Оносма способ применения и что лечит она: лекарственное растение, применение, отзывы, полезные свойства, противопоказания

Содержание

лекарственное растение, применение, отзывы, полезные свойства, противопоказания

Оносма – это род многолетних (в основном) травянистых растений из семейства Бурачниковые. Сюда относятся как двулетние, так и многолетние растения, полукустарники и полукустарнички. Все представители этого рода опушены жесткими сероватыми щетинистыми волосками и имеют цельные сидячие или линейно-ланцетные листья. Длина листьев варьируется от 3 до 5 см. В ширину листья могут достигать 0,5 см. Стебли у растения простые, в основании древесневеют.

Цветки у этих растений актиноморфные, а соцветия – цимозные. Они собраны в многоцветковые облиственные завитки. Венчики у всех представителей рода Оносма, как правило, окрашены в светло-желтый цвет, но бывают и беловатыми, и розовыми, и синими, и даже разноцветными – все зависит от вида травы. Плоды у этих растений представлены небольшими трехгранно-яйцевидными орешками длиной от 3 до 6 мм. Период цветения у каждого вида из рода Оносма – свой, однако, как правило, он начинается в мае, а заканчивается в середине июля.

Один из ярких видов рода – это оносма крымская, занесенная в Красную книгу. Является травянистым многолетником, опушенным, как и все представители рода, жесткими серыми волосками. В высоту достигает 40 см. Имеет прямостоячий стебель, очередные ланцетно-узколинейные листья. Цветы – опушенные, окрашены в желтый цвет, венчики имеют колокольчато-трубчатую форму и собраны в пониклое зонтичное простое соцветие. Плод оносмы крымской – серый орешек. Период цветения – май-июль.

Другой вид – оносма песчаная – является травянистым двулетником. Имеет одиночные стебли, покрытые жесткими волосками. Листья у этого вида имеют продолговатую форму и покрыты щетинками. Цветки у оносмы песчаной располагаются на стеблях кистями. Плод – орешек. Цветет растение, как и его сородичи, в мае-июле. Следующий вид – оносма бело-розовая – достигает высоты 20 см, отличается от других представителей рода своими большими цветками белого цвета с розоватым налетом. Период цветения этого вида приходится или на конец весны, или на начало лета.

С оносмой крымской схожа оносма башенная. Высота этого вида достигает 30 см. Цветы у нее полностью окрашены в лимонно-желтый цвет. Все растение испещрено жесткими щетинками. Период цветения выпадает на начало или середину лета. Следующий вид рода Оносма произрастает на огромных высотах над уровнем моря – это оносма многолистная. Ее цветы окрашены в ярко-желтые тона, а зеленые листья покрыты белой опушкой.

Многолетником (не двулетником) является оносма простейшая. Ее высота может достигать 40 см. Листья, как и у сородичей, имеют ланцетную продолговатую форму, а цветки крупные и собраны в соцветия. Плоды у этого вида темно-серые. Период цветения выпадает на конец весны и на все лето. Плоды у этого вида созревают с июня и до конца октября. Еще один сородич – это оносма зауральская. Она является двулетником. Ее высота не превышает 40 см. Цветы имеют желтый оттенок, стебли беловато-зеленые, более тонкие и слабые, если сравнивать их с другими видами этого рода. Цветение происходит с мая по июнь.

Аносма способ применения и что лечит она, оносма трава

Применение

За годы использования травы народные целители нашли лучшие варианты ее применения, чтобы максимально извлекать пользу для лечения разных заболеваний. Так, можно использовать рецепты с оносмой в чистом виде и в составах сборов для внутреннего и внешнего применения.

  • В качестве мочегонного средства можно использовать настой из трех больших ложек сушеной травы и 400 мл воды. Траву заливают, кипятят 5 минут и оставляют в тепле на 2 часа. Процедив, его пьют по четверти стакана два-три раза в день. Средство можно чередовать с отварами из —омелы—, которая также обладает сильным мочегонным эффектом.
  • От бессонницы и головной боли поможет настой из оносмы, донника и пятилистного пустырника. Их смешивают в пропорции 1:1:2, заливают стаканом кипящей воды и оставляют на пару часов. После процеживания лекарство пьют перед основными приемами пищи. А если часто мучают мигрени, то можно использовать настои из —очанки—, которая быстро снимает сильные боли.
  • От цистита и женских воспалительных болезней нужно пару минут прокипятить и настоять 3-4 часа 15 г травы в стакане воды. Принимают процеженное лекарство по две-три большие ложки каждые 5-7 часов.
  • При гипертонии и от жара отлично помогает настой из корней и надземной части растения. Для этого большую ложку сбора необходимо настоять на стакане кипятка пару часов. Процедив, лекарство пьют перед каждым приемом пищи по столовой ложке. А чтобы помочь правильной работе сердца, стоит приготовить отвар из олеандра, который укрепляет его и налаживает сердечный ритм.
  • В лечении бесплодия поможет порошок из травы. Его принимают по маленькой ложечке, смешав с таким же количеством меда три раза в сутки.
  • Трава оносма нашла свое применение и в лечении онкологии. Для уменьшения роста опухолей нужно залить 10 г сырья стаканом воды, прокипятить 5 минут и настоять еще 5 часов. Пить по 30 мл каждые 7-9 часов.

Оносма полезные свойства, заготовка, способ применения и выращивание простейшей, донской, — Офремонт

Перечень растений, удачно применяющихся сегодня в оздоровительных целях, такой большой, что усвоить названия любого из них бывает очень и довольно трудно.

Не удивляет, что мало кто слышал о траве оносме, которая, к слову, обладает немалыми лечебными характеристиками. Давайте намного больше выясним о характеристиках, пользе и использовании этого растения.

Ботаническое описание

Трава оносма относится к семейству Бурачниковых, соединяющих в себе травянистые, кустарниковые и полукустарниковые растения. На данный период времени выделяют несколько ее разновидностей, друг от друга отличающихся не только ботаническими параметрами, но и ареалом произрастания. Впрочем о каком бы виде не шла речь, каждый из них может использоваться для лечения того либо другого недуга. Все растения установленного рода имеют жёсткое серое, щетинистое опушение, а длина листовых пластин может изменяться в границах 3-5 см. Ширина их листьев в большинстве случаев может достигать 0,5 см, они размещаются на обычных, древесневеющих у самого основания стеблях.

В качестве плодов оносмы представлены относительно небольшие орехи яйцевидной формы с тремя гранями, достигающие по длине 3-6 мм.

Химсостав

К несчастью, о химическом составе данного растения есть очень минимум информации. Одно, что можно сказать, так это то, что оносма обладает одним из хемотаксономических признаков, отличительным и для множестве прочих растений из семейства Бурачниковых — присутствием в корневище литоспермовой кислоты.

Распространение

Растения установленного рода можно найти на Кавказе, территории Средиземного моря, уральских и южно-сибирских землях, в средней и юго-восточной Европейской части и даже в Средней Азии. Некоторые из видов оносмы присмотрели себе очень экзотичные места произрастания: каменистые участки горных холмов, скалы, леса и степные зоны с разреженным воздухом. В особенности, на скалистой местности Крыма произрастает один из очень востребованных видов — оносма крымская.

Востребованные виды

В роде многолетников и двулетников с названием «Оносма» сегодня насчитывается приблизительно 145 видов, однако чаще всего люди встречаются с крымской, песчаной, многолистной, самой простой, многоцветной, донской и красильной разновидностями. Более того, также известны широко зауральская, башенная и бело-розовая оносмы. Давайте выясним про них намного больше.

Самая простая

Данная разновидность, как и многие ее сородичи, считается многолетником, достигающим в высоту 40 см. У самой простой оносмы ланцетные, продолговатые листовые пластины и большие, соединенные в соцветия цветочки. Высота не ветвящихся цветоносов — 15-30 см. Начало цветения сходится с завершением весенней поры и длится до конца лета.

Созревание темно-серых орешков (по длине могут достигать всего 2-3 мм) происходит в период с начала июня до конца октября. Эта разновидность часто можно встретить в юго-восточной части РФ и в восточной части Украины.

На простейшую чуть-чуть похожа и оносма зауральская, разве что она считается двухлетним растением и имеет более слабые беловато-зеленые стебли. Цветение встречается начиная с конца весенней поры и до средины лета.

Многоцветная

Данная разновидность представлена двухлетними травами, в большинстве случаев с несколькими стебельками (до 6-ти). Высота многоцветной оносмы может достигать 1 метра, хотя могут встречаться и более очень маленькие экземпляры — от 20 см в высоту. Ветвление стеблей происходит до их средины и они все густо укрыты серовато-бурыми, тонкими волосками, хотя внизу опушение нередко имеет более оттенок белого, а вверху оно рыжее или жёлтое. Длина листовых пластин около 1-1,5 см, при ширине 2-12 мм. Находящиеся снизу листья более продолговатые и лопатчатые (на концах больше тупые), а верхние — продолговатые и ланцетные, у самого основания сидячие.

Соцветия многоцветной оносмы представлены сравнительно очень маленькими, но густыми завитками, а если в них есть плод, тогда они удлиняются и выпрямляются. Линейные и ланцетные чашелистики — относительно свободные, могут достигать по длине 7-11 мм, хотя после завершения срока цветения удлинятся намного больше, до 16 мм. Длина трубообразного венчика — 12-13 мм.

Он выделяется отогнутыми зубчиками формы треугольника и тройным окрасом: сначала палевым, потом розововатым или красноватым и на последок темно-синим. Пятимиллиметровые пыльники оносмы почти что не выпячиваются, в большинстве случаев соединяются только у самого основания и заканчиваются узкими придатками сверху. Вместе с другими частями растения они выполняют его прекрасным вариантом для декора индивидуальных участков.

Данная разновидность оносмы представленная полукустарниковыми растениями, достигающими в высоту 35 см. Белесые стебли — бесчисленные и цветоносные, с бесплодными побегами. Листовые пластины — ланцетные, со слегка завернутыми краями и густым опушением в виде прижатых щетинок. Соцветие донской оносмы бывает как простым, так и двойным завитым, с цветочками правильной формы. Чашечки у них, как правило, ланцетные, хотя в свободных частях больше ланцетно-линейные, достигающие длины 9 мм, при ширине 1,5 мм.

Венчики из сросшихся лепестков длиной 15-20 мм окрашены в бледно-жёлтый цвет. По всей части, не считая зубчиков, они голые, трубчато-воронкообразные. Цветение встречается в мае-июле. Длина плодоножек — шесть миллиметров, на них закреплен распадающийся плод с орешками, который созревает ближе к июлю-августу. Размножение донской оносмы (как правило) происходит семенным способом.

Исходя из названия такой разновидности, очень просто догадаться, где собственно ее можно повстречать: возле рек Дон и Северский Донец, а точнее в их средней и нижней части. В Украине также встречается по побережьям рек Сухая Волноваха и Крынка, хотя регион произрастания оносмы охватывает всю Донецкую, Харьковскую и Луганскую области. Образцовым субстратом для донской разновидности описанного растения будут открытые эродированные меловые, известняковые и мергелевые отслоения склонов, а еще пески, граниты, а порой и лесные песчаники.

Многолистная

Эта оснома представляет собой травянистое растение, достигающее в высоту 15-30 см. У него зеленые листовые пластины, покрытые белым шелковистым пушком, и ярко-жёлтые цветки. Размножение — семенное, хотя всхожесть семян тяжело назвать высокой.

Растение прекрасно чувствует себя на известняках, каменистых склонах и скалах, на высоте приблизительно 100-1000 м, над уровнем моря. В культуре этой оносме отведена декоративно-садовая роль.

Красильная

Еще одна двухлетняя трава, цветоносы которой могут достигать 20-70 см. Каждый экземпляр обладает несколькими прямостоячими, ветвящимися стебельками, которые по всей поверхности укрыты щетинками (длина 1-3 мм). Внизу находятся листья, их длина может достигать 3-15 см, при ширине 3-15 мм. Они все продолговатые, либо удлиненно-лопатовидные, восполненные на конце и у самого основания щетинками. Более того, опушение ощутимо на главной жиле и по краешкам листочков.

Соцветия красильной оносмы — сильно разветвленные, цветоножки могут достигать длины 1-2 мм, а длина прицветников фактически отвечает длине чашечки (с самого начала это значение отвечает 6-11 мм, однако в процессе роста и развития цветка становится больше до 12-20 мм). Венчик может достигать длины 8-12, порой 15 мм. В большинстве случаев он покрашен в бледно-жёлтый цвет, нередко восполненный пурпурными пятнами. Может быть голым или слегка опушенным, длиной около 1/3 длины чашечки.

Плоды растения представленные гладкими орешками, 3-4 м по длине. Цветение красильной разновидности приходится на май-июнь, после которого растение отмирает. Размножение — только семенное.

Отыскать эту разновидность можно на территории Причерноморья, Крыма, в определенных местах средней полосы европейкой части России (к примеру, в Воронежской и Белгородской областях).

Один из самых ярких представителей установленного рода, который не напрасно обозначен в Красной книге как исчезающий вид. Это долголетняя трава, как и другие ее сородичи, покрыта жёстким серым опушением, а высота ее составляет 40 см. Стеблевая часть — прямостоячая, листовые пластины — ланцетно-узколистные, размещены по очереди. Жёлтые цветочки, как и стебли, слегка опушены, венчики отличаются колокольчато-трубчатой формой и соединены в простой зонт, слегка опущенный вниз. Плод у такой разновидности оносмы представлен орешком сероватого цвета. Как и остальные, цветет растение с мая по июль. Конечно, родиной этой оносмы считается Крым, хотя она часто встречается и на Европейской территории.

На крымскую в большинстве случаев похожа башенная разновидность, вырастающая до 30 см. Ее цветочки имеют насыщенно-жёлтый цвет, а по всем частям отлично видна жёсткая щетинка. Цветение сходится с возникновением цветочков у крымской разновидности.

Хорошие свойства

В оздоровительных целях применяются все части оносмы, ведь и листы, и стебли, и цветочки растения оказывают крайне полезное влияние на различные органы и системы организма. Например, она выделяется отлично заметной мочегонной, успокоительной и гипотензивной способностью, из-за чего может улучшить работу ЦНС, артериальное давление, уменьшить проницаемость и повреждаемость сосудисто-капиллярной сетки. Кроме этого, оносма оказывает определенное миотропное влияние, понижая тонус гладких мышц органов находящихся внутри и расслабляя их.

В зависимости от определенного вида растения, можно говорить о тех либо других его свойствах. Так, если крымская разновидность имеет больше мочегонное и седативное влияние, то многолистный отличается ярко выраженными противовоспалительными, антимикробными и диуретическими качествами.

Приняв во внимание все это, очень просто догадаться, что самой ценной оносма будет во время лечения заболеваний мочевого пузыря, а именно трудностей с мочеиспусканием, и будет служить современным средством для укрепления сосудистой системы.

Использование

Как мы уже рассказывали, наиболее большое применение травы оносмы замечено в медицине, что можно вполне объяснить ее лечебными характеристиками. Но некоторые домохозяйки вполне удачно используют ее дома, решая домашние задачи. Давайте больше выясним о всех возможностях ее применения.

В медицине

В основном, трава оносма хорошо ценят именно в альтернативной медицине, правда сегодня уже можно найти Официальные лекарства, в их состав также входит это растение. Так, правильно приготовленный отвар поможет избавится от проблемы головных болей, гипертонической заболевания и повысит диурез, а все что необходимо просто залить 3 ст. л. измельченного растения 400 мл воды, прокипятив смесь в течение пяти минут на небольшом огне. Как только отвар отлично настоится (в большинстве случаев 2-ух часов более чем достаточно), его можно будет процедить и принимать по ? стакана трижды в день.

Для приготовления похожего отвара против бессонницы и гипертонической заболевания нужно перемешать пару растений, добавив к оносме зауральской лечебный донник и пятилистный пустырник, в расчете 1:1:2 столовые ложки и залив кипятком (1 стакан) на несколько часов. Готовый настой процеживают и употребляют каждый раз перед приемом пищи трижды в день.

К слову, зауральские целители применяют во время лечения лишь местную, зауральскую оносму, используя ее для создания отваров от мигреней и увеличения диуреза. В то же время, растения-представители самой простой разновидности помогают уменьшить артериальное давление, увеличить сердечную амплитуду, углубить дыхание и оказывают противолихорадочный и жаропонижающий эффекты.

На данное время использование оносмы в бытовых задачах и целях не очень широко, как в медицинских целях, но наряду с тем нужно подчеркнуть ее красящие способности. Корни этого растения — неплохой настоящий краситель, с помощью которого можно не прилагая больших усилий дать каждой вещи красный цвет.

В гинекологии

Считается, что оносма может удачно использоваться с целью устранения гинекологических проблем, что в большинстве случаев поясняется ее мочегонным, антибактериальным и противовоспалительным влиянием.

Так, при помощи данного растения можно бороться с циститом и воспалительными процессами во влагалище, а все, что необходимо настоять или кипятить смесь десяти грамм высушенной травы и стакана жидкости (принимать по 2-3 столовые ложки через каждых 6-8 часов).

Противопоказания и негативные действия

Не обращая внимания на все собственные оздоровительные свойства, как и у любой иной травы, у оносмы есть конкретные противопоказания к ее использованию. Благодаря этому, перед тем как назначать себе терапию с применением самого растения или препаратов на его основе, необходимо обязательно пройти консультацию с доктором.

Оносма выделяется очень сильным влиянием на организм человека, что по истечению определенного времени может привести к разным сбоям в его работе. Благодаря этому, в первую очередь, ее использования стоит остерегаться людям, с индивидуальной чувствительностью к составляющим компонентам растения, беременным и кормящим представительницам слабого пола и детям до 12 лет. При значительных заболеваниях мочеполовой системы приготовление каждого целебного настоя должно быть согласовано с лечащим доктором, иначе не нужно исключать осложнение состояния.

Среди нежелательных эффектов от использования оносмы необходимо отметить реакции аллергии и потенциальную отечность слизистых оболочек, хотя последнее отличительно как правило исключительно при передозировке и наличии больших проблем с отдельными органами.

Выращивание

Узнав о целебных свойствах того либо другого растения, большинство людей очень хотят обзавестись таким «помощником» у себя на участке, но чтобы он прижился и на самом деле раскрыл весь собственный потенциал природы, ему необходимо создать прекрасные для данного условия. Оносма — не исключение в данном плане, благодаря этому давайте выясним о требованиях растения к составу почвы, месту посадки и остальных особенностях выращивания.

Почва и удобрения

Грунт и его питательность — ключевые составляющие успешного процесса выращивания оносмы. В таком случае идет речь о легких суглинистых или почвах где есть песок, с нейтральной или слабощелочной реакцией и хорошей системой дренажа. В каких-нибудь специализированных подкормках растение не нуждается, но для поддержки его отличного состояния в почву полезно вносить гашенную известь.

Выбор места и освещения

Образцовым местом для выращивания оносмы станут укрытые от ветра и отлично освещенные солнцем участки территории. Резкие порывы ветра, как и попадание существенного количества осадков, могут очень отрицательно отразиться на состоянии растения, благодаря этому если понадобится, с ветреной стороны его лучше чем-то изолировать.

Режим температур

Оносма прекрасно чувствует себя в средней климатической зоне, однако в особенно холодные зимы может умереть. Благодаря этому, если летом (с температурой до +30°C), растение себя будет чувствовать более-менее хорошо, то в зимний период, когда столбы термометров опускаются меньше нуля, его придется прятать, дополнительно защищая от холода особенными материалами (к примеру, спандексом или обыкновенной мешковиной).

Посев и размножение

Размножение оносмы может делаться 2-мя очень популярными способами: высевом в грунт семян и высадкой заблаговременно заготовленных черенков, возможно, порезанных с дикого растения. Конечно, в каждом из данных случаев будут собственные характерности выполнения процедуры.

Семенное размножение — самый обычный вариант получения оносмы у себя на участке. Для этого только лишь стоит прорастить сеянцы в индивидуальных горшочках, при температуре 20 градусов, а потом посадить их на постоянное место произрастания. Высев семян в большинстве случаев выполняют весной, применяя под эти цели легкий и увлажненный субстрат, хотя нередко посадку проводят в осеннее время, что именуется «под зиму».

Данный вариант замечательно подойдет для летнего разведения оносмы, путем начальной высадки черенков в парник. Их срезают с пришествием первого устойчивого тепла и укореняют в затененном месте, на что понадобиться не менее 10-12 дней. Стоит выделить, что для средней климатической полосы данный вариант менее успешный, чем первый, так же как и при отсутствии должного уровня температур, укоренение материала для посадки будет очень проблемной задачей.

Полив и влажность

Оносма не сильно любит влагу, а переизбыток воды у корневой системы и совсем может ее погубить. Благодаря этому полив необходимо проводить только в очень жаркие летние дни, чтобы избыток влаги быстро выветрился из почвы. Более того, уберечь корневую систему растений от гниения поможет и организация хорошей специальной водоотводной конструкции. С пришествием осени поливы уменьшают, а в дождливое время и совсем отменяют.

Заболевания и вредители

Оносма выделяется достаточно крепким «здоровьем» и при выращивании в саду вредители и заболевания ей нестрашны. Но в тепличных условиях растение нередко поражает тля и белокрылки, нападающие на молоденькие саженцы или черенки с уже показавшимися листьями.

Заготовка полезного сырья

Все части растения, при правильной заготовке и применении, бывают очень полезны, ведь и цветы, и листы, и стебли обладают хорошим запасом главных для организма веществ. Заготовкой оносмы начинают заниматься в срок цветения и буйства растения, выбирая для этого сухой и безветренный день. Сушка собранного сырья делается в темном, отлично проветриваемом месте, после этого его помещают в пакеты из бумаги и оставляют в отлично вентилируемых и сухих помещениях со средними показателями температуры. В подобных условиях срок хранения оносмы в большинстве случаев будет примерно 1 года.

Способ использования

Некоторые востребованные рецепты альтернативной медицины с использованием оносмы уже выше были упомянуты, но в действительности их есть гораздо выше, ведь здесь все может зависеть от определенного недуга и свойств его направления. Вот еще несколько популярных вариантов использования установленного растения.

Освободится от лихорадки и упростить течение гипертонической заболевания поможет настой из столовой ложки измельченной оносмы и стакана горячей воды, которые после смешивания оставляют для настаивания в течении 2-х часов. Готовое средство процеживают, а потом употребляют по 1-2 ст. ложки перед приемом пищи.

При бесплодии представительницам слабого пола рекомендуют применять растение, заранее измельченное до порошкообразного состояния. Для этого высушенные части оносмы перепускают при помощи мясорубки (можно наряду с веточками), а потом готовый порошок принимают трижды в день за 30 минут до еды, заранее смешав с 1 чайной ложечкой меда.

Разумеется, кому-то приведенные рецепты сразу справяться с трудностью, а кому-то понадобиться более серьезное лечение, с использованием оносмы только в качестве дополнительного средства. Но, не обращая внимания на неизвестность финишного результата, пользу описанной травы для организма человека опровергать не имеет смысла, благодаря этому после консультации со своим лечащим доктором можете довериться и альтернативной медицине.

#Оносма Instagram posts (photos and videos)

🌸Компания “Бадр Маркет” которая заботится о вашем здоровье, приготовила для вас яркую новинку 🌿”Травы Жизни” 🌿из серии женское здоровье. ♥️В этой яркой новинке собрана увлекательная☺️ коллекция трав🌿 которые позаботятся о вас на протяжении всей жизни. ♥️Ведь в течении всей жизни мы часто сталкиваемся с такими заболеваниями как : воспаление, зуд,эрозия,кольпит,вагинит,болезненные менструации, молочница и многое другое🤦🏼‍♀️ 🌹🌹🌹Новинка 🌸”Травы жизни”🌸 поможет преодолеть эти лёгкие невзгоды😌 благодаря своему заботливому составу, в который входят: 🌿 Красная щётка 🌿 Боровая матка 🌿 Оносма 🌿 Грушанка 🌿 Шалфей 🌿 Зимолюбка 🌿 Кыст аль-хинди 🌸 “Травы жизни”🌸 – оказывает на организм комплексное действие, этот сбор трав демонстрирует противоопухолевый, противовоспалительный, антибактериальный, спазмолитический, противомикробный, болеутоляющий эффект, улучшает состояние крови. 🌸 В этом вы убедитесь сами если пройдитесь вместе с нами по нашему маленькому но весьма полезному саду и ознакомившись с каждым растением, вы узнаете как они воздействует на наш прекрасный женский организм. ☘️ Красная щётка – применяется для профилактики и лечения заболеваний доброкачественных новообразований: миом, аденом, фиброаденом, папиллом, полипов. Так же она применяется при женском бесплодии🤰🏻, фригидности, заболеваниях щитовидной железы, нарушениях цикла, раннем климаксе, мастопатии, поликистоз, кисты, фибромиома,кольпит, эндометрит,маточное кровотечение, инфекционные заболевания(очищает кровь). ☘️ Боровая матка – лечебные свойства боровой матки уникальны, стабилизируется настроение 😄, не мучает пресловутый предменструальный синдром 😒,уходят боли при менструациях, лечится бесплодие и снимается угроза самопроизвольного выкидыша при беременности. Когда повышается уровень прогестерона — увеличивается шанс забеременеть🤰🏻 снижается риск выкидыша, и токсикоз намного легче проходит, способствует нормализации сна, укреплению кровеносных сосудов, в том числе и сосудов сердца💓, стабилизируется артериальное давление, разжижается кровь. ☘️ Оносма – является мочегонным, антибактериальным и противовоспалительным воздействием Цена 950₽ #травыжизни #бадр #оносма

Лечит и калечит: как правильно употреблять крымские травы

СИМФЕРОПОЛЬ, 5 июн – РИА Новости Крым, Ольга Леонова. Лекарства бывают разные. В том числе и такие, которые мы за лекарства не считаем. Растет себе что-то невзрачное, а на деле – лекарство. А бывает и так, что, порадовавшись приятному виду и вкусу, мы употребляем в пищу то, что нельзя употреблять так часто. Потому что это тоже – лекарство, а не еда.

Розовые, синие, с рисунками чаек и гор, бухт и дворцов. “Крымский чай”, “Целебные травы” гласят не менее красивые буквы на упаковках. Продавцы нахваливают свой товар – “только с гор прямо к вам в чашку!” Стоит ли верить маркетингу и бабушкам-травницам на рынке или лучше поверить врачам? Давайте разбираться.

Первый магазин крымских товаров “Крымское подворье” в Подмосковье.

Профессор, доктор медицинских наук Наталья Мирошниченко 15 лет проработала завкафедрой нетрадиционной медицины в Крымском медицинском университете. Она категорически против “травяного маркетинга”.

“Рынок пересыщен травяными чаями якобы из Крыма. Даже если это и так, то оказывается, что наша Красная книга затоптана туристами и выкошена травниками. Например, такие травы как ятрышник, мощнейшее кровоостанавливающее средство, эндемик Крыма полынь крымская, используется для регуляции функций нервной системы. Их сегодня вырывают с корнями”, – сетует Наталья.

И правда, после того, как Крым стал в России моден, слишком много появилось на прилавках чаев, а на обочинах дорог – продавцов с наборами трав для заваривания, собранными неизвестно где, когда и кем.

Обернули, подержали: как грязь может помочь и навредить”У предпринимателей, которые собирают эти травы, в том числе и по заповедникам, должны быть допуски на сбор. Должны быть сертификаты качества на отсутствие в зонах сбора отходов жизнедеятельности животных и людей, должна быть экспертиза на содержание тяжелых металлов, – поясняет специалист. – Кто у продавцов спрашивает эти документы? В итоге в погоне за здоровьем мы можем получить не лечебный настой, а концентрированный яд. На красивой упаковке можно написать что угодно”.

Доктор говорит, что сама покупает травяные сборы исключительно в аптеках. А если и берет травы для самостоятельного смешивания, то только после консультации с докторами.

Безобидный на взгляд рядового покупателя сбор может навредить, потому что включает в себя травы со взаимоисключающим на организм действием.

Кроме того, все собранные растения должны быть заготовлены, сохранены и применены по правилам. 

“Если высушивать растения на солнце, то уже через три часа в сырье останется только две трети эфирного масла. Сырье должно высушиваться и храниться только в закрытом, прохладном месте без проветривания и посторонних запахов. К примеру, это чердак. Но никак не курятник или коровник”.

В домашних условиях Наталья рекомендует хранить травы в бумажных пакетах или стеклянных банках с прикрученной крышкой. И обязательно маркировать – где растение собрано, в какое время, в каком году.

Нужно и правильно использовать травы. Чай заваривается 5-7, настой – 7-15 минут, так как после 20 минут заваривания все без исключения травы начинают выделять в воду дубильные вещества, они затрудняют всасывание питательных веществ и могут отягощающе действовать на слизистые желудочно-кишечного тракта.

Профессор еще раз напоминает, что травы – это натуральный источник мощных природных фитокомпонентов, с которыми нужно обращаться очень осторожно. К тому же отдельные части растения собирают в разное время года, и это тоже нужно учитывать.

Чаепитие. В заварниках – отвары из крымских трав

Эффект от трав бывает достаточно сильным. Именно поэтому все травки, которыми вы хотите лечиться, давать своим близким и особенно детям, стоит употреблять только после консультации с врачом. Три чашки любого травяного чая в день – это уже лекарство! Опять же, например, в сочетании с антидепрессантами зверобой может вызвать приступы сильной головной боли. Его не используют при гастрите и повышенной температуре, эхинацею не рекомендуется употреблять с противогрибковыми препаратами. Мята категорически противопоказана людям с пониженным артериальным давлением и склонностью к изжоге.

Окопник, эфедра, кора ивы, чистотел в микродозах содержат ядовитые и токсичные вещества, это – только лекарство, но никак не чаи. И перед употреблением всех без исключения трав аллергопробы – обязательны.

Какое растение может применяться при пневмониях и Covid-19:

Солодка голая. Использовалась в фитотерапии китайской медицины как онкостатик. Это мощнейший иммуномодулятор и очень хорошее отхаркивающее средство. Используется в медицине для восстановления функций дыхания.

Шалфей луговой. Мощное противовоспалительное средство. Обладает ранозаживляющим действием. Основные заросли – на Чатыр-Даге, Аю-Даге, Ай-Петри и Кара-Даге.

Какие травы можно собирать в Крыму в июле:

Лаванда. С ней надо быть очень аккуратным аллергикам, особенно тем, у кого аллергия проявляется в виде кашля. Масло лаванды отлично заживляет ожоги, восстанавливает эпителий, регенерирует без стяжек и рубцов.

Лимонник, чабан-чай, или татар-чай. Эндемик Крыма. Считается одним из шести растений-тоников. Издревле крымские татары добавляли измельченный порошок чабан-чая в тесто для хлеба и лепешек. Дает хорошую иммунную и сосудистую реакцию организма, используется наружно при кожных заболеваниях.

Чабрец. Его нужно собирать только ранним утром, но без росы: содержащиеся в чабреце вещества могут на жаре частично “спрятаться” в корень. В виде отвара обладает отхаркивающим, муколитическими функциями, но у аллергиков может вызывать бронхоспазм, а у язвенников – обострения.

Цикорий. Цветы цикория заваривают при головокружениях, вегетативной дистонии. Стебли в спиртовых растворах используют для восстановления связочного аппарата. В октябре собирают корни, которыми лечат заболевания поджелудочной железы и излишнее пристрастие к сладкому, а также восстанавливают кишечную флору, так как корень цикория содержит инулин.

Розмарин. Отличная приправа и одновременно помощник в восстановлении кишечной, желудочной флоры, “природный фестал” помогает при переваривании мясных блюд, стимулируя выделение желчных кислот.

Производство лекарственных препаратов на фабрике

Какие растения можно пить как чай без последствий:

Земляника. Полезна для повышения иммунитета, убирает слизь из тонкого кишечника мощное мочегонное и противовоспалительное средство, восстанавливает почечную ткань  и даже помогает растворять оксолаты. Корень земляники использовался в традиционной русской фитотерапии для лечения пиелонефритов.

Ежевика дикая. Кладезь цинка. Способствует регуляция иммунитета и стабилизации гормонального фона как у мужчин, так и у женщин. Регулирует состояние нервной системы. Стабилизирует гормональный фон щитовидной железы у женщин в период полового созревания и климакса.

Вишня. Черенки вишни – это самое лучшее, что может придумать природа для регуляции иммунитета. Черенки собрать по 20 штук, высушить в пучках и добавлять мелко измельченными в чай.

Малина и смородина. После сбора урожая необходимо состричь верхние листики малины или смородины – первые 10-15 см от верхушки. Связать по 10-15 листиков и высушить. Для чая подходят все виды смородины.

Крапива. Собирать проще всего с помощью тканевой рабочей рукавицы. Необходимо брать верхушки на ширину ладони. Из крапивы можно делать борщи и пироги, а остальное сушить на зиму. Настой этого растения – мощное противоаллергическое средство, муколитик. Из настоя можно сделать ледяные кубики и протирать лицо – помогает от кожных аллергий и угревых высыпаний у подростков.

 

Как избавиться от бородавок или папиллом

Бородавки и папилломы могут появляться на теле любого человека. Возбудителем этого заболевания является вирус папилломы человека. В здоровый организм вирусу попасть сложно, поэтому, кроме выполнения требований личной гигиены, пристальное внимание нужно уделить состоянию иммунитета.

Если не предпринимать никаких действий для лечения бородавок и папиллом, они начинают увеличиваться в размерах, разрастаться, образовывать целые колонии. Появляться они могут в разных местах: на шее, плечах, руках, ногах, даже половых органах. Для некоторых людей бородавки и папилломы приносят огромные неудобства, расположившись на самых видных местах. Как же избавиться от них?

Лечение

Сразу стоит сказать, для того, чтобы избавиться от этих образований навсегда, просто удалить их будет недостаточно. Если иммунная система так и останется слабой, вирус вернется. Поэтому необходимо пройти курс лечения, направленный на укрепление иммунитета. Разновидностей папиллом существует множество, и только врач может подобрать действенный препарат, после проведения надлежащего обследования. Подробнее об эффективных средствах можно почитать здесь.

На данный момент в аптеках можно найти множество различных средств для удаления бородавок и папиллом. Какое из них лучшее, определить невозможно. Для кого-то эффективным окажется один препарат, для кого-то он не окажет никакого действия. Поэтому назначение делает врач, исходя из результатов диагностики, общего состояния здоровья больного, наличия сопутствующих заболеваний. Существует несколько методов избавления от новообразований:

• механический метод;

• медикаментозное лечение;

• лечение растительными препаратами.

Механический метод предполагает лечение с помощью электротока и высокой температуры (электрокоагуляция), при помощи жидкого азота (криотерапия), либо с помощью лазерных лучей (лазеротерапия).

Медикаментозное лечение можно разделить на такие группы:

• Таблетки. Так как заражение вирусом происходит по причине снижения иммунитета, действие этих средств направлено на повышение защитных свойств организма. То есть, иммуномодулирующие средства, противовирусные лекарства, витаминные препараты. Иногда после приема этих средств бородавки и папилломы исчезают сами, без применения других препаратов.

2. Препараты для местной обработки:

• кремы и мази, оказывающие противовирусное действие: виферон, оксолиновая мазь, крем Имиквимод и другие;

• гели противовирусного действия, стимулирующие выработку интерферона. Например, гель Панавир, уничтожающий корень образования;

• растворы, которые бывают масляными, щелочными, кислотными. Они обладают прижигающими свойствами, для удаления бородавок у детей эти средства обычно не используются. Это такие препараты, как ферезол, колломак, йод и др.;

• пластыри, одним из самых популярных из них является салипод, действующим веществом которого является салициловая кислота;

• карандаш на основе ляписа, оказывающий прижигающее действие. Его не используют для выведения наростов на лице, потому как средство оставляет рубцы.

3. Лечение растительными препаратами пользуется популярностью ввиду натуральности их состава, отсутствия побочных проявлений. Среди них можно назвать такие:

• Папилайт, в составе которого только натуральные активные компоненты, такие, как экстракт чеснока, красного перца, прополиса, сока топинамбура и множества других ингредиентов, действие которых направлено на удаление наростов и укрепление иммунной системы. Подробнее о средстве -http://netderm.ru/papilayt/

• Папилюкс, в состав которого входят чеснок, перец чили, рододендрон, прополис и множество других растительных компонентов. Препарат разрушает образования, останавливает распространение вируса, стимулирует работу иммунной системы. Натуральные препараты можно применять без опаски даже детям. Подробнее о препарате -http://netderm.ru/papillux/

Не забывайте о том, что только комплексный подход к лечению бородавок и папиллом позволит избавиться от них навсегда. Поэтому наряду с удалением внешних проявлений болезни нужно укреплять защитные свойства организма.

Цисто Cisto 60табл, Sangam Herbals, при мочекаменной болезни

Гармоничное сочетание целебных растений, входящих в состав Цисто, создает синергию трав, которые дополняют и усиливают взаимное действие. Благодаря этому, Цисто является эффективным средством для оздоровления почек и мочеполовой системы.

Обладает следующими свойствами: оказывает выраженное противовоспалительное, противомикробное и мочегонное действие, улучшает кровообращение органов малого таза и мочеполовой системы. Эффективно очищает почки, выводит песок, камни, препятствуя их повторному образованию. Качественно улучшает   состав мочи: уменьшая содержание кальция, щавелевой кислоты и гидроксиполина, что снижает вероятность образования песка и камней в органах мочевыделительной системы.

Активные компоненты Цисто обладают антисептическим, противовоспалительным и спазмолитическим эффектом, что позволяет снизить болезненные ощущения при мочеиспускании.

Активные ингредиенты:

  • Двуплодник стебельковый (Didymocarpus pedicellata) – обладает мягким мочегонным действием.
  • Камнеломка язычковая (ligulata Saxifraga)  оказываетмочегонное, вяжущее, противомикробное действие, уменьшает раздражение. Способствует растворению камней в почках, мочевом пузыре. Предотвращает и борется с мочеполовыми инфекциями.
  • Гокшура (Tribulus terrestris) – одно из лучших растений для здоровья мочеполовойсистемы: прекрасно справляется с различными инфекциями, обладает выраженным противовоспалительным и антибактериальным эффектом, выводит камни из почек, излишнюю жидкость из организма, нормализует состояние мочеполовой системы, восстанавливает эректильную функцию, лечит бесплодие, считается мощным афродизиаком. Действует как тонизирующее средство при почечных заболеваниях, омолаживая ткани. Гокшура полезна при аденоме простаты, особенно эффективно она действует в сочетании с Ашвагандой. Способствует оздоровлению и тонусу мочеполовой системы. Помогает также при болезнях печени и суставов, восстанавливает баланс Вата-доши.
  • Марена сердцелистная (Rubia cordifolia) – содержит антрахиновые гликозиды, а также руберитриновую кислоту, которая растворяет оксалатные камни. Оказывает вяжущее и мочегонное действие.
  • Сыть пленчатая (Cyperus rotundus) – прекрасныйобщеукрепляющий тоник для всего организма. Применяется при общей слабости, для очищения от шлаков и токсинов, при бронхолёгочных заболеваниях. Обладает выраженным антиоксидантным, противомикробным, обезболивающим, и противовоспалительным эффектом, а также успокаивающими, охлаждающими свойствами.
  • Соломоцвет шероховатый (Achyranthes aspera) – обладает мочегонным и спазмолитическим действием, улучшает процессы обмена веществ.
  • Оносма многолистная (Onosma bracteatum) – обладает противомикробным, мочегонным, противовоспалительным, жаропонижающим, седативным эффектом. Регулирует отток мочи при нарушениях мочеиспускания (странгурии).
  • Вернония пепельная (Vernonia cinerea) – оказывает спазмолитическое, жаропонижающее действие, улучшает обмен веществ. Восстанавливает нормальное мочеиспускание, особенно эффективна при проблеме недержания мочи.
  • Кратева нурвала (Варуна, Crataeva nurvala) – признанное эффективное средство для очистки почек: предупреждает образование камней в почках и желчном пузыре, выводит печеночные и почечные камни, обладает противовоспалительным, мочегонным действием, тонизирует стенки сосудов. Улучшает кровообращение, лимфоток в органах малого таза.
  • Боерхавия розлогая (Boerhavia diffusa) – действенное противовоспалительное средство, расаяна. Ценится как противоотечное, диуретическое средство. Восстанавливает нормальную работу почек, тоник для мочеполовой системы. Очищает кровь и лимфу, устраняет застой в печени, повышает гемоглобин, тонизирует стенки сосудов.
  • Гуггул (Commiphora mukul) –  обладает мощными очищающими свойствами, нормализует функцию почек, выводит камни и песок из почек, абсорбирует шлаки, токсины, тяжелые металлы. Благодаря такому глубокому очищению, происходит омоложение организма и повышение эффективности работы жизненно важных систем. Гуггул нормализует обмен веществ, снижает уровень холестерина, стимулирует работу щитовидной железы. Приводит в норму количество лейкоцитов, подавляет развитие опухолей, снимает отеки. Обладает синергичной способностью объединять и приумножать целебные качества всех ингредиентов препарата, в состав которого входит.

Рекомендуется к применению:

  • при мочекаменной болезни – активен для выведения фосфатных, оксалатных камней, уратов
  • кристаллоурии
  • для профилактики мочекаменной болезни
  • при инфекциях мочевыводящих путей, цистите (воспаление мочевого пузыря), пиелите (воспаление почечных лоханок)
  • при нарушениях мочеиспускания (странгурии)
  • при подагре
  • слюннокаменной болезни

Противопоказания:

  • индивидуальная непереносимость компонентов;
  • крупный размер камней в почках, которые при прохождении через мочевыводящие пути могут вызвать их закупорку.

Показания по Аюрведе:

  • здоровье мочеполовой системы
  • мочекаменная болезнь
  • нарушения мочеиспускания

Способ применения:

Взрослым   –   по 1-2 таблетки два-три раза в день через полчаса-час после еды, обильно запивая теплой водой.  Курс приема может составлять от 4-х до 6-ти месяцев.

Важно! В период приема Цисто выпивать не менее 2,5 л воды в течение дня для более легкого и безболезненного выхода песка , камней из почек и во избежание травматизации мочевыводящих путей.

Состав:

Цисто каждая таблетка содержит 750 мг (двуплодник стебельковый (Didymocarpus pedicellata), марена сердцелистная (Rubia cordifolia), сыть пленчатая (Cyperus rotundus),  соломоцвет шероховатый (Achyranthes aspera), оносма многолистная (Onosma bracteatum), вернония пепельная (Vernonia cinerea), кратева нурвала (Crataeva nurvala), боерхавия розлогая (Boerhavia diffusa), якорцы стелющиеся (Tribulus terrestris), камнеломка язычковая (Saxifraga ligulata), ячмень (Barleys), бальзамодендрон млечный (Commiphora mukul)).

Данное средство не является медицинским препаратом. Перед употреблением рекомендуется проконсультироваться соспециалист по аюрведе.

Обзор фитохимии и этнофармакологии

Pharmacogn Rev. 2013 июл-декабрь; 7 (14): 140–151.

Нирадж Кумар

Фармацевтический факультет Инженерно-технологического колледжа Шри Рам Мурти Смарак, Барейли, Уттар-Прадеш, Индия

Раджниш Кумар

Фармацевтический факультет, Шри Рам Мурти Смарак Колледж инженерии и технологий , Уттар-Прадеш, Индия

Камал Кишор

1 Аптечный департамент, М.Университет Дж. П. Рохилкханда, Барейли, Уттар-Прадеш, Индия

Фармацевтический факультет, Инженерно-технологический колледж Шри Рама Мурти Смарака, Барейли, Уттар-Прадеш, Индия

1 Фармацевтический факультет Университета Барейлкханда MJP , Уттар-Прадеш, Индия

Адрес для корреспонденции: Г-н Нирадж Кумар, Фармацевтический факультет, Инженерно-технологический колледж Шри Рам Мурти Смарак, Найнитал-роуд, Барейли – 243 202, Уттар-Прадеш, Индия.Электронная почта: [email protected]

Поступила в редакцию 4 апреля 2013 г .; Пересмотрено 10 мая 2013 г .; Принято 25 октября 2013 г.

Это статья в открытом доступе, распространяемая в соответствии с условиями лицензии Creative Commons Attribution-Noncommercial-Share Alike 3.0 Unported, которая разрешает неограниченное использование, распространение и воспроизведение на любом носителе при условии, что оригинальная работа находится в надлежащем виде. цитируется.

Эта статья цитируется в других статьях в PMC.

Abstract

Род Onosma L. ( Boraginaceae ) включает около 150 видов, распространенных по всему миру, из которых только около 75 растений были описаны по его морфологии и менее 10 растений по их химическим компонентам и клиническому потенциалу.Фитохимические отчеты этого рода свидетельствуют о том, что он состоит в основном из алифатических кетонов, липидов, нафтазаринов, алкалоидов, фенольных соединений, нафтохинонов, флавонов, в то время как наиболее важными из них являются шиконины и оносмины. Растения традиционно используются как слабительное, глистогонное и алексифармическое средство. Растения также одинаково используются при заболеваниях глаз, крови, бронхите, болях в животе, зловонии, жажде, зуде, лекодермии, лихорадке, ранах, ожогах, геморрагиях и мочевых камнях. Цветки различных растений назначают в качестве стимуляторов, кардиотоников, при отеках тела, а листья используются как слабительное и при кожных высыпаниях.Корни используются для окрашивания пищевых продуктов, масел и окрашивания шерсти, а также в лекарственных препаратах. Этот обзор подчеркивает распределение, морфологию, фитохимические составляющие, этнофармакологию, что может помочь в будущих исследованиях.

Ключевые слова: Алканнин, гистидон, нафтохиноны, ратанджот, шиконин

ВВЕДЕНИЕ

Род Onosma L. ( Boraginaceae ) представляет около 150 известных видов в Азии [1], в том числе 29 видов в Китае, [2] ] 95 видов в Турции [3] и 8 в Пакистане, [4] но недавние исследования и пересмотры увеличили количество видов этого рода до более чем 230 видов.[5] Название onosma для этого рода было введено в современную ботаническую номенклатуру Линнеем, которое происходит от латинского слова «osma», происходящего от греческого слова «osma», что означает запах. [6] Все виды растут в сухих или влажных и солнечных местах обитания, обычно в расщелинах скал и широко известных как растения альпинария [3].

Onosma L. – это богатый видами род со сложными морфологическими, кариологическими вариациями и таксономическими трактовками внутри групп этого рода, которые вызывают большие споры.Многие похожие виды были описаны на основе незначительных морфологических различий, и поэтому их часто путали. Кроме того, в Европейском регионе их распределение довольно фрагментировано, и классификации часто делаются на основе географически ограниченных исследований [7], которые кажутся частично искусственными, и существует необходимость в повторном исследовании, которое могут дать новые данные. полезная ссылка в будущей классификации. [3] Согласно «Списку растений» Королевского ботанического сада, Ботанического сада Кью и Миссури, он включает 387 научных названий растений, относящихся к этому роду, из которых только 37 являются общепринятыми названиями видов, а 19 научных названий растений имеют инфра-специфический ранг.Этот список также показывает, что только 9,6% имен принимаются, 6,2% имен являются синонимами, а 84,2% имен все еще не оцениваются.

РАСПРОСТРАНЕНИЕ

Onosma L. включает многочисленные виды, распространенные в Азии, Евразии, Средиземноморье и Европе, главным образом в Иране, Сирии, Турции, Китае, Пакистане, Индии и Шри-Ланке и т. Д. Этот род был разделен на три разделы, названные Onosma , Protonosma и Podonosma, а раздел Onosma были дополнительно разделены на два подраздела asterotricha (Boiss.) Gurke и Haplotricha (Boiss.) Gurke. [3,8] Во флоре региона Ираника, 39 видов растут в Иране [9], в то время как Анатолия является важным центром происхождения Onosma , включающего около 95 видов, 48 из которых и один истины являются эндемичными для Турции. [10]

В Швейцарии род Onosma представлен двумя редкими видами, населяющими известняковые степные луга, один – Onosma helvetica (A. DC.) Boissier, расположенный в Оллон (VD) и в Верхнем Вале, и второй – Onosma pseudoarenaria Шур распространен в центральном Вале.[11]

В Румынии Onosma visianii Clementi распространены в основном в бесплодных местах Добруджи, степи, на известковых почвах, а Onosma setosum Ledeb., Onosma arenaria Waldst. et Kit., O. pseudoarenaria Schur и Onosma viride (Borb.) Jav. являются эндемичными, распространены в бесплодных регионах, таких как Клуж, Хунедоара и Плоешти, Onosma taurica Pall. ex Willd. Распространяется в каменистых, травянистых и известняковых районах от Тимишоары и Констанцы.Теппнер насчитывает только Onosma heterophylla (sin. viride ), Onosma helveticum Boiss. распространение в Трансильвании, Onosma lypskyi, O. visianii Clementi, O. taurica Pall. ex Willd., Onosma rigida Ledeb. Распространен в Добрудже и О. arenaria Вальдст. et Kit. замечен в дельте Дуная, без упоминания O. pseudoarenaria Schur. в то время как в Трансильвании это единственный существующий вид [12].

Кроме того, Джонстон (1954) изучил световую микроскопию пыльцы 45 видов Onosma [13], а Куреши и Кайзер (1987) изучали характеристики пыльцы 9 растений [14], в то время как Maggi et al .(2009) изучили морфологию пыльцы пяти видов Onosma [15]. Бинзет и Акчин (2011) также сообщили о характеристиках пыльцы около видов Onosma в Турции [16] и недавно Mehrabian et al . (2012) был проведен численный анализ характеристик пыльцы у 24 видов Onosma , произрастающих в Иране, и попытался оценить полезность палинологических данных в таксономии рода, а также использовать эти данные для иллюстрации видового сходства [17].

Анатомические и экологические свойства около видов Onosma были изучены [18] Акчином (2004), Акчином и Энгином (2005).[19] Бинзет и Оркан (2009) исследовали анатомическое строение и палинологические характеристики Onosma roussaei DC. и Onosma giganteum Lam. [20] в то время как количество хромосом различных видов Onosma было сообщено Теппнером в 1981 и 1988 годах. [21,22] Микроморфология орешков около видов Onosma также была изучена Акчином в 2007 году [23]. Распространение некоторых видов обобщено в.

Таблица 1

Распространение растений рода Onosma L.

МОРФОЛОГИЯ

Род Onosma L. содержит двулетние или многолетние травы, шероховатые, с черешковыми или сидячими листьями по всему краю. Цимы скорпиоидные, одиночные на вершине стебля, а ветви, образующие метелку, у плодов обычно удлиненные, прицветные. Цветки актиноморфные, на цветоножках или сидячие, чашечка с раздельными или близкими к основанию 5 лопастями, линейными или линейно-ланцетными, равными и обычно увеличенными после цветения. Венчик синего, желтого, белого или красного цвета, трубчатый с колокольчатым или ретророзным с коническим и обычно постепенно расширяется от основания вверх, горло не прикреплено, в то время как нектарники кольцевидные или лопастные с зубчатым краем.Пыльники сбоку смыкаются в трубку или сагиттат, который является прозрачным и вырезанным со стерильной вершиной. Стиль включен или слегка подчеркнут головчатым клеймом. Гинобаза плоская с 4-мя орешками, прямостоячая, яйцевидно-треугольной формы, примерно одинаковой длины и ширины, ребристая по оси и слегка выпуклая по направлению к основанию, прикреплена к базальному рубцу [2].

В дополнение к щетинкам с увеличенным основанием, известным для многих родов семейства Boraginaceae , многие виды Onosma имеют щетинки с 4-20 лучами, отходящими от основания, они называются звездчатыми щетинками.Центральная щетинка на этих волосках иногда отсутствует, но обычно заметно длиннее и толще лучей. Наличие или отсутствие звездчатых щетинок широко используется как главный признак этого рода, но у ряда видов может быть широкий диапазон вариаций наличия, частоты и длины звездчатых щетинок. Морфология лепестков имеет большое таксономическое значение, а цвет, форма и размер венчика используются в качестве таксономических признаков в этом роде [24]. Однако подробные наблюдения за микроморфологией и анатомией лепестков большинства из видов Onosma отсутствуют [25], как описано в.Этот род представляет значительные таксономические трудности, особенно в центральной и юго-восточной Европе, которые не могут быть решены без экспериментального исследования.

Таблица 2

Неразрешенные растения рода Onosma L.

PHYTOCHEMISTRY

Обзор литературы показал, что для рода Onosma L. было проведено очень мало фитохимических исследований и только некоторые нафтахиноны и фенольные соединения, алкалоиды пока не поступало.[83] Алканнины и шиконины представляют собой хиральные пары встречающихся в природе изогексенилнафтазаринов, обнаруженных во внешнем слое корней многих видов, которые в основном относятся к родам Alkanna, Lithospermum, Echium, Onosma и Arnebia из семейства Boraginaceae [] [ ]. [84]

Таблица 3

Структуры некоторых фитосоставляющих, обнаруженных в роде Onosma L.

Из экстракта алкалоидов O. arenaria Waldst. и комплект. Упландицин, 1,2-ненасыщенный пирролизидиновый алкалоид, этерифицированный ацетильными и эхимидинильными фрагментами, и его структура была подтверждена масс-спектроскопией (электронный удар и положительная бомбардировка быстрыми атомами), анализом 1H- и 13C-ядерного магнитного резонанса (ЯМР).Кроме того, девять второстепенных алкалоидов были идентифицированы на основе масс-спектральных данных и / или индексов удерживания Коваца. [1]

Когда корни Onosma argentatum Hub.-Mor. экстрагировали смесью н-гексан-дихлорметан (1: 1), подвергали хроматографии на колонке с силикагелем и элюирование проводили смесью н-гексан-этилацетат с градиентным элюированием, дезоксишиконином, ацетилшиконином, 3-гидроксиизовалерилшиконином, Был получен 5,8-O-диметилацетил шиконин. [35,88]

The Onosma bracteosum Hausskn.и Борнм. и Onosma thracicum Velen. Показывает, что олеиновая и α-линоленовая кислоты количественно определены на более высоких уровнях у эндемичного O. bracteosum , в то время как другие жирные кислоты и α-токоферол наблюдались в более высоких концентрациях в O. thracicum . [10]

Исследование Onosma echioides CB Clarke не Линн. показали содержание алканнина или шиконина с производными нафтохинона, т.е. дезоксиалканнином или дезоксишиконином и 5,8-дигидрокси-2- (4-метил-6-оксо-5,6-дигидро-2H-пиран-2-ил) – [1,4 ] нафтохинон и арнебин-6 были обнаружены и охарактеризованы в экстрактах с использованием аппарата высокоэффективной жидкостной хроматографии-масс-спектрометрии (ВЭЖХ-МС), оборудованного источником ионизации ионизатора Electro Spray.[89] Летучие компоненты, полученные гидродистилляцией из надземных частей (листьев и цветов) O. echioides L. var. columnae Lacaita были исследованы с помощью газовой хроматографии и газовой хроматографии – МС, где было идентифицировано 64 летучих компонента, гексадекановая кислота и фитол преобладали в цветочных маслах, а фитол и гексагидрофарнезилацетон были основными компонентами в масле листьев. Алканы, жирные кислоты и альдегиды составляли основную фракцию цветочных масел, в то время как кислородсодержащие дитерпены и кетоны преобладали в маслах листьев.[15]

Onosmins A и B были выделены из Onosma hispidum Wall. ex G. Don и их структуры были установлены как 2 – [(4-метилбензил) амино] бензойная кислота и метил 2 – [(4-метилбензил) амино] бензоат посредством спектроскопических исследований, включая 2D-ЯМР. Известными соединениями являются апигенин, 6,4′-диметокси-3, 5, 7-тригидроксифлавон, 6,7-диметокси-3, 5,4′-тригидроксифлавон и апигенин 7-O-бета-D-глюкозид. также сообщалось об этом виде. [85] В 2006 году из спиртового экстракта коры коры корня были выделены 4-гидрокси-3-метоксикоричная кислота (феруловая кислота) и 4-гидрокси-3-метоксибензойная кислота (ванильная кислота).[90] Гиспидон, новый флаванон, был выделен и получил структуру (2S) -5, 2′-дигидрокси-7, 4 ‘, 5’-триметоксифлаванон спектроскопическими методами и в дополнение к этой бензойной кислоте и 4-гидрокси бензойная кислота также встречается из этого вида. [84]

Onosma paniculata Bureau и Franchet-HPLC анализ активного экстракта, растворимого в петролейном эфире, показал наличие нескольких производных шиконина с помощью препаративной HPLC, было собрано семь фракций, из которых были собраны β-гидроксиизовалерилшиконин, ацетилшиконин, диметилакрилшиконин и смесь α-шикалерилшиконина и смесь α-шикалерилшиконина. изолирован [91] и методом ВЭЖХ с использованием диодно-матричного детектирования, использованного для одновременного количественного определения восьми производных нафтохинона, выделенных из Onosma exsertum Hemsl., Onosma confertum W.W. Smith, Onosma hookerii Clarke var. longiflorum Duthie, O. hookerii Clarke и Onosma waltonii Duthic, а также эти шесть видов Onosma также используются народами Тибета и Юньнани, которые содержат различные типы и значительные количества нафтахинонов. [92]

ЭТНОФАРМАКОЛОГИЯ

Растения рода Onosma L. содержат алканнин и шиконин, флавоноиды, феруловую и ванилиновую кислоты, которые могут оказывать противовоспалительное, ранозаживляющее, обезболивающее и антибактериальное действие.Исследование показало, что эти фитохимические вещества обладают значительным противовоспалительным и обезболивающим действием без повреждения желудка, вызываемого индометацином. [87] О противораковой активности сообщили Onosma limitaneum [85], а антиоксидант с антимикробной активностью – O. argentatum . [57]

Экстракт корней O. argentatum Hub.-Mor. были исследованы на их способность стимулировать рост человеческих фибробластов амниона, активность заживления ран может быть частично обусловлена ​​аддитивным действием производных шиконина.[88] Экстракт корня также обладает спазмолитическим и жаропонижающим действием. [93]

Экстракт корней O. arenaria , содержащий производные нафтазарина, показал цитотоксичность по отношению к клеткам аденокарциномы шейки матки и клеткам лейкемии K562, а в другом исследовании также было показано, что β-гидроксиизовалерилалканнин, ацетилалканнин и фракция пигментов периферической крови проявляют высокую незначительную цитотоксичность в крови. мононуклеарных клеток (PBMC), а также на здоровых PBMC, активированных фитогемагглютинином. [94] В экспериментальном исследовании Onosma armeniacum K.было показано, что он обладает противоязвенными и антиоксидантными свойствами. [95]

Водный, метанольный и дихлорметановый экстракты золотой капли Аушера ( Onosma aucheriana ) проявили интересную антилейшманиозную активность в отношении внутриклеточной амастиготной формы паразита, которая, как было также показано, индуцирует выработку закиси азота макрофагами человека [36].

Было обнаружено значительное влияние экстракта стенки Onosma bracteatum на дегрануляцию перитонеальных тучных клеток крыс и ингибирующее действие на клетки при иммунологически индуцированной дегрануляции тучных клеток.[96] Водно-спиртовой экстракт этого растения, используемый при астме, поскольку он стабилизирует активность тучных клеток, ревматоидного артрита и показал значительную роль в значительном снижении гиперчувствительности бронхов при уменьшении инфильтрации эозинофилов и нейтрофилов у грызунов. . [97,98] Это растение также используется в системе медицины Унани при стрессе, нарушениях гомеостаза тела или при нарушениях нормальной физиологии организма, таких как психологические (поведенческие изменения), иммунологические и гормональные дисбалансы, которые вызывают патогенез. некоторых хронических заболеваний, таких как болезнь Альцгеймера, болезнь Паркинсона, гипертония, слабость иммунной системы человеческого организма, астма, диабет, сердечные заболевания, рак [99] антиоксидант [100] с ранозаживляющей активностью.[101,102]

Антиоксидантная активность была исследована на Onosma chlorotricum Boiss and Noe [103], а Onosma griffithii vatke обладают спазмогенной активностью. [104] O. chlorotricum Boiss and Noe [103] и Onosma dichroanthum Boiss. обладают спазмолитической активностью, [105] ацетоновый экстракт корней O. dichroanthum Boiss. приводит к сильному улавливанию свободных радикалов. [106]

O. griffithii был также проверен на паразитицидную активность против Leishmania major на основании значений IC 50 (ингибиторная концентрация), было обнаружено, что эффективная, аналогичная умеренная противогрибковая активность проявлялась неочищенным метанольным экстрактом против Aspergillus flavus и Favusarium. solani , тогда как против Staphylococcus aureus водная фракция продемонстрировала умеренную антибактериальную активность.[107]

Шарма и др. . (2004) раскрыли влияние экстракта O. echioides на двухстадийный канцерогенез кожи и на маркеры, индуцированные промотором опухоли, и окислительный стресс у швейцарских мышей. Предварительная обработка экстракта O. echioides в обоих исследованиях однократного местного применения пероксида бензоила с последующим воздействием ультрафиолетового излучения B вызывала значительный окислительный стресс и повышала маркерные параметры промотирования опухоли [108].

Химическое исследование спиртового экстракта коры корня O.hispidum Стенка после антибактериального и неочищенного этанольного экстракта и фракции метанола продемонстрировала значительную биоактивность против видов коринебактерий, энтерококков, стафилококков и стрептококков, в которых феруловая кислота оказалась более биологически активной по сравнению с ванилиновой кислотой [90,109] и гипидоном, выделенным из нее флаваноном. растения обладают свойством ингибирования холинэстеразы [84], в то время как экстракт корня обладает ранозаживляющим, [110] противокашлевым [90] и противодиабетическим действием [111].

Было также изучено влияние брассинолида на рост клеток, образование шиконина и его производных в культуре клеток Onosma paniculatum .[112] Сделан вывод, что выход пигментов каллусных и суспензионных культивированных клеток был увеличен, и максимальный выход пигментов был получен, когда в среду было добавлено 10 (-6) М аскорбиновой кислоты [113], в то время как ее экстракт петролейного эфира индуцирует клетки смерть в зависимости от каспаз. [114] Неочищенный препарат-элиситор культуры Aspergillus может также ускорить образование производных шиконина, но необратимо остановить рост клеток в культурах клеток O. paniculatum .[115]

Исследование также показывает генотоксические эффекты наземных и подземных частей видов. Onosma stellulata in-vitro. условий было проведено с использованием Allium-теста, наряду с наблюдением хромосомных аномалий, вызывающих генотоксические эффекты при митозе в меристематических клетках. лука. [1,116]

ТРАДИЦИОННОЕ ИСПОЛЬЗОВАНИЕ

Традиционно растения рода Onosma L. используются как стимулятор при ревматизме, боли в мочевом пузыре, раздражении почек, сердцебиении [57] и корнях как мочегонное, охлаждающее, вяжущее средство. и успокаивающее действие.В Индии он используется для лечения гипертонии, лихорадки и нервных состояний. В Турции эти растения используются для лечения воспалительных заболеваний, таких как тонзиллит, геморрой, бронхит и боли. [82]

O. hispidum Стенка. используются для лечения лихорадки, обезболивания, ран, укусов, инфекционных заболеваний, укусы и цветы используются как сердечное тонизирующее и стимулирующее средство, в то время как ушибленные корни применяются наружно при кожных высыпаниях [111].

Корни О.argentatum Hub.-Mor. Традиционно используются в Турции для заживления ран и ожогов, а в традиционной медицине провинции Лорестан масляный экстракт корня растения, известного как Ташнехдары ( O. chlorotricum ), используется местно для заживления ран. [103]

Экстракт, используемый перорально, получают из корней O, armeniacum K. сельчане, которые нагревают корни маслом и фильтруют, а затем используют в качестве народной медицины в Турции для лечения ран, ожогов, одышки, охриплости голоса, геморроя. , боли в животе, язвы желудка и гинекологические проблемы.[95]

O. bracteatum Wall., Известный как Gaozaban в системе медицины Унани и как Sedge на Ближнем Востоке и традиционно используется как тонизирующее средство, которое помогает в формировании иммунной устойчивости организма с регулированием диуреза [99 ] также сообщалось о применении при лечении астмы, бронхита, тонизирующем, альтеративном, успокаивающем, мочегонном и спазмолитическом средствах. Отвар используется при лечении сифилиса, ревматизма, проказы, беспокойства при фебрильном возбуждении, облегчении чрезмерной жажды, полезен при раздражении мочевого пузыря, сердцебиении, сердцебиении и странгурии, а также в народной медицине для лечения ран и кожи. болезни.[102]

Листья O. echioides DC. являются альтернативными, а порошок давали детям как слабительное. Цветы используются как сердечное и стимулирующее средство при лечении ревматизма и учащенного сердцебиения при ушибах корня, используются для лечения кожных высыпаний. [117]

Высушенные корни O. paniculata Bureau и Franchet используются в традиционной китайской медицине для лечения различных заболеваний, включая рак. [91]

ПРОМЫШЛЕННОЕ ИСПОЛЬЗОВАНИЕ

O.hispidum Wall. Сообщается, что он является источником ратанджота, корня, дающего красный краситель, который обычно используется для окрашивания пищевых продуктов, масел и лекарственных препаратов. Из-за своего цвета он также использовался в качестве примеси в специях, таких как порошок чили, и в пищевых продуктах. Было предложено его использование в качестве видимого красителя для Vanaspati, но испытания кормления на крысах показали, что это красящее вещество нетоксично в низких дозах и токсично в высоких концентрациях, вызывая разрушение клеток печени после продолжения кормления.Цвет, приданный Vanaspati, полностью удаляется простой химической обработкой раствором щелочи и, в значительной степени, воздействием прямых солнечных лучей или нагревания. Infect, краситель не подходит для окрашивания Vanaspati. [110,118]

Комбинация протравы, такой как квасцы: хром, сульфат меди, квасцы: сульфат железа, хром: сульфат меди, хром: сульфат железа, сульфат меди: Сульфат железа с корнями в соотношении 1: 3, 1: 1 и 3: 1 был исследован на свойства устойчивости окраски, а устойчивость окрашенных образцов к свету, стирке, истиранию и потоотделению дает оценку устойчивости от средней до отличной.[119]

ОБСУЖДЕНИЕ

Род Onosma L. имеет противоречивые и сложные образцы морфологических, кариологических и таксономических данных. Многочисленные похожие растения описаны на основании незначительных различий в морфологических характеристиках. Либо эти растения имеют только одну или две ссылки, либо являются подвидами других признанных растений. Большинство этих растений принадлежат к одному виду, но из-за отсутствия таксономических данных некоторые исследователи используют другое название, что может быть связано с некоторыми морфологическими изменениями в разных климатических условиях.перечисляет такие типы растений, которые имеются в литературе, но не имеют достаточно данных, чтобы идентифицировать или доказывать, существуют ли эти виды или нет, а также предоставляет доступные ссылки для этих отдельных названий. Список растений Королевского ботанического сада, ботанического сада Кью и Миссури показывает, что только около 37 растений имеют правильные таксономические данные. Растения этого рода широко распространены в Турции, Китае, Иране, Пакистане, Сирии, Индии и Шри-Ланке, а также в Швейцарии, Румынии и Анатолии.Этот род отчетливо различается внешними признаками орешка, размером, формой, цветом и орнаментом, а также скульптурой рисунка поверхности орешка с морфологией лепестков, такой как цвет, форма и размер венчика. Что касается фитохимических веществ, в этом роду в изобилии встречаются алканины и шиконины, которые представляют собой хиральные пары встречающихся в природе изогексенилнафтазаринов с некоторыми специфическими фитохимическими веществами, такими как гистидон, оносмин, оносмон и упландицин. Помимо них также обнаружены флавоноиды, феруловая и ванилиновая кислоты, которые могут отвечать за противовоспалительное, ранозаживляющее, обезболивающее и антибактериальное действие.

Растения этого рода обладают противоопухолевым, антиоксидантным, противомикробным, жаропонижающим, антидиабетическим, противокашлевым и спазмолитическим действием и традиционно используются при ревматизме, боли в мочевом пузыре, раздражении почек, сердцебиении, в то время как корни используются как вяжущее, успокаивающее, мочегонное средство, гипертония, лихорадка, боль и воспалительные заболевания и широко используется местным населением в лечебных целях. Основная цель этого обзора – создать постоянную литературу по родам в информации о растительных ресурсах, чтобы облегчить будущие исследования и вмешательство человека в мир.

БЛАГОДАРНОСТИ

Авторы выражают благодарность г-ну Деву Мурти, председателю, д-ру Джаганнту Саху, директору д-ра М. М. Абдулла, HOD, SRMS College of Engineering and Technology (Pharmacy), Bareilly за его поддержку и предоставление исследовательских помещений и SRMS доверие для финансовой поддержки.

Сноски

Источник поддержки: Нет

Конфликт интересов: Не заявлено

ССЫЛКИ

1. Эль-Шазли А., Гани А.А., Винк М.Пирролизидиновые алкалоиды из Onosma arenaria ( Boraginaceae ) Biochem Syst Ecol. 2003. 31: 477–85. [Google Scholar] 2. Шу ДЗ. Onosma Linnaeus. Флора Китая. 1995; 16: 348–57. [Google Scholar] 3. Рейдл Х., Оносма. Флора Турции и островов Восточного Эгейского моря. В: Devis PH, редактор. Vol. 6. Эдинбург: Издательство Эдинбургского университета; 1978. С. 326–76. [Google Scholar] 4. Насир Ю.Дж., Оносма Л. Флора из Пакистана. В: Насир Ю.Дж., Алис И., редакторы. Vol. 191. Исламабад: Национальный гербарий Пакистанского совета сельскохозяйственных исследований; 1989 г.С. 94–100. [Google Scholar] 5. Бинзет Р., Кандемир И., Оркан Н. Палинологическая классификация видов Onosma L. ( Boraginaceae ) из региона Восточного Средиземноморья в Турции. Acta Bot Croat. 2010; 69: 259–74. [Google Scholar] 6. Stearn WT. Пол родового названия Onosma ( Boraginaceae ) Taxon. 1993; 42: 679–81. [Google Scholar] 7. Коларчик В., Зозомова-Лихова Дж., Мартонфи П. Систематика и эволюционная история группы астеротрих рода Onosma ( Boraginaceae ) в центральной и южной Европе по данным AFLP и nrDNA ITS.Plant Syst Evol. 2010; 290: 21–45. [Google Scholar] 8. Кандемир А., Туркмен З. Новый вид Onosma ( Boraginaceae ) из восточной Турции. Turk J Bot. 2010; 34: 277–82. [Google Scholar] 9. Mehrabian AR, Sheidai M, Noormohammadi Z, Asrei Y, Mozafarian V. Межпростые повторы последовательности (ISSR) и морфологическое разнообразие у видов Onosma L. ( Boraginaceae ) в Иране. Afr J Biotechnol. 2011; 10: 10831–8. [Google Scholar] 10. Озкан Т. Характеристика Onosma bracteosum Hausskn.и Борнм. и Onosma thracicum Velen. на основе жирных кислот и содержания A-токоферола в растительных маслах. IUFS J Biol. 2009. 68: 75–83. [Google Scholar] 11. Vouillamoz PJ. Критическая инвентаризация, число хромосом и хорология Onosma helvetica (A. DC.) Boissiere Onosma pseudoarenaria Schur sl ( Boraginaceae ) в Швейцарии. Бык Муритиенн. 1999; 117: 45–59. [Google Scholar] 12. Сутеу Д., Попеску Ф., Попеску О. Оценка генетического разнообразия вида Onosma Sp .( Boraginaceae ) Ser Chem. 2007; 16: 45–54. [Google Scholar] 13. Джонстон И.М. Исследования Boraginaceae , 26. Дальнейшие оценки родов Lithospermae. Дж. Арнольд Арбор. 1954; 35: 1–81. [Google Scholar] 14. Куреши США, Кайзер М. Палинологическое исследование Onosma ( Boraginaceae ) из Пакистана. Пак Дж. Бот. 1987. 19: 99–105. [Google Scholar] 15. Maggi F, Tirillini B, Vittori S, Sagratini G, Papa F. Анализ летучих компонентов Onosma echioides (L.) L. Var. Columnae Lacaita растет в центральной Италии. J Essent Oil Res. 2009; 21: 441–7. [Google Scholar] 16. Бинзет Р., Акчин О.Е. Морфология пыльцы около видов Onosma ( Boraginaceae ) из Турции. Пак Дж. Бот. 2011; 43: 731–41. [Google Scholar] 17. Акчин О.Е. Исследование морфологии, анатомии и экологии эндемика Onosmabornmuelleri Hausskn. [Последний доступ 10 февраля 2013 г.]; Ekoloji. 2004 51: 13–9. Доступна с: http://www.ekoloji.com.tr/ [Google Scholar] 18.Акчин О.Е., Энгин А. Морфологические и анатомо-экологические свойства эндемика Onosma bracteosum Hausskn. и виды Bornm ( Boraginaceae ). Turk J Bot. 2005; 29: 317–25. [Google Scholar] 19. Бинзет Р., Оркан Н. Анатомические и палинологические исследования эндемичных Onosma mersinana Riedl и Orcan. Пак Дж. Бот. 2009; 41: 503–10. [Google Scholar] 21. Теппнер Х. Onosma kaheirei Spec, Nova Und O. erectum ( Boraginaceae ) Aus Griechenland.Фитон (Австрия) 1988; 28: 115–31. [Google Scholar] 22. Акчин О.Е. Морфологические и анатомические свойства эндемика Onosma armenum DC. ( Boraginaceae ) видов. Int J Nat Eng Sci. 2007; 1: 37–43. [Google Scholar] 23. Тутин Т.Г., Хейвуд В.Х., Берджес Н.А., Мур Д.М., Валентайн Д.Х., Уолтерс С.М. и др. Vol. 3. Нью-Йорк: издательство Кембриджского университета; 1972. Flora Europaea; п. 89. [Google Scholar] 24. Акчин О.Е. Микроморфологические и анатомические исследования лепестков 11 турецких Onosma L.( Boraginaceae ) таксоны. Бангладеш J Таксон растений. 2009. 16: 157–64. [Google Scholar] 25. Ахмад I, Анис I, Малик А., Наваз С.А., Чоудхари М.И. Компоненты, ингибирующие холинэстеразу, из Onosma hispida . Chem Pharm Bull (Tokyo) 2003; 51: 412–4. [PubMed] [Google Scholar] 26. Папагеоргиу В.П., Ассимопулу А.Н., Баллис А.С. Алканнины и шиконины: новый класс средств для заживления ран. Curr Med Chem. 2008. 15: 3248–67. [PubMed] [Google Scholar] 27. Озген У., Коскун М., Казаз С., Сесен Х. Нафтохиноны из корней Onosma argentatum Hub.-Мор. ( Boraginaceae ) Turk J Chem. 2004; 28: 451–4. [Google Scholar] 28. Озген У., Икбал М., Хаджимуфтуоглу А., Хоутон П.Дж., Гоцер Ф., Доган Х. и др. Стимуляция роста фибробластов экстрактами и соединениями корней Onosma argentatum . J Ethnopharmacol. 2006; 104: 100–3. [PubMed] [Google Scholar] 29. Sagratini G, Cristalli G, Giardinà D, Gioventù G, Maggi F, Ricciutelli M и др. Смесь алканнин / шиконин из корней Onosma echioides (L.) L .: Изучение метода экстракции и количественная оценка.J Sep Sci. 2008; 31: 945–52. [PubMed] [Google Scholar] 30. Ахмад В.Ю., Кусар Ф., Хан А., Зубайр М., Икбал С., Тарин РБ. Новый кетон и известный противораковый тритерпеноид из листьев Onosma limitaneum . Helv Chim Acta. 2005; 88: 309–11. [Google Scholar] 31. Наз С., Хан Р.А., Сиддики Р., Сайид С.А. Противокашлевое действие направлено на выделение соединений из Onosma hispidum . Am J Pharmacol Toxicol. 2006; 1: 1–4. [Google Scholar] 32. Наз С., Ахмад С., Аджаз Расул С., Асад Сайид С., Сиддики Р.Антибактериальная активность направлена ​​на выделение соединений из Onosma hispidum . Microbiol Res. 2006; 161: 43–8. [PubMed] [Google Scholar] 33. Kretschmer N, Rinner B, Deutsch AJ, Lohberger B, Knausz H, Kunert O и др. Нафтохиноны из Onosma paniculata вызывают остановку клеточного цикла и апоптоз в клетках меланомы. J Nat Prod. 2012; 75: 865–9. [Бесплатная статья PMC] [PubMed] [Google Scholar] 34. Hu Y, Jiang Z, Leung KS, Zhao Z. Одновременное определение производных нафтохинона в борагиновых травах с помощью высокоэффективной жидкостной хроматографии.Анальный Чим Акта. 2006; 577: 26–31. [PubMed] [Google Scholar] 35. Ларин А.П., Алеутский Н.Н. Об эффективности Оносма при экспериментальной гипертонии. Фармакол Токсикол. 1967. 30: 694–6. [PubMed] [Google Scholar] 36. Ахмад I, Наваз С.А., Афза Н., Малик А., Фатима I, Хан С.Б. и др. Выделение оносминов А и В, ингибиторов липоксигеназы из Onosma hispida . Chem Pharm Bull (Tokyo) 2005; 53: 907–10. [PubMed] [Google Scholar] 37. Бирадар Ю.С. Предварительная оценка выбранных лекарственных растений на антиплазмодийную активность.В: Оценка противомалярийной активности выбранных растений индийских систем медицины и изучение синергической активности соединений, присутствующих в них. Индийский репозиторий ETD @ INFLIBNET. 2010. [Последний доступ: январь 2013 г.]. Доступна с: http://www.ir.inflibnet.ac.in: 8080 / jspui / bitstream / 10603/1379/8 / 08_chapter 3.pdf. 38. Кундакович Т., Станойкович Т., Юранич З., Ковачевич Н. Цитотоксичность in vitro производных нафтазарина из Onosma arenaria . Phytother Res.2006; 20: 602–4. [PubMed] [Google Scholar] 39. Салман С., Кумбасар С., Озген У., Эрдоган Ф., Сулейман Х. Противозачаточные эффекты Onosma armeniacum при имплантации эмбриона крысам. Cell Membr Free Radic Res. 2009; 1: 90–4. [Google Scholar] 40. Ди Джорджио С., Дельмас Ф., Туэни М., Шебле Э., Халил Т., Балансард Г. Альтернативные и дополнительные антилейшманиозные обработки: оценка антилейшманиозной активности 27 ливанских растений, включая 11 эндемичных видов. J Altern Complement Med. 2008. 14: 157–62.[PubMed] [Google Scholar] 41. Choudhary GP. In vitro Стабилизирующая активность тучных клеток Onosma bracteatum Wall. [Последний доступ 10 февраля 2013 г.]; Int J Pharm Bio Sci. 2010 1: 1–6. Доступна с: http://www.ijpbs.net/ [Google Scholar] 42. Patel KG, Patel KV, Gandhiijpt TR. Оценка влияния Onosma bracteatum Wall ( Boraginaceae ) на гиперреактивность бронхов у сенсибилизированных морских свинок. Иранский J Pharmacol Ther. 2008; 7: 35–41. [Google Scholar] 43.Патель К.Г., Детройа-младший, Шах Т.А., Патель К.В., Ганди Т.Р. Оценка эффекта Onosma bracteatum Wall ( Boraginaceae ) с использованием экспериментальных аллергических и воспалительных моделей. Glob J Pharmacol. 2011; 5: 40–9. [Google Scholar] 44. Бадруддин С.Ф., Сиддики Х.Х., Хак С.Е., Халид М., Ахтар Дж. Психоиммуномодулирующие эффекты Onosma bracteatum Wall. (Gaozaban) на модели стресса у крыс sprague dawley. J Clin Diagn Res. 2012; 6: 1356–60. [Google Scholar] 45. Менгани Э., Судханшу, Рао Н., Миттал С.Способность улавливать свободные радикалы и антиоксидантная активность Onosma bracteatum . Int J Pharm Res Dev. 2012; 4: 16–20. [Google Scholar] 46. Choudhary GP. Противодиарейное действие спиртового экстракта Onosma bracteatum Wall. Int J Adv Pharm Biol Chem. 2012; 1: 402–5. [Google Scholar] 47. Choudhary GP. Ранозаживляющая активность спиртового экстракта Onosma bracteatum Wall. Int J Pharm Chem Sci. 2012; 1: 1035–7. [Google Scholar] 49. Али Н, Ахмад Б., Шах SW. Спазмогенное и спазмолитическое действие Onosma griffithii Ватке.Pak J Pharm Sci. 2011; 24: 553–8. [PubMed] [Google Scholar] 50. Moghaddam PZ, Mazandarani M, Zolfaghari MR, Badeleh MT, Ghaemi EA. Антибактериальная и антиоксидантная активность экстракта корня Onosma dichroanthum Boiss. на севере Ирана. Afr J Microbiol Res. 2012; 6: 1776–81. [Google Scholar] 51. Mazandarani M, Zarghami Moghaddam P, Zolfaghari MR, Ghaemi EA, Bayat H. Влияние типа растворителя на содержание фенолов и флавоноидов и антиоксидантную активность в Onosma dichroanthum Boiss.J Med Plants Res. 2012; 6: 4481–8. [Google Scholar] 52. Ахмад Б., Али Н., Башир С., Чоудхари М. И., Азам С., Хан И. Паразитарная, противогрибковая и антибактериальная активность Onosma griffithii Vatke. Afr J Biotechnol. 2009. 8: 5084–7. [Google Scholar] 53. Шарма С., Хан К., Султана С. Эффект Onosma echioides на канцерогенный ответ, опосредованный dmba / кротоновым маслом, гиперпролиферацию и окислительное повреждение кожи мышей. Life Sci. 2004. 75: 391–410. [PubMed] [Google Scholar] 54. Кумар Н, Гупта АК.Ранозаживляющая активность Onosma hispidum (Ratanjot) у нормальных и диабетических крыс. Растения J Herbs Spices Med. 2009; 15: 342–51. [Google Scholar] 55. Кумар Н., Гупта А.К., Пракаш Д., Кумар П. Гипогликемическая активность Onosma hispidum (Ratanjot) Int J Diabetes Dev Ctries. 2010; 30: 213–6. [Google Scholar] 56. Ян Ю., Чжан Х., Цао Р. Влияние брассинолида на рост и образование шиконина в культивируемых клетках Onosma paniculatum . J Регулятор роста растений. 1999; 18: 89–92. [PubMed] [Google Scholar] 57.Zhou L, Zheng G, Wang S, Gan F. Метаболическая регуляция образования пигмента в культивируемых клетках Onosma paniculatum. Chin J Biotechnol. 1992; 8: 263–8. [PubMed] [Google Scholar] 58. Rinner B, Kretschmer N, Knausz H, Mayer A, Boechzelt H, Hao XJ и др. Экстракт петролейного эфира корней Onosma paniculatum вызывает гибель клеток каспазозависимым образом. J Ethnopharmacol. 2010; 129: 182–8. [PubMed] [Google Scholar] 59. Вэнь Н, Цуньхуа З., Чжунхао X, Рицян С. Влияние грибкового элиситора на образование производных шиконина в культурах клеток Onosma paniculatum .J Ethnopharmacol. 2010; 129: 182–8. [Google Scholar] 60. Редзич СС. Экологический аспект этноботаники и этнофармакологии населения Боснии и Герцеговины. Coll Antropol. 2007; 31: 869–90. [PubMed] [Google Scholar] 61. Тосун А., Аккол Е.К., Бахадир О., Ешилада Э. Оценка противовоспалительной и антиноцицептивной активности около видов Onosma L., произрастающих в Турции. J Ethnopharmacol. 2008; 120: 378–81. [PubMed] [Google Scholar] 62. Хак Ф. Этно-ботаническое использование лекарственных растений долины Аллай, западные Гималаи Пакистана.Int J Plant Res. 2012; 2: 21–34. [Google Scholar] 63. Наз С. Пакистан: Университет Карачи; 2005. Структура и функции пигментов, выделенных из Onosma hispidum (Ratanjot) Terminalla catappa (Jangli Badam) и других тропических растений. Кандидатская диссертация; С. 53–174. [Google Scholar] 64. Бэйнс С., Каур К., Канг С. Свойства стойкости окраски при окрашивании шерсти красителем Голдендроп ( Onosma echioides ) с использованием комбинации протравы. Цвет. 2005; 51: 51–5. [Google Scholar] 65.Furth DG, Ben-Dov Y, Gerson U. Новый вид Peliococcus (Homoptera: Pseudococcidae) из Иудейской пустыни. Isr J Entomol. 1983; 17: 105–8. [Google Scholar] 66. Бинзет Р., Оркан Н. Новый вид ( Boraginaceae ) из южной Турции. Новон. 2007; 17: 8–10. [Google Scholar] 67. Бинзет Р., Акчин О.Е. Размер, форма и орнамент поверхности орешков у 14 Onosma видов ( Boraginaceae ) Acta Bot Croat. 2009. 68: 117–26. [Google Scholar] 69. Вурал С. Флора Эрджиес Дауи (Кайсери, Турция) Тюрк Дж. Бот.2009. 29: 185–236. [Google Scholar] 70. Михай Д., Адриан О, Николае С., Ион С. Сосудистая дикая флора биосферного заповедника «Дельта Дуная». Sci Ann Danube Delta Inst. 2011; 17: 1–37. [Google Scholar] 71. Акчин О.Е., Бинзет Р. Микроморфологические и анатомические свойства Onosma angustissimum Hausskn. и Борнм. и O. Калий Boiss ( Boraginaceae ) Bangladesh J Plant Taxon. 2010: 17, 1–8. [Google Scholar] 72. Терзи М, Д’амико Ф.С. Хасмофитная растительность класса Asplenietea trichomanis на юго-востоке Италии.Acta Bot Croat. 2008; 67: 147–74. [Google Scholar] 73. Peruzzi L, Passalacqua NG. Таксономия комплекса Onosma echioides (L.) L. ( Boraginaceae ) на основе морфометрического анализа. Bot J Linn Soc. 2008; 157: 763–74. [Google Scholar] 74. Айтач З., Думан Х. Степная флора высоких гор Ахир, Оксус и Бинбога (Кахраманмарас, Кайсери, Турция) Флора Медитерр. 2005; 15: 121–78. [Google Scholar] 75. Аслан С., Вурал М. Флора долины Кыбрис-Кою (Мамак-Анкара, Турция) Biodicon. 2009; 2: 34–64.[Google Scholar] 76. Георгиу К., Делипетру П. Образцы и черты эндемичных растений Греции. Bot J Linn Soc. 2010. 162: 130–422. [Google Scholar] 77. Attar IF, Hamzehee B. Onosma bisotunensis ( Boraginaceae ), новый вид из западного Ирана. Новон. 2007; 17: 279–81. [Google Scholar] 78. Peruzzi L, Aquaro G, Cesca G. Распространение, кариология и таксономия Onosma helvetica subsp lucana Comb. Nova ( Boraginaceae ), шизоэндемик в Базиликате и Калабрии (S.Италия) Phyton Ann Rei Botanicae. 2004; 44: 69–81. [Google Scholar] 79. Акчин О.Е., Бинзет Р. Микроморфологические исследования орешков около видов Onosma L. ( Boraginaceae ) из Турции. Пак Дж. Бот. 2011; 43: 743–52. [Google Scholar] 80. Дузенли А., Чакан Х. Флора горы Муса (Хатай, Турция) Тюрк Дж. Бот. 2001; 25: 285–309. [Google Scholar] 81. Уллах И., Вазир С.М., Фарук А., Хан С.У., Хуссейн З. Идентификация обычных сорняков и характер их распространения на пшеничных полях Фр. Банну, Хайбер-Пахтунхва, Пакистан.Pak J Weed Sci Res. 2011; 17: 407–16. [Google Scholar] 83. Mehrabian AR, Sheidai M, Noormohammadi Z, Mozafarian V, Asrei Y. Палинологическое разнообразие в роде Onosma L. ( Boraginaceae ) из Ирана. Ann Biol Res. 2012; 3: 3885–93. [Google Scholar] 84. Authier P. Каталог Commente D e La Flore De La Region Des Monts Timfi (Национальный парк дю Викос-Аоос и окрестности-Эпир-Нор-Уэст Грече). 4. Boraginaceae . Кандоллея. 2000; 55: 153–78. [Google Scholar] 85. Дукас Р., Дафни А.Опыление жужжанием у трех нектароносных Boraginaceae и возможная эволюция цветков, опыляемых жужжанием. Pl Syst Evol. 1990; 169: 65–8. [Google Scholar] 86. Теппнер Х., Ятроу Г. Onosma sangiasense Spec, Nova ( Boraginaceae ) из Пелопонниса (Греция), Фитон (Австрия) 1987; 27: 285–8. [Google Scholar] 87. Теппнер Х., Оносма Л. Горная флора Греции. В: Тан К., Стрид А., редакторы. Vol. 2. Эдинбург: Издательство Эдинбургского университета; 1991. С. 25–38. [Google Scholar] 88.Павол М., Мартонфьева Л., Коларчик В. Кариотипы и размер генома видов Onosma из северных границ рода в Карпатах. Кариология. 2008; 61: 363–74. [Google Scholar] 89. Вурал М., Думан Х., Айтач З., Адигузель Н. Новый род и три новых вида из центральной Анатолии, Турция. Turk J Bot. 2012; 36: 427–33. [Google Scholar] 90. Теппнер Х. Кариология некоторых греческих видов Onasma ( Boraginaceae ) Bot Chron. 1991; 10: 271–92. [Google Scholar] 91. Гогала А, Сурина Б.Кормление пчелы Osmia apicata Smith, 1853 (Hymenoptera: Megachilidae) Acta Entomol Slov Любляна. 2011; 19: 139–44. [Google Scholar] 92. Аттар Ф, Джохарчи MR. Onosma khorassanica , новый вид с северо-востока Ирана. Ростаниха. 2006; 7: 111–4. [Google Scholar] 93. Христодулакис Д. Флора Икарии (Греция, Эгейские острова) Фитон (Хорн, Австрия) 1995; 36: 63–91. [Google Scholar] 94. Явари А, Шахголзари С.М. Флористическое исследование охраняемой территории Хан-Гормаз в провинции Хамадан, Иран.Int J Agric Biol. 2010; 12: 271–5. [Google Scholar] 95. Кандемир А., Туркмен З. Флора Узумлу-Сакалтутан (Эрзинджан-Гумуфлхане) Тюрк Дж. Бот. 2008. 32: 265–304. [Google Scholar] 96. Джохарчи MR, Амири MS. Таксономическая оценка ошибочной идентификации сырых растительных препаратов, продаваемых в Иране. Авиценна Дж. Фитомедицина. 2012; 2: 105–12. [Бесплатная статья PMC] [PubMed] [Google Scholar] 97. Гахреман А., Хейдари Дж., Аттар Ф., Хамзехи Б. Флористическое исследование юго-западных склонов возвышенности Биналауд (Иран: провинция Хорасан) J Sci (JSUT) 2006; 32: 1–12.[Google Scholar] 98. Мемариани Ф., Джохарчи М.Р., Эйтехади Х., Эмадзаде К. Вклад в флору и растительность горного хребта Биналуд, Северо-Восточный Иран: Флористические и хорологические исследования в регионе Ферейзи. Ferdowsi Uni Int J Biol Sci. 2009; 1: 1–18. [Google Scholar] 99. Теппнер Х. Примечания к Onosma видов O. bourgaei , O. spruneri и O. stellulata ( Boraginaceae ). Samentauschverzeichnis. 1996: 33–9. [Google Scholar] 100. Рейдл Х., Бинзель Р., Оркан Н.Новый вид Onosma ( Boraginaceae -Lithospermeae) из южной Турции. Edinb J Bot. 2004; 61: 127–30. [Google Scholar] 101. Мортеза-Семнани К., Саиди М., Акбарзаде М., Мошири К. Состав эфирных масел Onosma microcarpum Dc. Аромат Fragr J. 2006; 21: 314–6. [Google Scholar] 102. Бинзет Р., Акчин О.Е. Анатомические свойства двух видов Onosma L. ( Boraginaceae ) из Турции. J Med Plants Res. 2012; 6: 3288–94. [Google Scholar] 103.Ридл Х. Дополнительные примечания по видам Cwoiswa ( Boraginaceae ) из Турции. Linzer Biol Beitr. 1987; 19: 461–5. [Google Scholar] 104. Кахьяоглу М., Туркоглу И. Антимикробная активность некоторых растений, собранных в районах Элязыг. Dumlupinar univeritesi fen bilimleri enstitusu Dergesi. 2008; 15: 1–7. [Google Scholar] 105. Soueges R. Эмбриогенез Boraginaceae ; развитие эмбриона в Onosma nanum DC (O. decipiens Schott et Kotschy) C R Hebd Seances Acad Sci.1951; 232: 2164–7. [PubMed] [Google Scholar] 106. Teppner H, Tuzlaci E. Onosma propontica Aznavour ( Boraginaceae -Lithospermeae). Landesmuseums NF. 1994. 76: 77–83. [Google Scholar] 107. Тивари Великобритания, Адхикари BS, Рават GS. О воспоминании и повторном открытии Onosma pyramidale Hook. F., Boraginaceae из Чамоли, Уттаракханд. Азиатский J Pharm Life Sci. 2011; 1: 2231–423. [Google Scholar] 108. Лопес Г. Notas Sorbre El Genero Onosma L. ( Boraginaceae ) En El Mediterraneo Occidental.Jard Bot Madrid. 1994; 52: 43–52. [Google Scholar] 109. Mroczek T, Baj S, Chrobok A, Glowniak K. Скрининг пирролизидиновых алкалоидов в растительных материалах с помощью электронной ионизации RP-HPLC-MS с интерфейсом термо-пучка. Biomed Chromatogr. 2004; 18: 745–51. [PubMed] [Google Scholar] 110. Халили М.А., Миресмаили С.М., Могддам Х.Х., Резаи С.Х., Вахиди АР. Исследование заживления ожога Onosma stenosiphon при ожоге II типа спины и яичек у крыс. J Травяные препараты. 2010; 1: 29–34. [Google Scholar] 111.Гахреманиеджад Ф., Джохарчи М., Витек Э. Новые рекорды заводов в провинции Хорасан, Иран. Анн Нарурхист Мус Вин Б. 2005; 106: 255–93. [Google Scholar] 112. Павлова Д., Кожухарова Е., Димитров Д. Флористический каталог серпантинов восточных гор Родопы (Болгария) Пол Бот Дж. 2003; 48: 21–41. [Google Scholar] 113. Петрова А., Владимиров В. Балканские эндемики в болгарской флоре. Phytologia Balcanica. 2010. 16: 293–311. [Google Scholar] 114. Анцев М., Полачек А. Erysimum Bulgaricum (Brassicaceae), новый вид для Балканского полуострова.Энн Натурхист Мус Вин Б. 2003; 104: 691–8. [Google Scholar] 115. Порто М., Перейра А.Дж., Хасинто М., Таулен-Гомеш К. Onosma tricerosperma subsp. tricerosperma Лаг. ( Boraginaceae ), новый вид и род во флоре Португалии. Acta Bot Malacitana. 2012; 37: 216–8. [Google Scholar] 116. Папагеоргиу В.П., Ассимопулу А.Н., Куладурос Е.А., Хепворт Д., Николау К.С.. Химия и биология алканнина, шиконина и родственных природных продуктов нафтазарина. Angew Chem Int Ed.1999. 38: 270–300. [PubMed] [Google Scholar] 117. Кандемир А, Hedge IC. Аномальный новый Ferulago (Apiaceae) из восточной Турции. Willdenowia. 2007. 37: 273–6. [Google Scholar] 118. Redzic A, Redzic S, Sejdic N. Генотоксические эффекты водного экстракта эндемичного растения Onosma stellulata Waldst. и комплект. ( Boraginaceae ) Afr J Tradit Complement Altern Med. 2009. 6: 347–446. [Google Scholar] 119. Теппнер Х. Onosma stridii Spec, Nova ( Boraginaceae ) Aus Griechenland.Фитон (Австрия) 1988; 28: 271–5. [Google Scholar]

Лечебный эффект экстракта корня Onosma Bulbotrichum N-гексан-дихлорметаном при ожогах второй степени

World J Plast Surg. 2018 Янв; 7 (1): 25–33.

Псевдоним Хеммати

1 Отделение фармакологической токсикологии, Фармацевтический факультет, Исследовательский центр физиологии, Университет медицинских наук Джундишапур, Ахваз, Иран;

Форо Намджуян

2 Кафедра фармакогнозии, Фармацевтический факультет, Университет медицинских наук Ахваза Джундишапура, Ахваз, Иран;

Садех Юсефи

3 Кафедра фармакологии Фармацевтического факультета Университета медицинских наук Ахваза Джундишапура, Ахваз, Иран;

Gholamreza Housmand

1 Отделение фармакологической токсикологии, Фармацевтический факультет, Исследовательский центр физиологии, Университет медицинских наук Джундишапур, Ахваз, Иран;

Хоссейн Хадем Хагигян

4 Кафедра питания, факультет здравоохранения, Казвинский университет медицинских наук, Казвин, Иран;

Анахита Резаи

5 Кафедра патологии, факультет ветеринарной медицины, Университет Шахида Чамрана, Ахваз, Иран

1 Отделение фармакологической токсикологии, Фармацевтический факультет, Исследовательский центр физиологии, Университет медицинских наук Джундишапур, Ахваз, Иран;

2 Кафедра фармакогнозии, Фармацевтический факультет, Университет медицинских наук Ахваза Джундишапура, Ахваз, Иран;

3 Кафедра фармакологии, Фармацевтический факультет, Университет медицинских наук Ахваза Джундишапура, Ахваз, Иран;

4 Кафедра питания, факультет здравоохранения, Казвинский университет медицинских наук, Казвин, Иран;

5 Кафедра патологии, факультет ветеринарной медицины, Университет Шахида Чамрана, Ахваз, Иран

* Автор для переписки: Голамреза Хаусманд, доктор философии, кафедра фармакологии, токсикологическая группа, фармацевтическая школа, физиологический исследовательский центр, университет Джундишапура Медицинские науки, Ахваз, Иран, тел .: + 98-914-3436838, факс: + 98-2-833336001, электронная почта: rezahoushmand_vet79 @ yahoo.com

Поступило 01.09.2016; Пересмотрено 15 августа 2017 г .; Принято 4 октября 2017 г.

Это статья в открытом доступе, распространяемая в соответствии с условиями лицензии Creative Commons Attribution License (http://creativecommons.org/licenses/by/3.0/), которая разрешает неограниченное использование, распространение и воспроизведение в любых средний при условии правильного цитирования оригинала.

Abstract

ИСТОРИЯ ВОПРОСА

Заживление ран – это процесс восстановления после травмы кожи и других мягких тканей.В этом исследовании изучали влияние экстракта н-гексана-d-хлорметана (1: 1) корня Onosma bulbotrichum DC на ожог второй степени на модели кролика.

МЕТОДЫ

Тридцать шесть взрослых кроликов обоего пола были случайным образом разделены на шесть групп: контроль (без лечения), отрицательный контроль (обработка холодным кремом), положительный контроль (обработка сульфадиазином серебра) и группы обработки с 5%. , 1% и 2% крем O. Bulbotrichum и оценивали гистологически.

РЕЗУЛЬТАТЫ

Наилучший результат был получен в группе 5% O. Bulbotrichum , аналогичной группе сульфадиазина серебра. Максимальное количество коллагена и прочность ткани на разрыв наблюдались в группах 5% O. Bulbotrichum и сульфадиазина серебра. Гистопатологическое исследование показало, что заживление ожогов в группе лечения с 5% O. bulbotrichum было быстрее, чем в других группах.

ЗАКЛЮЧЕНИЕ

Было показано, что 5% крем O. Bulbotrichum обладает заживляющим и противовоспалительным действием при лечении ожогов второй степени.

Ключевые слова: Ожог, заживление, сульфадиазин серебра, Onosma bulbotrichum , Rabbit

ВВЕДЕНИЕ

Конечная цель лечения ожогов и лечения – скорейшее заживление и эпителизация ран для предотвращения инфекции и выздоровления. функциональные и эстетические эффекты. 1 Использование местной химиотерапии имело фундаментальное значение в этом отношении и помогло улучшить выживаемость пациентов с обширными ожогами и свести к минимуму частоту ожогового сепсиса, являющегося основной причиной смертности и заболеваемости ожоговых пациентов. 2 Возможно, самая травматическая травма для жертвы, на протяжении многих лет ожоги были обработаны различными раневыми покрытиями, 3 как натуральными, так и синтетическими, с целью найти наиболее эффективные средства борьбы с повреждениями, выходящими за пределы места травмы . 4

Это также важно для ускорения заживления, так как основной задачей при лечении ожогов является их физиологическое закрытие в кратчайшие сроки. 5 Среди осложнений, связанных с термической травмой, образование свободных радикалов кислорода, которые могут вызвать инфекцию, показало, что от 50% до 75% смертей в больнице происходит из-за травм. 6 Восстановление после ожога – это процесс самопроизвольный и без участия других факторов, но инфекция необходима для лечения. 7 Заживление ран широко обсуждается в медицинской литературе. 8

В местной ожоговой терапии сульфадиазин серебра был представлен как золотой стандарт, обладающий также антибактериальными свойствами. 9 Были проведены многочисленные исследования для разработки более сложных повязок для ускорения процесса заживления и уменьшения бактериальной нагрузки на раны. 8 Даже лекарственные растения применялись для заживления ожоговых ран, традиционные формы медицины, особенно растительные продукты, которые веками использовались в Африке и Азии, сейчас исследуются на предмет их роли в лечении ран. 10 , 11 Есть много сообщений, подтверждающих использование лекарственных растений для перевязки ран, которое было описано Авиценной, персидским врачом (980–1037 гг. Н.э.) в его знаменитой книге «Канон медицины». 2

Семейство Boraginaceae насчитывает около 100 родов и 2000 видов, которые часто встречаются в регионах с теплым и умеренным климатом. 12

Род Onosma насчитывает более 150 видов и обитает в основном в жарких и засушливых регионах, особенно в Средиземноморье и Азии, и в основном в Иране. 13 Наиболее важные соединения, выделенные из этого рода, такие как нафтохинона, шиконин и алканнин. В корне красный пигмент присутствует в разном соотношении. 14 Например, такие виды, как Onosma argentatum , имеют 3-гидроксиизовалерилшиконин 5 и O-диметилацетилшиконин. 15 Эти соединения являются липофильными и обладают несколькими фармакологическими активностями, такими как заживление ран, антимикробным, противогрибковым, противовоспалительным, противоопухолевым и антиоксидантным действием, а также обладают ингибиторами топоизомеразы. 16 , 17

Корень – самая важная часть этого рода, которая используется для лечения ран, ожогов и геморроя. 18 Предыдущее исследование показало, что метанольный экстракт корня Onosma hispidum очень эффективен для заживления ран на животных моделях. 19 Кроме того, было обнаружено, что экстракт, приготовленный из Onosma stenosiphon , улучшает ожог у крыс через 24 дня. 20 В настоящем исследовании мы исследовали действие защитного экстракта н-гексан-дихлорметан (1: 1) корня Onosma bulbotrichum DC на ожоги второй степени на модели кролика.

МАТЕРИАЛЫ И МЕТОДЫ

Растение было собрано в западном регионе Ирана, его корень был отделен, а затем высушен. Для приготовления экстракта дихлорметана (1: 1) в н-гексановом растворителе использовали метод Сокслета.Триста г высушенного корня растения были разделены на 4 секции, и каждая секция (75 г) была перенесена на фильтровальную бумагу, а затем по 250 мл н-гексанового растворителя дихлорметана (1: 1) в каждый из баллонов. добавляли, нагревали в течение 4 часов, пока температура не достигала 40 ° C, и, наконец, фильтровали для экстракции. 21 На следующем этапе экстракт концентрировали на роторном испарителе, а затем концентрированный экстракт паровой бани использовали в качестве растворителя, полностью упаривали и сушили.5%, 1% и 2% экстракта были приготовлены в виде холодного крема.

Здоровые кролики-самцы и самки (от 1,8 до 1,2 кг) были получены из центра по уходу за лабораторными животными нашего учреждения и содержались в помещении для животных фармацевтической школы при 12-часовом освещении, 12-часовом темноте и поддержании температуры 22 ± 2 ° C и интенсивной пищи, моркови, салата и воды, употребляемой без ограничений. Этих животных поместили в стандартные клетки. Зона ожога создавалась на спине животных, рядом с позвоночником, при этом область была полностью выбрита и продезинфицирована этанолом.Для местной анестезии использовали 2% лидокаин. Чтобы вызвать ожог, круглый стальной стержень диаметром 2,5 см нагревали до 150 ° C и помещали на кожу животного на 20 секунд для создания ожога. Три раза в день очертания каждой раны наносились на прозрачный пластиковый лист.

Затем была рассчитана площадь поверхности ран. Площадь первого дня была 100, и степень заживления оценивалась каждый день по сравнению с первым днем. 22 Группы были (i) без лечения, которые не получали никакого лечения, (ii) Отрицательный контроль, который получал лечение холодным кремом два раза в день до полного заживления ран, (iii) Положительный контроль, который получал лечение кремом сульфадиазина серебра два раза в день до полного заживления ран; (iv) Тест 1, обработанный 5% O.Bulbotrichum два раза в день до полного заживления ран, (v) Тест 2, который обрабатывали кремом 1% O. Bulbotrichum два раза в день до полного заживления ран, и (vi) Тест 3, который обрабатывали 2% O Крем Bulbotrichum два раза в день до полного заживления ран.

Через 7 и 14 дней образец кожи был предоставлен для гистологического исследования. Образцы фиксировали в 10% формалине, и из срезов получали типичные толщины 5 микрометров.На следующем этапе срезы окрашивали гематоксилином и эозином и визуализировали с помощью световой микроскопии. Образцы также инкубировали с 10 мл 0,1% Sirius Red и 0,1% Fast Green, насыщенных пикриновой кислотой, растворенной в воде, в течение 30 мин, затем осторожно обесцвечивали и промывали деионизированной водой до обесцвечивания. Затем к тканевым блокам добавляли 1 мл цветного раствора, медленно встряхивали и осторожно переносили в микропробирки. Поглощение измеряли при длине волны 540 и 605 нм с помощью спектрофотометра. 23

Количество коллагеновых и неколлагеновых белков рассчитывали по следующей формуле: Коллаген (мкг / секция) = [OD540- (OD605 × 0,291)] / 37,8 × 1000, неколлагеновый белок (мкг / секция). ) = Значения OD605 / 2,04 × 1000, общий белок = коллаген + неколлагеновый белок. В конце периода лечения с раны удаляли кожу размером 20 × 5 мм и измеряли прочность на разрыв с помощью тензиометра. 24 Все обработанные группы сравнивали с контрольной группой, и результаты анализировали статистически с использованием однофакторного дисперсионного анализа (ANOVA) с последующим тестом Тьюки для выявления различий между обработанными группами и контролем.Данные считались значимыми при p <0,05.

РЕЗУЛЬТАТЫ

В группе кроликов, оставшихся без лечения, заживление длилось 26 дней. По сравнению с группой, получавшей холодный крем (отрицательный контроль), значимые различия наблюдались через 12, 22 и 23 дня, но в другие дни значимых различий не было (). В группе лечения сульфадиазином серебра заживление ожогов длилось 16 дней, и по сравнению с группой отрицательного контроля и группой без лечения значительная разница была отмечена для всех дней ().

Сравнение заживления ожогов после лечения группами холодного крема и без лечения.

Сравнение заживления кожных ран после лечения сульфадиазином серебра и холодным кремом.

В группе лечения холодным кремом (отрицательный контроль) заживление ожогов длилось 24 дня, и по сравнению с группой лечения 5% кремом O. Bulbotrichum значительная разница наблюдалась для всех дней, за исключением первого дня. Однако по сравнению с группой лечения 1% O.Bulbotrichum , значительная разница была видна для всех дней. В группе лечения 2% кремом O. Bulbotrichum значительная разница наблюдалась для всех дней, кроме 4, 5 и 6 (). В группе лечения 5% кремом заживление ожога длилось 17 дней. При компрессии между группами лечения 5% кремом O. Bulbotrichum по сравнению с группой сульфадиазина серебра значительная разница была отмечена в течение 4, 6, 9 и 10 дней ().

Сравнение скорости заживления кожных ран в группах, получавших различные концентрации О.Bulbotrichum (5%, 2% и 1%) сравнивали группу, получавшую холодный крем.

Сравнение заживления кожных ран после приема 5% крема O. Bulbotrichum и группы лечения сульфадиазином серебра.

Кроме того, максимальное количество коллагена было показано в группах лечения с 5%, 1% и 2% кремом O. bulbotrichum и сульфадиазином серебра, а минимальное количество – в группе без лечения и отрицательном контроле (). Самый высокий уровень неколлагеновых белков наблюдался в группе лечения сульфадиазином серебра по сравнению с другими группами ().Группы, получавшие 5% сульфадиазин серебра и крем O. bulbotrichum , показали максимальное количество резистентности тканей.

Сравнение концентраций коллагена (мкг / секция) во всех группах.

Сравнение концентраций неколлагеновых белков (мкг / секция) во всех группах.

Гистологические исследования подтвердили, что в группе без лечения в первую неделю были видны некроз и воспаление (). На второй неделе воспаление продолжилось, и было видно несколько красных кровяных телец ().В положительном контроле в первую неделю лечения были обнаружены воспалительные клетки (.), Что через две недели пролиферация и миграция клеток начинались в область ожога (). В группе лечения 5% кремом O. Bulbotrichum в первую неделю; наблюдалась пролиферация эпителиальных клеток (). На второй неделе пролиферация продолжалась и наблюдалась в виде широких мясистых тканей почек, покрывающих большие области области ожогового повреждения ().

Сравнение гистологических изменений в разных группах в течение первой недели: в группе без лечения (A), лечение холодным кремом (B), положительный контроль сульфадиина серебра (C), группа лечения с 5% O.Bulbotrichum крем (D), группа обработки с 2% кремом O. Bulbotrichum (E) группа обработки с 1% кремом O. bulbotrichum (F).

Сравнение гистологических изменений на второй неделе: в группе без лечения (A), лечение холодным кремом (B), положительный контроль сульфадиазина серебра (C), группа лечения 5% кремом O. bulbotrichum (D), группа обработки кремом 2% O. bulbotrichum (E) группа обработки кремом 1% O.Bulbotrichum (F).

В группе лечения кремом 2% O. bulbotrichum в первую неделю в области повреждения проявились воспаление и наличие базофилов (). На второй неделе было воспаление, но клетки эпителия увеличились и были видны эритроциты (). В группе лечения 1% кремом O. Bulbotrichum в дерме, гиподерме некроз наблюдался в первую неделю (). На второй неделе показали пролиферацию и наличие эпителиальных клеток ().

ОБСУЖДЕНИЕ

Ожоги считаются третьей основной причиной смерти в результате несчастных случаев во всех возрастных группах, являясь самой частой причиной ожогов, а также самой высокой частотой несчастных случаев в быту и окружающей среде, составляющими 60% от всех несчастных случаев. всего событий. 25 Альтернативы для лечения этих ран, которые способствуют уменьшению боли, времени и эпителизации визга, исследования имеют решающее значение. 26 Заживление ожоговой раны – сложный процесс воспаления, реэпителизации, грануляции, неоваскуляризации и сморщивания раны. 27 Несколько биохимических веществ участвуют в процессе облегчения ожогов, включая антиоксиданты, цитокины и биомаркеры печени и почек. 28 Противомикробные, противовоспалительные, антиоксидантные, стимуляторы синтеза коллагена, пролиферативные и ангиогенные эффекты – это положительная активность фитохимических веществ, которые присутствуют на разных этапах заживления ожоговой раны. 29

Кожа – первая защита организма от проникновения микроорганизмов и химических агентов. 19 Термическое повреждение как разрушительное физико-химическое явление приводит к большим проблемам и смерти во всем мире. 1 Заживление раны – это спонтанный процесс, на который влияют разные факторы. 12 Было проведено множество исследований активности экстрактов корней некоторых видов Boraginaceae, а также алканнина, шиконина и их производных в отношении заживления поражений. 30 Превосходные ранозаживляющие свойства эфиров алканнина в клиническом исследовании с участием 72 пациентов, страдающих вялотекущей язвой на нижней части ноги, были показаны из-за варикозного расширения вен. 29

Другой экстракт корня Boraginaceae видов Lithospermum erythrorhiozon и корня Macrotomia euchroma были изучены Ozaki et al. относительно ускоряющего действия на разрастание ткани гранулемы у крыс. Они предположили, что ускоряющий эффект на пролиферацию ткани гранулемы зависит, прежде всего, от общего содержания производных нафтохинона, в то время как ускоряющий эффект, подтвержденный эфирным экстрактом, может быть дополнительным эффектом этих производных нафтохинона. 31

В этом исследовании мы показали, что среди различных доз экстракта корня O. Bulbotrichum DC, доза 5% имела лучший эффект для улучшения ожога. Вероятно, этот лечебный эффект связан с присутствием шиконина, поскольку предыдущие исследования подтвердили, что это соединение ингибирует биосинтез лейкотриена B4 и обладает воспалительными эффектами. 19 В настоящее время эти соединения используются как новые лекарственные средства для заживления ран. 15 , 19 В другом исследовании было показано, что экстракт (1: 1) н-гександихлорэтил-оносма метан и 5,8-о-диметилацетил шиконин приводит к стимуляции и росту человеческих фибробластов. 32

Эти результаты показали, что увеличение дозы не превышает взаимодействий, которые, вероятно, связаны с цитотоксическим действием хинона в более высоких концентрациях. 33 Было показано, что алканнин и некоторые его производные действуют против многих раковых клеток, включая раковые клетки с цитотоксической активностью KB. 34 Также некоторые производные шиконина в концентрации 10 мг / кг / день могут полностью подавлять рост опухоли у мышей. Другие исследования показали, что производные алканнина через 5, 7 и 10 дней обладают наивысшими цитотоксическими эффектами, среди которых 5-O-метил-11-O-ацетилалканнин был наиболее эффективным. 35

Одним из важных факторов, которые развивают цитотоксические эффекты в более высоких концентрациях, является хинон, потому что он увеличивает образование окислительного стресса, свободных радикалов и повреждений ДНК. 36 Многие исследования показали, что производные нафтохинона обладают токсичностью при высоких концентрациях, что указывает на косвенную связь между концентрацией и заживлением ожогов. 37 Фибробласты играют важную роль в заживлении ран. 38 Коллаген – один из важнейших структурных белков соединительной ткани; что этот белок образуется в основном в коже. 39 Наше исследование показало, что концентрация этого белка в группе, получавшей крем 5%, значительно отличалась от других групп. Присутствие нафтохинона оказывает противовоспалительное действие, что может привести к стимуляции роста фибробластов и антиоксидантной активности. 40

Производное нафтохинона, арнебин-1 (b, b-диметилакрилалканнин), значительно ускоряет заживление ран при лечении гидрокортизоном или без него. 32 Уменьшение ширины раны и длины зазора по сравнению с контролем и стимулирование пролиферации, миграции и образования сосудов приводит к образованию толстой грануляционной ткани и реэпителизации ран, выявленных обработкой Арнебином-1. 41 В нашем настоящем исследовании O. bulbotrichum DC оказался более эффективным.

Данные нашего исследования показывают, что использование O. Bulbotrichum DC для заживления ожогов второй степени является эффективным методом лечения, даже точный механизм, лежащий в основе этих действий, неясен. Возможные механизмы процесса заживления могут быть связаны с противовоспалительным действием O. Bulbotrichum , которое может вызывать стимуляцию роста фибробластов и антиоксидантную активность.

БЛАГОДАРНОСТИ

Это исследование является частью докторской диссертации Садега Юсефи. Кроме того, авторы выражают благодарность за финансовую поддержку Университету медицинских наук имени Ахваза Джундишапура, Иран.

КОНФЛИКТ ИНТЕРЕСОВ

Авторы заявляют об отсутствии конфликта интересов.

Ссылки

1. Атье Б.С., Костальола М., Хайек С.Н., Дибо С.А. Влияние серебра на инфекционный контроль и заживление ожоговой раны: обзор литературы. Бернс.2007. 33: 139–48. [PubMed] [Google Scholar] 2. Магсуди Х., Моншизаде С., Месгари М. Сравнительное исследование свойств заживления ожоговой раны пропитанной физиологическим раствором повязки и сульфадиазина серебра у крыс. Индийский J Surg. 2011; 73: 24–7. [Бесплатная статья PMC] [PubMed] [Google Scholar] 3. Грэхем Дж.С., Шонебум Б.А. Исторический взгляд на последствия и лечение травм, вызванных серной горчицей. Chem Biol Interact. 2013; 206: 512–22. [PubMed] [Google Scholar] 4. Манафи А., Кохантеб Дж., Мехрабани Д., Джапони А., Амини М., Нагмачи М., Заги А. Х., Халили Н.Активная иммунизация с использованием экзотоксина А обеспечивает защиту от инфекции Pseudomonas aeruginosa на модели ожога у мышей. BMC Microbiol. 2009; 9: 23. [Бесплатная статья PMC] [PubMed] [Google Scholar] 5. Chua AWC, Khoo YC, Tan BK, Tan KC, Foo CL, Chong SJ. Развитие тканевой инженерии кожи при тяжелых ожогах: обзор и терапевтическое применение. Ожоговая травма. 2016; 4: 1. [Бесплатная статья PMC] [PubMed] [Google Scholar] 6. Парихар А., Парихар М.С., Милнер С., Бхат С. Окислительный стресс и антиоксидантная мобилизация при ожоговой травме.Бернс. 2008; 34: 6–17. [PubMed] [Google Scholar] 7. Mohtasham Amiri Z, Tanideh N, Seddighi A, Mokhtari M, Amini M, Shakouri Partovi A, Manafi A, Hashemi SS, Mehrabani D. Действие мазей lithospermum officinale, сульфадиазина серебра и альфа в заживлении ожоговых ран у крыс. Мир J Plast Surg. 2017; 6: 313–18. [Бесплатная статья PMC] [PubMed] [Google Scholar] 8. Akhoondinasab MR, Akhoondinasab M, Saberi M. Сравнение лечебного эффекта экстракта алоэ вера и сульфадиазина серебра при ожоговых травмах на экспериментальной модели крысы.Мир J Plast Surg. 2014; 3: 29–34. [Бесплатная статья PMC] [PubMed] [Google Scholar] 9. Таниде Н., Хаддади М. Х., Рокни-Хоссейни М. Х., Хоссиензаде М., Мехрабани Д., Сайехмири К., Кухи-Хоссиенабади О. Лечебный эффект scrophularia striata на экспериментальные ожоговые раны, инфицированные синегнойной палочкой у крыс. Мир J Plast Surg. 2015; 4: 16–22. [Бесплатная статья PMC] [PubMed] [Google Scholar] 10. Мехрабани Д., Фарджам М., Герамизаде Б., Таниде Н., Амини М., Панджешахин М.Р. Лечебный эффект куркумина на ожоговые раны у крыс.Мир J Plast Surg. 2015; 4: 29–35. [Бесплатная статья PMC] [PubMed] [Google Scholar] 11. Таниде Н., Рохсари П., Мехрабани Д., Мохаммади Самани С., Сабет Сарвестани Ф., Ашраф М.Дж., Кухи Хоссейнабади О., Шамсиан С., Ахмади Н. Лечебный эффект солодки на ожоговые раны, инфицированные синегнойной палочкой, на экспериментальной модели крысы. Мир J Plast Surg. 2014; 3: 99–106. [Бесплатная статья PMC] [PubMed] [Google Scholar] 12. Tölke EEAD, De Melo JIM, Carmello-Guerreiro SM, Lacchia APS. Анатомия листа с акцентом на разделение двух видов Varronia P Br (Cordiaceae) полузасушливого региона Бразилии.Braz J Botany. 2013; 36: 189–201. [Google Scholar] 13. Ахани Х., Махдави П., Норузи Дж., Зарринпур В. Структура растительности ирано-туранской степи вдоль высотного градиента 3000 м в горах Альборз на севере Ирана. Folia Geobot. 2013; 48: 229–55. [Google Scholar] 14. Лопес Лопес Ли, Флорес Н., Даниэль С., Сильва Белмарес Си, Саенс Галиндо А. Нафтохиноны: биологические свойства и синтез лавсона и производных – структурированный обзор. Vitae. 2014; 21: 248–58. [Google Scholar] 15. Наз С., Ахмад С., Расул С.А., Сайид С.А., Сиддики Р.Антибактериальная активность направлена ​​на выделение соединений из Onosma hispidum. Microbiol Res. 2006; 161: 43–8. [PubMed] [Google Scholar] 16. Али С.С., Касоджу Н., Лутра А., Сингх А., Шаранабасава Х., Саху А., Бора Ю. Индийские лекарственные травы как источники антиоксидантов. Food Res Int. 2008; 41: 1–15. [Google Scholar] 17. Салминен А., Лехтонен М., Сууронен Т., Каарниранта К., Хуусконен Дж. Терпеноиды: естественные ингибиторы передачи сигналов NF-κB с противовоспалительным и противораковым потенциалом. Cell Mol Life Sci. 2008; 65: 2979–99.[PubMed] [Google Scholar] 18. Бисвас Т.К., Мукерджи Б. Растительные лекарства индийского происхождения для заживления ран: обзор. Int J Раны нижних конечностей. 2003; 2: 25–39. [PubMed] [Google Scholar] 19. Moghaddam PZ, Maz M, Zolfaghari M, Badeleh M, Ghaemi E. Антибактериальная и антиоксидантная активность экстракта корня Onosma dichroanthum Boiss на севере Ирана. Afr J Microbiol Res. 2012; 6: 1776–81. [Google Scholar] 20. Халили М.А., Миресмаили С.М., Хекмати Могхаддам Х., Резаи С., Вахиди А.Р. Изучение заживления ожогов Onosma stenosiphon при ожогах II типа спины и яичек у крыс.J Herbal Drug. 2010; 1: 23–7. [Google Scholar] 21. Хеммати А.А., Агель Н., Рашиди И., Голампур-Агдами А. Экстракт семян винограда (Vitis vinifera) для местного применения способствует заживлению ран на всю толщину у кролика. Int Wound J. 2011; 8: 514–20. [Бесплатная статья PMC] [PubMed] [Google Scholar] 22. Кросс С., Нейлор Л., Коулман Р., Тео Т. Экспериментальная модель для исследования динамики сокращения раны. Br J Plast Surg. 1995; 48: 189–97. [PubMed] [Google Scholar] 23. Лопес-Де Леон А., Ройкинд М. Простой микрометод для определения коллагена и общего белка в фиксированных формалином срезах, залитых парафином.J Histochem Cytochem. 1985; 33: 737–43. [PubMed] [Google Scholar] 24. Саха К., Мукерджи П.К., Дас Дж., Пал М., Саха Б. Заживляющая активность Leucas lavandulaefolia Rees. J Ethnopharmacol. 1997; 56: 139–44. [PubMed] [Google Scholar] 25. Maguire SA, Upadhyaya M, Evans A, Mann MK, Haroon M, Tempest V, Lumb RC, Kemp AM. Систематический обзор жестоких висцеральных травм в детстве – их диапазон и признание. Жестокое обращение с детьми Negl. 2013; 37: 430–45. [PubMed] [Google Scholar] 26. Vloemans A, Hermans M, van der Wal M, Liebregts J, Middelkoop E.Оптимальное лечение ожогов частичной толщины у детей: систематический обзор. Бернс. 2014; 40: 177–90. [PubMed] [Google Scholar] 28. Кюттер М., Романо Л., Вентура-Лима Дж., Тессер М., Монсеррат Дж. Антиоксидантные и токсикологические эффекты, вызываемые альфа-липоевой кислотой в водных организмах. Comp Biochem Physiol Часть C: Toxicol Pharmacol. 2014; 162: 70–6. [PubMed] [Google Scholar] 29. Ли Г.Й., Пак К.Г., Намгун С., Хан С.К., Чжон С.Х., Донг Е.С., Ким В.К. Влияние экстракта женьшеня Panax на пролиферацию дермальных фибробластов и синтез коллагена.Int Wound J. 2016; 13: 42–6. [Бесплатная статья PMC] [PubMed] [Google Scholar] 30. Озген У, Икбал М., Хачимуфтуоглу А., Хоутон П., Гоцер Ф, Доган Х, Коскун М. Стимуляция роста фибробластов экстрактами и соединениями корней Onosma argentatum. J Ethnopharmacol. 2006; 104: 100–3. [PubMed] [Google Scholar] 31. Папагеоргиу В. Ранозаживляющие свойства нафтахиноновых пигментов алканны тинкторией. Experientia. 1978; 34: 1499–501. [PubMed] [Google Scholar] 32. Чен X, Ян Л., Оппенгейм Дж. Дж., Ховард О. Клеточные фармакологические исследования производных шиконина.Phytother Res. 2002; 16: 199–209. [PubMed] [Google Scholar] 33. Николау К., Хепворт Д. Краткий и эффективный общий синтез алканнина и шиконина. Angewandte Chemie. 1998; 37: 839–41. [Google Scholar] 34. Дрисколл Дж., Хазард Дж. Дж., Вуд Дж. Х., Голдин А. Взаимосвязи между структурой и противоопухолевой активностью среди производных хинона. Рак Chemother Rep Part. 1974; 4: 1. [PubMed] [Google Scholar] 35. Wu HQ, Хуан ZS, Бу XZ, Шен YD, Zhang ZL, Xie BF, Liu ZC, Gu LQ, Chan AS. Молекулярные механизмы, участвующие в цитотоксичности производных алканнина.Eu J Med Chem. 2005; 40: 1341–5. [PubMed] [Google Scholar] 36. Trachootham D, Alexandre J, Huang P. Нацеливание на раковые клетки с помощью ROS-опосредованных механизмов: радикальный терапевтический подход? На Rev Drug Discov. 2009; 8: 579–91. [PubMed] [Google Scholar] 37. Klotz LO, Hou X, Jacob C. 1, 4-нафтохиноны: от окислительного повреждения клеточной и межклеточной передачи сигналов. Молекулы. 2014; 19: 14902–18. [Бесплатная статья PMC] [PubMed] [Google Scholar] 38. Ли Дж., Чен Дж., Кирснер Р. Патофизиология заживления острых ран.Clin Dermatol. 2007; 25: 9–18. [PubMed] [Google Scholar] 39. Уоллер Дж. М., Майбах Х. И.. Возраст, структура и функция кожи, количественный подход (II): содержание и структура белков, гликозаминогликанов, воды и липидов. Skin Res Technol. 2006; 12: 145–54. [PubMed] [Google Scholar] 40. Ассимопулу А., Боскоу Д., Папагеоргиу В. Антиоксидантная активность экстрактов корней алканнина, шиконина и алканны тинкторией в масляных субстратах. Food Chem. 2004. 87: 433–8. [Google Scholar] 41. Тан Дж, Лю Х, Гао Ц, Му Л, Ян С, Ронг М, Чжан З, Лю Дж, Дин Кью, Лай Р.Небольшой пептид с потенциальной способностью ускорять заживление ран. ПлоС один. 2014; 9 [Бесплатная статья PMC] [PubMed] [Google Scholar] Экстракт корня

Havachoobe (Onosma dichroanthum Boiss) снижает секрецию поверхностного антигена вируса гепатита B в клеточной линии PLC / PRF / 5 – FullText – Intervirology 2021, Vol. 64, № 1

Абстрактные

Справочная информация: Многие усилия в настоящее время сосредоточены на функциональном лечении вируса гепатита B (HBV).Это можно сделать, подавив секрецию поверхностного антигена HBV (HBsAg). В этом отношении научные сообщества очень заинтересованы в натуральных продуктах. Цель: Использование экстракта корня Havachoobe ( Onosma dichroanthum BoissI ), местной лечебной травы Северного Ирана, для оценки его активности против секреции HBsAg. Методы: Havachoobe был куплен в ближайшей аптеке. Экстракт корня растений получали с помощью водно-спиртового процесса.Цитотоксическую активность экстракта исследовали на клетках PLC / PRF / 5 с помощью анализа МТТ. ELISA использовался для измерения HBsAg в супернатантах обработанной клеточной линии. Кроме того, был проведен ПЦР-анализ в реальном времени для оценки экспрессии HBsAg до и после лечения Onosma in vitro. Результаты: Результаты показали очень низкую цитотоксичность экстракта корня при концентрациях ниже 8 мкг / мл. Инфекционная доза 50 тканевой культуры составила 63,78 мкг / мл. В зависимости от дозы и времени значительно сниженная секреция HBsAg наблюдалась при концентрации 8 ppm через 12 часов после обработки.Результат ПЦР в реальном времени показал относительное снижение экспрессии HBsAg при всех дозах через 12 ч после обработки. Обсуждение: В этом исследовании мы впервые сообщили об активности анти-HBsAg в иранском растительном лекарстве. Было показано, что экстракт корня хавачобе способен ингибировать HBsAg в зависимости от дозы и времени. Мы обнаружили, что экстракт оказывает ингибирующее действие на HBsAg, направляя транскрипцию HBsAg.

© 2020 S. Karger AG, Базель


Введение

Группа высокоспецифичных вирусов образует семейство Hepadnaviridae.Одним из членов этого семейства является вирус гепатита B человека (HBV), который вызывает хронический гепатит B и, следовательно, цирроз и гепатоцеллюлярную карциному [1-3]. Во всем мире насчитывается более 250 миллионов хронически инфицированных людей и 600 000 смертей ежегодно от органной недостаточности, связанной с HBV [4]. Для снижения риска гепатоцеллюлярной карциномы, вызванной HBV, рекомендуется несколько одобренных FDA аналогов нуклеоз (т) идов, включая ламивудин, адефовир, энтекавир, телбивудин и тенофовир, которые подавляют или снижают репликацию вируса [5].

Длительное лечение аналогами нуклеоз (т) идов может привести к появлению лекарственно-устойчивых квазивидов вируса [6]. Фактически, функциональное лечение HBV заключается в подавлении секреции поверхностного антигена HBV (HBsAg) из инфицированных клеток [4]. Таким образом, инновационные терапевтические достижения с использованием методов борьбы с HBV могут обеспечить более глубокое понимание механизма вирусного патогенеза и менее токсичного лечения. Будучи прекрасным источником новых биомолекул, травы и их метаболиты имеют многообещающие варианты лечения.В настоящее время из трав, используемых для лечения различных заболеваний, создается значительное количество лекарств [7–9]. Род Onosma L. ( Boraginaceae ) включает множество видов, распространенных в Азии, Евразии, Средиземноморье и Европе [10, 11], и включает около 150 известных видов в Азии, в том числе 29 в Китае, 95 в Турции 8. в Пакистане [10] и 39 в Иране [10, 12].

Иран с разнообразным климатом и большим разнообразием лекарственных трав может быть источником выделения активного соединения, которое может быть эффективным против вирусов [13].Хавачобе ( Onosma dichroanthum Boiss ) – уникальное лечебное растение в провинции Мазандаран, Иран. Экстракты корня хавачобе обладают противовоспалительным действием и используются для лечения и заживления ожоговых ран [14]. Более того, некоторые представители этого рода также используются для лечения таких заболеваний, как одышка, тонзиллит, язва желудка, ревматизм, сердечно-сосудистые заболевания, почечный геморрой и охриплость голоса. Помимо лечебных свойств, красный краситель корней также используется в качестве красителя в текстильной и пищевой промышленности.Основными составляющими корня Havachoobe являются фенол, антоцианин и флавоноиды [15]. Эллаговая кислота была среди флавоноидов, обладающих анти-HBV активностью [16]. Oenanthe javanica растительные флавоны продемонстрировали анти-HBV активность за счет ингибирования HBsAg в нетоксичных концентрациях у HBV-инфицированных уток и клеточной линии HepG2.2.15 [17].

Поскольку утверждается, что основное отделение Havachoobe состоит из флавоноидов [14, 15, 18], мы решили поэкспериментировать с его анти-HBV активностью. Таким образом, целью данного исследования было изучить влияние экстракта корня Havachoobe на секрецию HBsAg в клеточной линии PLC / PRF / 5.Результаты показали, что секреция HBsAg при нетоксичных концентрациях экстракта растений была значительно снижена.

Материал и методы

Растительный материал

Хавачуб был приобретен в местной аптеке в Горгане, Иран. Водно-спиртовой экстракт растений готовили методом мацерации после таксономической идентификации растения. Для этого растительный материал оставляли хорошо просушивать при дневном свете. Электрический блендер использовался для тщательного измельчения высушенного растения, и 100 г материала помещали в химический стакан емкостью 1000 мл.В стакан добавляли 500 мл раствора спирт / дистиллированная вода (с соотношением 30 и 70% соответственно) и тщательно перемешивали. Через 72 ч растворитель отделяли, а оставшийся раствор фильтровали с использованием фильтровальной бумаги Whatman (0,2 мкм). Полученный неочищенный экстракт затем концентрировали с использованием роторного испарителя. Конечный растительный экстракт использовали для получения серийной концентрации, использованной в этом исследовании.

Приготовление образца

Остатки конечного сырого экстракта суспендировали в диметилсульфоксиде / среде (1: 9) и при разведении 1 ppm (1 мкг / мл), 2, 4, 8, 16, 32, 64, и 128 частей на миллион были получены.Все эти серийные концентрации снова центрифугировали при 10 000 g в течение 5 минут для удаления любых вероятных нерастворенных фракций.

Культура клеток PLC / PRF / 5

PLC / PRF / 5 была предоставлена ​​из предыдущего исследования нашей группы [19]. Полная среда, содержащая модифицированную Дульбекко среду Игла (Gibco, Waltham, MA, USA) с добавлением 10% фетальной бычьей сыворотки (Gibco, Waltham, MA, USA) и 1% антибиотиков Pen / Strep (Gibco, Waltham, MA, USA), была подготовлен для клеточной культуры.Флакон с клеточной линией плавили и размножали на колбах Т-75 и инкубировали при 37 ° C с 5% CO 2 и 10% влажностью. После достижения конфлюэнтности ≥90% клетки собирали и высевали в 96-луночные планшеты, дополненные полной средой для анализа цитотоксичности клеток.

Анализ жизнеспособности и цитотоксичности

клеток

Клетки PLC / PRF / 5 засевали либо полной средой, либо средой, содержащей экстракты толпы медоносных пчел. Вкратце, 8000–10 000 клеток на лунку высевали в 96-луночный планшет и инкубировали в течение 12 часов.Впоследствии супернатанты удаляли и заменяли либо свежей полной средой, либо экстрактами. Жизнеспособность клеток оценивали с помощью анализа МТТ (Sigma, Сент-Луис, Миссури, США) в течение 12, 48 и 72 часов после обработки. Лунки промывали PBS (Gibco, Waltham, MA, USA) после каждой временной точки и добавляли МТТ (20 мкл / лунку). После восстановления МТТ и образования фиолетовых кристаллов кристаллы формазана растворяли путем добавления диметилсульфоксида (100 мкл / лунку). Планшеты считывали с помощью ридера ELISA (BioTeck, Lionheart Technologies, Inc., Winooski, VT, USA) на длине волны 570 нм. Каждый тест измеряли в трех экземплярах.

Исследование секреции HBsAg

Для исследования ингибирования секреции HBsAg 8 000–10 000 клеток дважды высевали в 96-луночные планшеты. Двенадцать часов спустя клетки промывали PBS и заменяли либо полной средой, либо средой, содержащей экстракт корня растения в нетоксичных концентрациях. Через 12, 48 и 72 ч после обработки супернатанты собирали и хранили при -20 ° C для анализа HBsAg ELISA.Набор HBsAg Sandwich ELISA (PadTanDanesh Co., Тегеран, Иран) использовали для обнаружения HBsAg в супернатанте в соответствии с протоколом производства. Планшеты считывали при 450 нм с помощью ридера ELISA (Bio Teck, Lionheart Technologies, Inc., Winooski, VT, USA). Значение отсечки составляло 0,2, и результат был определен по следующей формуле:

Значения S / Co> 1 считались положительными. OD для каждого теста также использовали для оценки уровней снижения HBsAg в супернатанте обработанных клеток.

ПЦР-анализ экспрессии HBsAg в реальном времени

Первоначальный 96-луночный планшет с 8000–10 000 клеток PLC / PRF / 5 на лунку засевали и инкубировали в течение 12 часов. Лунки промывали и снова заполняли свежей полной средой в качестве контроля или экстрактом корня Havachoobe в нетоксичных концентрациях. Для анализа экспрессии HBsAg РНК экстрагировали как из обработанных, так и из необработанных клеток раствором тризола (DNAbiotech Co., Тегеран, Иран) через 12, 48 и 72 часа после обработки. кДНК синтезировали с помощью набора RevertAid First Strand cDNA Synthesis Kit (Thermo Scientific TM , Waltham, MA, USA) и в соответствии с его протоколом.Для каждого образца для синтеза кДНК использовали 600 нг РНК. Синтез кДНК был дополнительно подтвержден амплификацией гена GAPDH [20]. Экспрессию гена HBsAg оценивали в контролируемых и обработанных клетках с помощью набора SYBR Green qPCR Master Mix (Yekta-Tajhiz Inc., Тегеран, Иран) и конкретной пары праймеров (прямой: TGTTCAGTGGTTCGTAGGGC и обратный: ACAGCGGCATAAAGGGCATC). Термоциклирование было следующим: 2 мин 94 ° C, затем 35 циклов 94 ° C в течение 30 с, 58 ° C в течение 30 с и 72 ° C в течение 20 с.Каждый тест повторяли 3 раза. Для определения эффективности ОТ-ПЦР использовали серию из пяти необработанных образцов РНК, разведенных 1:10. Кратное изменение уровней экспрессии HBsAg оценивали с использованием метода 2 -∆Ct в контрольных и обработанных клетках.

Статистический анализ

Статистический анализ проводился с помощью GraphPad Prism 7. Двусторонний дисперсионный анализ ANOVA представлял собой статистический анализ различий цитотоксичности экстракта и экспрессии HBsAg через 12, 48 и 72 часа после обработки различных концентраций экстракты растений.Графики были построены с использованием MS Excel 2016 и GraphPad Prism 7.

Результаты

Инфекционная доза для культуры ткани оносмы 50

В результате анализа цитотоксичности была получена инфекционная доза 50 для культуры ткани (TCID50), равная 63,78 мкг / мл за 12 ч. лечение после. Никакой значительной цитотоксичности не наблюдалось при концентрациях 1, 2, 4 и 8 частей на миллион через 12 часов после обработки PLC / PRF / 5. В то время как более высокие концентрации 64 и 128 частей на миллион имели цитотоксичность на 83 и 86% соответственно (рис. 1).

Фиг.1.

Цитотоксичность различных концентраций Havachoobe в клеточной линии PLC / PRF / 5, содержащей интегрированный геном HBV, через 12, 24 и 72 часа после обработки. Существенной цитотоксичности до концентраций ниже 8 ppm не наблюдалось.

На этом этапе 4 концентрации (1, 2, 4 и 8 ppm) без цитотоксичности были выбраны для исследования секреции HBsAg в супернатанте клеточной линии PLC / PRF / 5 с использованием анализа ELISA. Как показано на Фигуре 2, снижение концентрации HBsAg наблюдалось в зависимости от времени при 8 ppm экстракта.Однако уровень HBsAg восстановился через 48 и 72 часа после лечения.

Рис. 2.

Результаты качественного анализа ELISA. Он показывает значительное снижение уровня HBsAg через 12 часов после лечения. Не было значительных различий между уровнями HBsAg через 48 и 72 часа после лечения. Через 12 ч наблюдалось значительное снижение HBsAg при 8 ppm по сравнению с 1, 2 и 4 ppm (значение p <0,001). HBsAg, поверхностный антиген вируса гепатита В.

Мы также спросили, обладает ли экстракт анти-HBsAg активностью на уровне экспрессии гена.Значительные различия в уровнях экспрессии HBsAg наблюдались при более высоких концентрациях экстракта. На рисунке 3 показаны изменения порога цикла в экспрессии HBsAg в обработанных и необработанных контрольных клетках. Поскольку полученные значения ∆CT были ниже 1, значения данных были преобразованы (1 / ∆CT) для получения кратного изменения снижения HBsAg. В соответствии с результатом ELISA, через 12 часов после обработки мы наблюдали значительное снижение уровня экспрессии HBsAg (32,22 раза) при 8 ppm. Кроме того, более высокие уровни экспрессии HBsAg наблюдались через 48 и 72 часа после лечения.

Рис. 3.

a показывает линейность серийно разведенных РНК, экстрагированных из необработанной клеточной линии PLC / PRF / 5. В результате эффективность проведенной ПЦР в реальном времени составила 86,32%. b показывает вариацию CT между обработанными и необработанными группами в экспрессии HBsAg. В любой момент времени не наблюдалось заметного кратного изменения уровней экспрессии HBsAg при концентрации 1 ppm. В целом, снижение уровня HBsAg наблюдалось во всех 4 концентрациях Havachoobe.HBsAg, поверхностный антиген вируса гепатита В.

Обсуждение

Известно, что функциональное излечение хронического гепатита B достигается путем подавления секреции HBsAg [4]. Существует несколько важных подходов к ингибированию секреции HBsAg, включая полимеры нуклеиновых кислот [21] и подавление генов малыми интерференционными РНК [22]. Дальнейшие исследования в этом направлении все еще продолжаются. Между тем природа является огромным источником веществ для открытия активных продуктов, действующих против патогенов человека [23, 24], таких как вирусы.

В настоящем исследовании оценивали ингибирующее действие экстракта корня Havachoobe на секрецию HBsAg в клеточной линии PLC / PRF / 5. Было зарегистрировано, что первичная клеточная линия, происходящая от карциномы печени (PLC / PRF / 5), содержит интегрированную форму последовательности подтипа adw HBV [25, 26]. Следовательно, эта клеточная линия содержит последний фрагмент генома HBV, продуцирующий и секретирующий HBsAg, но не другой известный вирусный белок [27]. Это делает эту клеточную линию подходящей для изучения эффектов новых соединений на экспрессию и секрецию HBsAg.Поскольку клетки не производят инфекционных частиц вирионов, с ними также безопасно обращаться.

В настоящее время из растений производится большое количество препаратов, действующих против различных заболеваний [7-9]. Вид Onosma в основном распространен в Азии, Евразии, Средиземноморье и Европе [10, 11] и насчитывает около 230 видов [10, 28]. В этом исследовании цитотоксическая активность экстракта корня Havachoobe была исследована с использованием анализа MTT на клеточной линии PLC / PRF / 5. Результаты показали TCID50 63,78 мкг / мл через 12 часов после обработки.Никакой значительной токсичности не наблюдалось при любой дозе через 12 ч после обработки. Более низкие дозы экстракта (1, 2, 4 и 8 частей на миллион) не проявляли токсичности в клеточной линии через 12, 48 и 72 часа после обработки. Эти концентрации были выбраны для исследования секреции и экспрессии HBsAg в клеточной линии PLC / PRF / 5.

Секрецию HBsAg количественно определяли в супернатанте обработанной клеточной линии. Результат показал значительное дозозависимое и зависимое от времени снижение HBsAg через 12 часов после лечения.Тем не менее, через 48 ч уровень HBsAg восстановился и повысился через 72 ч после лечения. Это может быть связано с периодом полужизни экстракта и продолжающейся экспрессией и продуцированием антигена в интегрированной форме гена HBsAg. Однако по сравнению с другими концентрациями продукция HBsAg при 8 ppm экстракта была ниже во всех 3 временных точках после обработки.

Чтобы оценить, является ли снижение HBsAg следствием подавления гена HBsAg, была проведена ПЦР в реальном времени для амплификации областей, кодирующих ген HBsAg, в клетках PLC / PRF / 5.Результаты показали 32,22-кратное снижение экспрессии HBsAg при 8 м.д. экстракта через 12 часов после обработки. В соответствии с результатами ELISA экспрессия HBsAg увеличивалась через 48 и 72 часа после обработки. Были также некоторые противоречия, такие как значительное снижение экспрессии HBsAg на 4 ppm через 72 часа после обработки, что могло быть результатом эффективности ПЦР (86,32%). Тем не менее, результаты показывают, что экстракт корня Havachoobe нацелен на секрецию HBsAg в процессе транскрипции.Дополнительная информация может быть получена путем анализа роли основных компонентов корня Havachoobe в том же эксперименте.

Заключение

В настоящем исследовании мы продемонстрировали анти-HBV активность Havachoobe, иранского фитотерапевтического средства. Экстракт корня растения в подавляющей дозе обладал низкой цитотоксичностью. Результат кПЦР показал, что экстракт нацелен на экспрессию HBsAg в клеточной линии PLC / PRF / 5.

Заявление об этике

Этического одобрения не требовалось, поскольку в исследование не были включены люди или животные.

Заявление о конфликте интересов

Авторы не сообщают о конфликте интересов.

Источники финансирования

Эта статья была подготовлена ​​на основе гранта в области вирусологии и полностью поддержана Голестанским университетом медицинских наук, Горган, Иран.

Вклад авторов

Все упомянутые авторы согласны нести ответственность за все аспекты работы, обеспечивая надлежащее расследование и решение вопросов, связанных с точностью или целостностью любой части работы.Каждый автор внес свой вклад в любую из частей исследования, включая сбор, анализ, интерпретацию данных, составление проекта работы или ее критический пересмотр с точки зрения важного интеллектуального содержания, а также окончательное утверждение версии, которая будет опубликована.

Список литературы

  1. Зулим Ф, Локарнини С.Устойчивость вируса гепатита В к аналогам нуклеоз (т) идов. Гастроэнтерология. 2009; 137 (5): 1593–608.e1.2.
  2. Дандри М., Локарнини С. Новое понимание патобиологии вирусной инфекции гепатита В. Кишечник. 2012; 61 (Приложение 1): i6.
  3. Мохебби А., Мохаммади С., Мемариан А.Прогнозирование взаимодействий HBF-0259 с рецепторами вируса гепатита В и секреторными факторами поверхностных антигенов. Вирусное заболевание. 2016; 27 (3): 234.
  4. Mohebbi A, Lorestani N, Tahamtan A, Kargar NL, Tabarraei A. Обзор ингибиторов секреции поверхностного антигена вируса гепатита B. Front Microbiol.2018; 9 (апрель): 1–9.
  5. Lim Y-S. Управление противовирусной резистентностью при хроническом гепатите B. Печень кишечника. 2017; 11 (2): 189–95.
  6. Гиш Р., Джиа Дж. Д., Локарнини С., Зулим Ф.Подбор терапии хронического гепатита В с высоким барьером устойчивости. Lancet Infect Dis. 2012; 12 (4): 341–53.
  7. Али А., Хуссейн Ф., Шахид М. Исследование потенциала заживления ран экстракта корня Onosma hispidum на моделях кроликов. Prog Nutr. 2015; 17 (3): 245–9.
  8. Асади С.Ю., Парсаи П., Карими М., Эззати С., Замири А., Мохаммадизаде Ф. и др.Влияние экстракта зеленого чая (Camellia sinensis) на процесс заживления хирургических ран у крыс. Int J Surg. 2013. 11 (4): 332–7.
  9. Хан А.А., Кумар В., Сингх Б.К., Сингх Р. Оценка способности заживления ран Terminalia catappa на моделях иссеченных ран у крыс линии Wistar. Drug Res.2014. 64 (5): 225–8.
  10. Кумар Н., Кумар Р., Кишор К., Оносма Л. Оносма Л.: обзор фитохимии и этнофармакологии. Pharmacogn Rev.2013; 7 (14): 140–51.
  11. Kandemir A, Türkmen Z.Türkiye’nin doğu anadolu bölgesinden (Boraginaceae) yeni bir onosma (Boraginaceae) Türü. Turk J Bot. 2010. 34 (4): 277–82.
  12. Ахмад Реза М., Масуд С., Захра Н., Юнес А., Валейолла М. Межпростые повторы последовательности (ISSR) и морфологическое разнообразие видов Onosma L. (Boraginaceae) в Иране.Afr J Biotechnol. 2011; 10 (53): 10831–8.
  13. Moradi M-T, Rafieian-Kopaei M, Karimi A. Обзорное исследование действия иранских лекарственных трав против репликации вируса простого герпеса in vitro. Авиценна Дж. Фитомед. 2016; 6 (5): 506–15.
  14. Moghaddam PZ, Zolfaghari MR, Ghaemi EA, Mazandarani M, Mansourian AR, Taheri SA.Отрицательное действие экстракта корня Onosma dichroanthum Boiss. по заживлению ожоговой раны на животной модели. Arch Clin Microbiol. 2011; 2 (5).
  15. Мазандарани М. Влияние типа растворителя на содержание фенолов и флавоноидов и антиоксидантную активность у Onosma dichroanthum Boiss.J Med Plants Res. 2012; 6 (28).
  16. Шин М.С., Кан Э.Х., Ли Ю.И. Флавоноид из лекарственных растений блокирует секрецию антигена вируса гепатита В в гепатоцитах, инфицированных вирусом гепатита В. Antiviral Res. 2005. 67 (3): 163–8.
  17. Ван WN, Ян XB, Лю HZ, Хуан ZM, Wu GX.Влияние флавона Oenanthe javanica на инфицирование вирусом гепатита B человека и уток. Acta Pharmacol Sin. 2005. 26 (5): 587–92.
  18. Mazandarani M, Moghaddam PZ, Baiat H, Zolfaghari MR, Ghaemi EA, Hemati H. Антиоксидантная активность, содержание фенола, флавоноидов и антоцианов в различных экстрактах Onosma dichroanthum Boiss.На севере Ирана. Иран Дж. Физиология растений. 2011; 1 (3): 169–76.
  19. Шейх М., Эшраги Х.Р., Хошниа М., Мазандарани М., Моради А. Цитотоксический эффект Capparis spinosa L. на клеточную линию гепатоцеллюлярной карциномы человека PLC / PRF / 5. Med Lab J. 2017; 11 (4)): 9–12.
  20. Джавид Н., Мохебби А., Эскандарян С., Тахамтан А., Аскари Ф.С., Моради А. и др.Обнаружение вируса герпеса человека 6 типа у пациентов, находящихся на гемодиализе. Будущий Virol. 2018; 13 (4): 237–43.
  21. Vaillant A. Полимеры нуклеиновых кислот: противовирусная активность широкого спектра, противовирусные механизмы и оптимизация для лечения гепатита B и инфекции гепатита D.Antiviral Res. 2016; 133: 32–40.
  22. Schluep T, Lickliter J, Hamilton J, Lewis DL, Lai CL, Lau JY, et al. Безопасность, переносимость и фармакокинетика инъекции ARC-520, терапевтического средства на основе РНК-интерференции для лечения хронической вирусной инфекции гепатита B, у здоровых добровольцев.Clin Pharmacol Drug Dev. 2017; 6 (4): 350.
  23. Салим М. Натуральные продукты как противомикробные средства: обновленная информация. Новые стратегии противомикробных агентов. 2014: 219–94.
  24. Линь Л-Т, Сюй В-Ц, Лин Ц-С.Натуральные противовирусные препараты и лекарственные травы. J Tradit Complement Med. 2014. 4 (1): 24–35.
  25. Зиемер М., Гарсия П., Шауль Ю., Раттер В.Дж. Последовательность ДНК вируса гепатита В, включенная в геном линии клеток гепатомы человека. J Virol. 1985; 53 (3): 885.
  26. Koch S, Freytag von Loringhoven A, Kahmann R, Hofschneider PH, Koshy R.Генетическая организация интегрированной ДНК вируса гепатита В в клеточной линии гепатомы человека PLC / PRF / 5. Nucleic Acids Res. 1984; 12 (17): 6871.
  27. Чакраборти П.Р., Руис-опазо Н., Шуваль Д., Шафриц Д.А. Идентификация интегрированной ДНК вируса гепатита В и экспрессии вирусной РНК в линии клеток гепатоцеллюлярной карциномы человека, продуцирующей HBsAg.Природа. 1980; 286 (5772): 531.
  28. Бинзет Р., Кандемир И., Оркан Н. Палинологическая классификация видов Onosma L. (Boraginaceae) из региона Восточного Средиземноморья в Турции. Acta Bot Croat. 2010. 69 (2): 259–74.

Автор Контакты

Алиреза Мохебби

Кафедра микробиологии, Медицинский факультет

Голестанский университет медицинских наук

4934174515 Горган (Иран)

mohebbi-a @ goums.ac.ir


Подробности статьи / публикации

Предварительный просмотр первой страницы

Поступила: 27 июня 2020 г.
Дата принятия: 3 октября 2020 г.
Опубликована онлайн: 15 декабря 2020 г.
Дата выпуска: январь 2021 г.

Количество страниц для печати: 5
Количество рисунков: 3
Количество столов: 0

ISSN: 0300-5526 (печатный)
eISSN: 1423-0100 (онлайн)

Для дополнительной информации: https: // www.karger.com/INT


Авторские права / Дозировка препарата / Заявление об ограничении ответственности

Авторские права: Все права защищены. Никакая часть данной публикации не может быть переведена на другие языки, воспроизведена или использована в любой форме и любыми средствами, электронными или механическими, включая фотокопирование, запись, микрокопирование или с помощью какой-либо системы хранения и поиска информации, без письменного разрешения издателя. .
Дозировка лекарств: авторы и издатель приложили все усилия, чтобы гарантировать, что выбор и дозировка лекарств, указанные в этом тексте, соответствуют текущим рекомендациям и практике на момент публикации.Тем не менее, ввиду продолжающихся исследований, изменений в правительственных постановлениях и постоянного потока информации, касающейся лекарственной терапии и реакций на них, читателю настоятельно рекомендуется проверять листок-вкладыш для каждого препарата на предмет любых изменений показаний и дозировки, а также дополнительных предупреждений. и меры предосторожности. Это особенно важно, когда рекомендованным агентом является новый и / или редко применяемый препарат.
Отказ от ответственности: утверждения, мнения и данные, содержащиеся в этой публикации, принадлежат исключительно отдельным авторам и соавторам, а не издателям и редакторам.{2 +} $ несет элиситорский сигнал и, в свою очередь, регулирует биосинтез производных шиконина.

Информация о журнале

Клеточная биология и биология развития in vitro – Plant публикует своевременные рецензируемые статьи для растущего числа исследователей, занимающихся клеточной, молекулярной биологией или биологией развития с использованием выращенных или поддерживаемых in vitro органов, тканей или клеток, полученных из растений. Журнал предоставляет оригинальные исследования, посвященные развитию и распространению фундаментальных и прикладных знаний, и незаменим для исследователей сельскохозяйственных биотехнологий, ученых-промышленников, ученых университетов, а также аспирантов и аспирантов.Клеточная биология и биология развития in vitro. Растение частично продолжается в клеточной биологии и биологии развития in vitro. Клеточная биология in vitro и биология развития была частично продолжена In vitro Cellular & Developmental Biology. Завод в январе 1991 года и продолжение In vitro Cellular & Developmental Biology. Животное в марте 1993 года.

Информация об издателе

Общество биологии in vitro (SIVB) было основано в 1946 году как Ассоциация культур тканей для содействия обмену знаниями о биологии in vitro клеток, тканей и органов как растений, так и животных (включая человека).Основное внимание уделяется биологическим исследованиям, разработкам и приложениям, имеющим значение для науки и общества. Миссия осуществляется через публикации Общества; национальные и местные конференции, встречи и семинары; и через поддержку учебных инициатив в сотрудничестве с образовательными учреждениями. За прошедшие годы SIVB расширился, чтобы создать среду для научного обмена и междисциплинарного взаимодействия с целью развития существующих и будущих систем для биологии in vitro.

Растение, используемое в традиционной китайской медицине, эффективно против злокачественного рака кожи

Злокачественный рак кожи – один из самых опасных видов рака. Ежегодно в Австрии он диагностируется у 5000 человек. В последние десятилетия количество заболевших резко возросло. Тридцать лет назад злокачественными меланомами страдали всего пятьсот человек.

Напротив, уровень смертности увеличился лишь незначительно. При раннем обнаружении шансы на выздоровление хорошие.Но как только начинают образовываться метастазы, шансы на излечение быстро падают. Это также связано с тем, что практически не существует эффективных вариантов долгосрочного лечения (источник: Австрийское общество дерматологов (ÖGDV).

Биоактивные вещества растительного происхождения

Институт фармацевтических наук Университета Граца уже много лет проводит исследования природных веществ, которые можно использовать для лечения рака. Теперь команда достигла прорыва, который также может позволить вылечить запущенные стадии злокачественного рака кожи.Активное вещество из корней растения Onosma paniculata , подвида растения огуречника (также известного как незабудка), было успешно испытано на раковых клетках и на мышах. Исследователям также удалось изменить активный ингредиент и улучшить его действие.

Подпишитесь на IO в Telegram!

Хотите вдохновляться 365 дней в году? Вот возможность. Мы предлагаем вам один «источник инноваций» в день в компактном сообщении Telegram.Семь дней в неделю, доставка около 20:00. CET. Прямо из нашей редакции. Подпишитесь здесь, это бесплатно!

Подписаться!

Проект был реализован в сотрудничестве с Мюнхенским техническим университетом и Мюнхенским институтом Гельмгольца (Немецкий исследовательский центр гигиены окружающей среды). Группу возглавлял Рудольф Бауэр из Института фармацевтических наук (фармакогнозия) Университета Граца. Он исследовал лекарственные растения, которые используются в традиционной медицине в течение пятнадцати лет с целью выявления биоактивных ингредиентов и открытия новых ключевых веществ.

Основной целью исследования было выявить растения, которые используются в традиционной китайской медицине (ТКМ) в качестве лекарств от заболеваний, связанных с раком. Связано с раком, потому что определение рака в традиционной китайской медицине отличается от определения в западной медицине, – объясняет Надин Кречмер. Она работала с проектом и работает биологом в Гейдельбергском медицинском университете . Другой целью было проверить их пригодность в качестве активного вещества для конкретного лекарства. Примерно восемьдесят процентов всех химиотерапевтических препаратов получают из природы, особенно из растений.Эта цифра достигает семидесяти процентов только для лечения рака. «Действующие вещества, представленные на рынке, обычно подвергаются синтетической модификации, чтобы добиться оптимального эффекта. Затем активные вещества обычно производятся синтетическим или биотехнологическим способом для коммерческих целей », – говорит Кречмер.

Растения народной медицины

Вклад Университета Граца в проект был основан на базе данных из нескольких сотен лекарственных растений, используемых в традиционной медицине, которые были накоплены за несколько лет.Этот проект был посвящен растениям традиционной китайской медицины (ТКМ). Частью вклада немецких партнеров было выполнение секвенирования РНК (рибонуклеиновой кислоты) и предварительных оценок. Секвенирование РНК служит средством определения нуклеотидной последовательности в РНК и предоставляет информацию о том, как выражается генетическая информация гена.

В проект вошли семьдесят шесть наиболее перспективных экземпляров из базы данных. Они были высушены, переработаны в 253 экстракта и протестированы на различных раковых клетках.В конце концов, именно Onosma Paniculata Bureau & Franch , разновидность кустарника бурачника, открыла перспективы для дальнейших исследований. Сильнодействующее вещество β-β-диметилакрилшиконин (DMAS) находится в корне растения.

Без побочных эффектов

В ходе экспериментов вещество апробировано на клетках злокачественных меланом. Вещество разрушило клетки, тем самым подтвердив их эффективность. Чтобы проверить вещество на наличие побочных эффектов, первые тестов in vivo были проведены на мышах, которые были поражены раком кожи. β-β-диметилакрилшиконин вводили непосредственно в опухоль, что привело к ее изменению и отмиранию. Наблюдались два типа гибели клеток:

  • Апоптоз, регулируемая смерть, вызванная организмом
  • Некроз, неконтролируемая смерть;

Побочных эффектов не было.

Запланированы два последующих проекта

Последующие испытания проводились специально с целью модификации вещества с целью повышения его эффективности.Специфическое производное шиконина оказалось особенно эффективным. Это продемонстрировало, что вещество хорошо подходит для разработки фармацевтических препаратов. Тем временем были запланированы еще два последующих проекта. Кречмер заявляет, что требуются более обширные исследования, а метод применения остается открытым.

Кречмер подчеркивает, что ТКМ была вдохновением для активного вещества. До сих пор не ясно, как это работает в TCM. Обычно в TCM не используются отдельные растения, вместо этого используются смеси растений.Их готовят как чай. В попытке разгадать эффект TCM, команда приготовила высушенное растение в соответствии с методом TCM и использовала его в экспериментах по культивированию клеток. Однако противоопухолевого эффекта не наблюдалось. Кречмер видит больший потенциал в методе подготовки на масляной основе, который наносится на пораженные участки кожи. Это связано с тем, что шиконинов обнаруживаются в масле в более высоких концентрациях.

Подтверждение идентичности видов растений

В ходе проекта также была проверена идентичность видов бурачников, продаваемых в качестве средств традиционной китайской медицины.«Есть корни, которые очень похожи на корни растения, которое мы изучаем, и мы обнаружили, что этот вид часто продается в Китае под вымышленными названиями». Это проблематично, потому что некоторые из продаваемых растений содержат потенциально вредные вещества.

Кречмер и группа исследователей нашли техническое решение проблемы: метод, использующий тонкослойную хроматографию для идентификации растений. Эта новинка основана на системе CAMAG и достаточно проста для использования в аптеках.

Тонкослойная хроматография (ТСХ) – это физико-химический процесс разделения, который используется для исследования состава образцов.

Основной проект финансировался Австрийским научным фондом FWF и был завершен в начале 2019 года.

Публикации:

Kretschmer, N .; Deutsch, A .; Durchschein, C .; Риннер, Б .; Сталлингер, А .; Higareda-Almaraz, J.C .; Шайделер, М .; Lohberger, B .; Бауэр, Р .: Сравнительный анализ экспрессии генов в клетках меланомы WM164 показал, что β-β-диметилакрилшиконин приводит к образованию АФК, потере потенциала митохондриальной мембраны и индукции аутофагии, в: Molecules 2018, 23

Durchschein, C.; Hufner, A .; Риннер, Б .; Сталлингер, А .; Deutsch, A .; Lohberger, B .; Bauer, R .; Кречмер, Н .: Синтез новых производных шиконина и фармакологические эффекты циклопропилацетилшиконина на клетки меланомы, в: Molecules 2018, 23

Jahanafrooz, Z; Сталлингер, А; Андерс, я; Кляйнеггер, Ф; Lohberger, B; Durchschein, C; Bauer, R; Deutsch, A; Риннер, Б; Кречмер, Н .: Влияние силибинина и β-β-диметилакрилшиконина на клетки хордомы, в: Phytomedicine 2018, 49

.

Также представляет интерес:

Двойная терапия для снижения частоты рецидивов рака

Onosma echioides – Полезные растения умеренного климата

Л.

Boraginaceae


База данных Temperate находится в процессе обновления, при этом добавляются новые записи, а старые проверяются и обновляются там, где это необходимо. Эта запись еще не проверялась и не обновлялась.
Общее название:

Общая информация

Onosma echioides – многолетнее растение, достигающее 0,30 метра в высоту.
Его собирают в дикой природе для местного использования в качестве лекарства и источника материалов.

Известные опасности

Щетинистые стебли и листья могут вызывать сильное раздражение кожи [219
Title
Садоводство на стенах
Публикация
Автор
Грей-Уилсон. К. и Мэтьюз. V.
Издатель
Коллинз
Год
1983
ISBN
0-00-219220-0
Описание
Хорошая маленькая книжка о растениях для выращивания у стен и небольшой раздел о растениях, которые могут расти в стенах.
].

Ботанические ссылки

89
Название
Цветы Средиземноморья.
Публикация
Автор
Полунин. О. и Хаксли. А.
Издатель
Hogarth Press
Год
1987
ISBN
0-7012-0784-1
Описание
Хорошо читаемая карманная флора, хорошо иллюстрированная. Дает некоторую информацию об использовании растений.
, 200
Название
Новый словарь садоводства RHS.1992.
Публикация
Автор
Хаксли. А.
Издатель
MacMillan Press
Год
1992
ISBN
0-333-47494-5
Описание
Отлично и очень исчерпывающе, хотя и содержит ряд глупых ошибок. Читабельно, но также очень подробно.

Диапазон

от юга до севера Африки.

Среда обитания

Известняковые склоны и скалы высотой до 1600 метров [187
Название
Многолетние растения.Том 1 и 2.
Публикация
Автор
Филлипс. Р. и Рикс. М.
Издательство
Pan Books
Год
1991
ISBN
0-330-30936-9
Описание
Фотографии более 3000 видов и сортов декоративных растений вместе с краткими сведениями о выращивании, сведениями о среде обитания и т. Д.
]. Расщелины в скалах и обрывах [89
Название
Цветы Средиземноморья.
Публикация
Автор
Полунин. О. и Хаксли. А.
Издатель
Hogarth Press
Год
1987
ISBN
0-7012-0784-1
Описание
Хорошо читаемая карманная флора, хорошо иллюстрированная. Дает некоторую информацию об использовании растений.
].

Объекты

Рейтинг лекарственных средств
Привычка Многолетник
Высота 0.30 м
опылители Насекомые
Статус выращивания Дикий

Подробные сведения о выращивании

Требуется хорошо дренированная почва на ярком солнце [1
Название
RHS Словарь растений плюс приложение. 1956
Публикация
Автор
Ф. Читтендон.
Издатель
Oxford University Press
Год
1951
ISBN
Описание
Исчерпывающий список видов и способов их выращивания.Несколько устаревший, он был заменен в 1992 г. новым словарем (см. [200]).
, 187
Название
Многолетние растения. Том 1 и 2.
Публикация
Автор
Филлипс. Р. и Рикс. М.
Издательство
Pan Books
Год
1991
ISBN
0-330-30936-9
Описание
Фотографии более 3000 видов и сортов декоративных растений вместе с краткими сведениями о выращивании, сведениями о среде обитания и т. Д.
]. Предпочитает глубокие, довольно богатые супеси [1
Title
RHS Dictionary of Plants plus Supplement. 1956
Публикация
Автор
Ф. Читтендон.
Издатель
Oxford University Press
Год
1951
ISBN
Описание
Исчерпывающий список видов и способов их выращивания. Несколько устаревший, он был заменен в 1992 г. новым словарем (см. [200]).
]. Лучше всего выращивать в расщелинах альпинария или на стене [1
Название
RHS Словарь растений плюс приложение. 1956
Публикация
Автор
Ф. Читтендон.
Издатель
Oxford University Press
Год
1951
ISBN
Описание
Исчерпывающий список видов и способов их выращивания. Несколько устаревший, он был заменен в 1992 г. новым словарем (см. [200]).
, 187
Название
Многолетние растения. Том 1 и 2.
Публикация
Автор
Филлипс. Р. и Рикс. М.
Издательство
Pan Books
Год
1991
ISBN
0-330-30936-9
Описание
Фотографии более 3000 видов и сортов декоративных растений вместе с краткими сведениями о выращивании, сведениями о среде обитания и т. Д.
].Переносит жаркие засушливые условия, а также засуху после того, как она укоренится, но не любит влажную зимнюю погоду [190
Title
The Dry Garden.
Публикация
Автор
Chatto. Б.
Издатель
Дент
Год
1982
ISBN
0460045512
Описание
Хороший список засухоустойчивых растений с подробным описанием того, как их выращивать.
]. Растения также не любят влажное лето [200
Название
Новый словарь садоводства RHS.1992.
Публикация
Автор
Хаксли. А.
Издатель
MacMillan Press
Год
1992
ISBN
0-333-47494-5
Описание
Отлично и очень исчерпывающе, хотя и содержит ряд глупых ошибок. Читабельно, но также очень подробно.
].
Выносливы примерно до -15 ° C [187
Название
Многолетние растения. Том 1 и 2.
Публикация
Автор
Филлипс.Р. и Рикс. М.
Издательство
Pan Books
Год
1991
ISBN
0-330-30936-9
Описание
Фотографии более 3000 видов и сортов декоративных растений вместе с краткими сведениями о выращивании, сведениями о среде обитания и т. Д.
].
Есть некоторая путаница по поводу этого вида. В некоторых отчетах он приводится как часть O. frutescens, но [200
Название
Новый словарь садоводства RHS.1992.
Публикация
Автор
Хаксли. А.
Издатель
MacMillan Press
Год
1992
ISBN
0-333-47494-5
Описание
Отлично и очень исчерпывающе, хотя и содержит ряд глупых ошибок. Читабельно, но также очень подробно.
] придает ему особый статус.
Очень декоративное растение [1
Название
RHS Словарь растений плюс приложение.1956
Публикация
Автор
Ф. Читтендон.
Издатель
Oxford University Press
Год
1951
ISBN
Описание
Исчерпывающий список видов и способов их выращивания. Несколько устаревший, он был заменен в 1992 г. новым словарем (см. [200]).
].

Съедобное использование

Не известно

Лекарственное средство

Листья являются альтернативными [240
Название
Глоссарий индийских лекарственных растений (включая дополнение).
Публикация
Автор
Чопра. Р. Н., Наяр. С. Л. и Чопра. I. C.
Издатель
Совет научных и промышленных исследований, Нью-Дели.
Год
1986
ISBN
Описание
Очень краткие сведения о лекарственном использовании растений с широким кругом ссылок и подробностей исследований в области химии растений. Не для случайного читателя.
]. Из них делают порошок и дают детям как слабительное [240
Название
Глоссарий индийских лекарственных растений (включая дополнение).
Публикация
Автор
Чопра. Р. Н., Наяр. С. Л. и Чопра. I. C.
Издатель
Совет научных и промышленных исследований, Нью-Дели.
Год
1986
ISBN
Описание
Очень краткие сведения о лекарственном использовании растений с широким кругом ссылок и подробностей исследований в области химии растений. Не для случайного читателя.
].
Цветы используются как сердечное и стимулирующее средство при лечении ревматизма и сердцебиения [240
Название
Глоссарий индийских лекарственных растений (включая добавку).
Публикация
Автор
Чопра. Р. Н., Наяр. С. Л. и Чопра. I. C.
Издатель
Совет научных и промышленных исследований, Нью-Дели.
Год
1986
ISBN
Описание
Очень краткие сведения о лекарственном использовании растений с широким кругом ссылок и подробностей исследований в области химии растений. Не для случайного читателя.
].
Корень поврежден и используется как наружное средство для удаления кожных высыпаний [240
Название
Глоссарий индийских лекарственных растений (включая дополнение).
Публикация
Автор
Чопра. Р. Н., Наяр. С. Л. и Чопра. I. C.
Издатель
Совет научных и промышленных исследований, Нью-Дели.
Год
1986
ISBN
Описание
Очень краткие сведения о лекарственном использовании растений с широким кругом ссылок и подробностей исследований в области химии растений. Не для случайного читателя.
].

Другое применение

Красный краситель получают из корня.Это заменитель алканны [46
Название
Словарь экономических предприятий.
Публикация
Автор
Uphof. J. C. Th.
Издатель
Weinheim
Год
1959
ISBN
Описание
Отличное и очень подробное руководство, но оно дает только очень краткие описания использования без каких-либо подробностей о том, как использовать растения. Не для случайного читателя.
, 61
Название
Словарь растений, используемых человеком.
Публикация
Автор
Ашер. Г.
Издатель
Констебль
Год
1974
ISBN
0094579202
Описание
Забудьте о сексистских названиях, это одна из лучших книг по этой теме. Перечисляет очень широкий спектр полезных растений со всего мира с очень краткими деталями использования.Не для случайного читателя.
].

Размножение

Семена – у нас нет информации об этом виде, но мы предлагаем сеять семена в теплице ранней весной. Выложите саженцы в отдельные горшки, как только они станут достаточно большими, чтобы с ними можно было справиться, и вырастите их в теплице хотя бы на первую зиму. Высаживайте их в начале лета.
Черенки в раму летом. Заштрихуйте их в течение первых 10–12 дней [1
Название
RHS Словарь растений плюс приложение.1956
Публикация
Автор
Ф. Читтендон.
Издатель
Oxford University Press
Год
1951
ISBN
Описание
Исчерпывающий список видов и способов их выращивания. Несколько устаревший, он был заменен в 1992 г. новым словарем (см. [200]).
].

Если у вас есть полезная информация об этом растении, оставьте, пожалуйста, комментарий.Комментарии должны быть одобрены, прежде чем они будут показаны здесь.

научных статей, журналов, авторов, подписчиков, издателей

Как крупный международный издатель академических и исследовательских журналов Science Alert издает и разрабатывает названия в партнерстве с самыми престижные научные общества и издатели. Наша цель заключается в том, чтобы максимально широко использовать качественные исследования. аудитория.
Мы прилагаем все усилия, чтобы поддержать исследователей которые публикуют в наших журналах. Есть масса информации здесь, чтобы помочь вам публиковаться вместе с нами, а также ценные услуги для авторов, которые уже публиковались у нас.
2021 цены уже доступны.Ты может получить личную / институциональную подписку перечисленных журналы прямо из Science Alert. В качестве альтернативы вы возможно, пожелает связаться с выбранным вами агентством по подписке. Направляйте заказы, платежи и запросы в службу поддержки клиентов. в службу поддержки клиентов журнала Science Alert.
Science Alert гордится своей тесные и прозрачные отношения с обществом.В виде некоммерческий издатель, мы стремимся к самому широкому возможное распространение публикуемых нами материалов и на предоставление услуг высочайшего качества нашим издательские партнеры.
Здесь вы найдете ответы на наиболее часто задаваемые вопросы (FAQ), которые мы получили по электронной почте или через контактную форму в Интернете.В зависимости от характера вопросов мы разделили часто задаваемые вопросы на разные категории.
Азиатский индекс научного цитирования (ASCI) стремится предоставить авторитетный, надежный и значимая информация по освещению наиболее важных и влиятельные журналы для удовлетворения потребностей мировых научное сообщество.

Добавить комментарий

Ваш адрес email не будет опубликован.