Арабис многолетний посадка и уход фото: посадка и уход, фото на клумбе, размножение резухи-многолетки

Содержание

посадка и уход, фото на клумбе, размножение резухи-многолетки

Арабис многолетний или резуха (латинское название Arabis) полностью покрывает землю. Прополка ему требуется только тогда, когда всходы еще небольшие. Как только они подрастут, то растение вытеснит все сорняки из цветника. Каменистые клумбы, на которых высажено травянистое растение, долгие годы сохраняют высокодекоративный вид.

Растение относится к семейству крестоцветных (капустных). В природе оно произрастает в умеренном климате и в горной местности Африки. Причем неприхотливое растение прекрасно себя чувствует на осыпях, скалах, глинистых склонах, песках.

Имя резуха почвопокровное растение получило за то, что его листовые пластинки покрыты жесткими волосками. Они могут поранить, если человек неаккуратно прикоснется к ним.

Арабис многолетний: описание с фото, использование в ландшафтном дизайне

Внешний вид многолетника можно описать таким образом:

  1. Высота зависит от сорта, не превышает 30 см.
  2. Цельные сердцевидные опушенные листовые пластинки зеленого цвета зубчатые по краям.
  3. Плотные некрупные кистевидные соцветия состоят из цветков диаметром 1-1,5 см. Они бывают простыми либо махровыми белого, светло-желтого, розового, лилового окраса.
  4. Плод ― стручок с плоскими, иногда крылатыми семенами.

Арабис многолетний на клумбе:

Буйное цветение начинается в середине весны, длится примерно месяц. От травянистых растений распространяется сладкий аромат. Повторное появление цветков происходит в сентябре.

Резуха прекрасно вписывается в убранство приусадебного участка, украшает любой цветник как почвопокровное растение. Она невысока, очень быстро растет. За короткое время многолетник затягивает пустую землю, покрывает ее пушистым зеленым ковром. Арабис многолетку садят под деревьями, около цветущих растений среднего или высокого роста либо на альпийских горках.

Высаживая на участке резуху, надо не забывать о том, что в тени они сильно разрастаются и вытягиваются.

А на солнце – цветут ярче.

Сорта и виды с описанием и фото

Существуют такие виды резухи.

Альпийский (Arabis alpina)

Название сорта Высота растения в сантиметрах Диаметр соцветий в сантиметрах Окрас цветов
Шнеесхаубе 25 15 Белый
Розовый 20 12 Розовый

Кавказский (Arabis caucasica)

Название сорта Высота растения в сантиметрах Диаметр соцветий в сантиметрах Окрас цветов
Флоре-плено 20-25 8 Белый
Вариегата 20-25 8 Молочно-белый
Розабелла 20-25 8 Розовый
Кокцинеа 20-25 8 Пурпурный
Литтл Треже Роуз 20-25 8 Белый, розовый, лиловый, сиреневый
Lotti White 15 15 Белоснежный

Реснитчатолистный (Arabis blepharophylla)

Название сорта Высота растения в сантиметрах Окрас цветов
Роут Сенсейшн 8 Насыщенно-розовый
Фрюлингшабер 8 Нежно-розовый
Роуз делайт 8 Ярко-розовый

Стреловидный (Arabis hirsuta)

Вырастает ввысь до 45 см.

Прикорневые листовые пластинки многолетника стреловидные, собраны в розетку. Узкие и длинные соцветия состоят из белых цветков в диаметре полсантиметра. Мелкие, коричневые семена находятся в стручках длиной 2-6 см. Цветение резухи начинается в конце июня — начале июля. Плоды появляются в начале августа.

Повислый (Arabis pendula)

Резуха достигает высоты 12 см.,характеризуется сильно ветвящимся стеблем. Листовые пластинки овальные либо ланцетные с заострением. Белые, мелкие цветки покрытыми волосками. В плоском, дугообразном стручке расположены мелкие семена. Цветет резуха с июля, по август.

Песчаный (Arabis arenosa)

Вырастает высотой 2 см – это растение с прямостоячими, ветвистыми побегами. Их отличительная особенность в том, что они голые сверху, но опушенные снизу. Белые, розовые, сиреневые цветки собраны в соцветия. Появляются в июне, увядают в сентябре.

Фердинанд Кобургский (Arabis ferdinandi-coburgii)

Блестящие, светло-зеленые листья имеют тонкую белую кайму по краю.

Белые мелкие цветки соединяются в рыхлые соцветия, которые цветут с мая по июнь.

Грандифлора

Резуха розовая с побегами, достигающими высоты 25 – 30 см, украсит любой участок нежно-розовыми цветками. Бутоны достигают 2 см в диаметре.

Видов и сортов арабиса многолетнего множество. Каждый садовод сможет выбрать резуху по своему вкусу.

Сроки посадки на рассаду

Почвопокровное растение можно выращивать рассадным способом. В I декаду марта посевной материал помещают в емкости с влажной смесью речного песка и садовой земли на глубину полсантиметра. Тару помещают в полиэтиленовый пакет, оставляют в теплом месте.

Всходы появятся через месяц, за это время грунт несколько раз поливают по мере высыхания. Пленку убирают, а емкость выставляют в светлое место. Маленькие растеньица своевременно увлажняют, удобряют 2 раза. Не забывают и про рыхление почвы.

Если садовод планирует травянистые растения высаживать на грядку так, чтобы впоследствии образовался травяной «ковер», то пикировку не проводят.

Рассада резухи

Посадка в открытый грунт

Вначале готовят грядки. Землю перекапывают с комплексным удобрением, удаляют все сорняки. Лучше для многолетника выбрать легкие почвы с примесью речного песка. Если земля глинистая, то обязательно делают дренаж. Выкапывают неглубокие канавки, на их дно укладывают некрупные камни, битый кирпич. Засыпают углубления речным песком.

Высадку семян в открытый грунт производят, как только оттает земля. Цветник поливают и укрывают пленкой. После появления всходов ее убирают. Или в конце октября, чтобы посадочный материал не пророс.

Рассаду помещают на клумбы, как только минует угроза ночных заморозков.

Особенности ухода

Уход за резухой заключается в подкормках, поливах, обрезке. В момент закладывания бутонов вносят минеральный комплекс для садовых цветов. Второй раз удобрение без азота вносят в конце лета. Орошение проводят регулярно по мере высыхания земли. После завершения цветения сухие части удаляют, а стебли подрезают на 1/3.

Почвопокровное растение выдерживает зимние морозы до -5°C. Если в местности температура опускается ниже, то цветник с резухой укрывают ветками хвойных деревьев, пленкой. А сверху конструкцию заваливают досками, чтобы сильный ветер не разрушил ее.

Размножение

Арабис многолетний можно размножать черенками, перевалкой и делением. Ранней весной или в середине осени хорошо разросшиеся кусты выкапывают, острым ножом делят на несколько частей так, чтобы у каждой были точки роста. Затем новые растеньица помещают в стимулятор роста на несколько часов. Только потом высаживают в цветник. Дистанция между саженцами должна быть не менее 30 – 40 см.

В конце весны – начале лета можно проводить черенкование. Вначале с самых здоровых экземпляров нарезают десятисантиметровые черенки. Снизу удаляют листовые пластинки, производят высаживание в удобренный грунт. Каждый день черенки и землю рядом с ними опрыскивают из пульверизатора. Через месяц молоденькие растеньица с корешками рассаживают на клумбе.

Тонкие корни резухи непрочны, их легко можно повредить. Поэтому метод перевалки считается самым лучшим. Вначале в земле выкапывают лунки глубиной 10-15 см. В них насыпают древесную золу и поливают. Грунт на грядке с многолетником разрыхляют, его извлекают вместе с комом земли. Растения переваливают в углубления, засыпают перегноем, слегка уплотняют и еще раз поливают.

Молодые растения в саду

Вредители, болезни

Арабис многолетний может заболеть вирусной мозаикой. Пораженные экземпляры удаляют с участка, а грядку проливают раствором хлорной извести. Только следующей зимой на этом участке земли можно высаживать травянистые растения.

Крестоцветная блошка тоже способна напасть на растения. Если это произошло, то кустики проливают раствором почвенного инсектицида под названием «Почин». Это самое эффективное средство, так как оно быстро уничтожает насекомых и долгое время защищает многолетник.

Чтобы неприятности в виде болезней и вредителей не возникали, садоводу требуется выполнять ряд профилактических мероприятий:

  • осуществление глубокой перекопки грунта перед посадкой многолетника на постоянное место;
  • тщательная прополка сорняков, пока почвопокровное растение не затянет всю землю;
  • периодическое удаление отмерших и поврежденных частей резухи и растений, находящихся рядом.

А еще травянистому растению не помешает опрыскивание современными иммуностимуляторами.

Почвопокровное растение обладает лечебным свойством – своим прекрасным видом услаждать взгляд человека.

Интересный факт-легенда

Историки утверждают, что арабис знаком человеческому обществу не меньше двух веков. А любителям исландского фольклора известна легенда о неприметном цветке, которому эльфы подарили магическое очарование.

Волшебная семья жила в кроне высокого дерева. Оно дарило маленьким существам прохладу. А питались они нектаром близлежащих цветов. Но однажды ночью началась страшная гроза. Раскаты грома сотрясали воздух. Огромная молния ударила в дерево, и оно загорелось. Испуганные эльфы в спешке покинули свое жилище и спрятались в мокрой траве. Утром они обнаружили, что дождь потушил огонь, но дерево успело полностью выгореть.

Пришлось маленьким существам отправляться на поиски нового места обитания. Весь день они пытались осуществить задуманное, но это не получалось.

Кустарники были уже заселены насекомыми. А деревья – мелкими зверьками и птицами.

Вечером обессиленные беженцы обратились к цветам с просьбой приютить их. Но представители флоры не желали мять свои пышные лепесточки. Только арабис разрешил эльфам укрыться в своих зарослях. Утром все растения увидели, что неказистая резуха приобрела магическое очарование. Теперь от прекрасных кустиков с маленькими цветками невозможно было отвести взгляд. Это был подарок благодарных эльфов.

Резуху не считают экзотическим растением, поражающим воображение. Она невелика, соцветия скромны, а листовые пластинки не имеют оригинальной формы. Но многие садовники любят высаживать арабис на участках. Он достаточно неприхотлив в уходе. Его нежная красота пленяет любого человека.

посадка и уход, фото, сорта и выращивание

Дачникам, которые хотят, чтобы их участок без особых хлопот каждую весну кутало пышное цветочное покрывало, непременно полюбится арабис многолетний — посадка и уход за ним, в открытом грунте, не требуют особых навыков и знаний. Эти многолетние растения имеют не только декоративный экстерьер, но и приятный аромат, а размножение проходит достаточно быстро.

Описание и разновидности

Растение арабис (лат. Ara­bis), или резуха принадлежит к роду травянистых многолетников семейства Капустные, либо Крестоцветные, который насчитывает более ста видов. В природе цветок арабис попадается в горах тропической Африки и в районах с умеренными климатическими условиями Северного полушария. Происхождение латинского наименования арабиса доподлинно не известно, а резухой арабис называют из-за жестких шерстинок опушения, которыми можно травмировать руки.

Это растение разводится уже более двух сотен лет. В ландшафтном дизайне арабис используют в клумбах и миксбордерах, для украшения бордюров, альпийских горок и рабаток. В статье, подготовленной редакцией сайта KustRoz.ru, мы расскажем вам, как производится посадка и уход за резухой в открытом грунте.

Виды и сорта

Среди всего разнообразия сортов арабиса, неотъемлемым лидерством обладают такие:

  • Кавказский — отличается высокой стойкостью к бедности почвы, засухе и излишку влаги, перепадам температур и суровым холодам. Куст едва достигает 15 сантиметров в высоту, однако способен разрастаться в густое цветущее полотно, покрывающее почти любую поверхность. Корневая система наполняет любые расщелины, маскируя некоторые недочеты, случившиеся при строительстве или возделывании грунта.
  • Альпийский — один из самых ароматных сортов арабиса, на основе которого были сделаны многие гибридные сорта. Цветение стартует уже с середины апреля — обильное, с выпусканием массы кисточек белого и розового оттенков. Высота достигает 20 сантиметров.
  • Мохообразный — обладает самым длительным цветением, до 30–40 дней. Цветы как обычные, так и махровые, оттенки варьируются от белоснежного до ярко-лимонного.

  • Арабис розовый — многолетнее растение высотой 20–25 сантиметров. От рассмотренных видов отличается лишь окраской цветков, причем интенсивность розовой расцветки у разных растений неодинакова. Зацветает на 2 недели позже белых немахровых сортов.
  • Арабис проломниковый — родиной считаются горы Турции. Подушковидное многолетнее растение до 10 сантиметров высотой. Листва овальная с острым концом. Цветки белые возникают летом. Нуждается в раскрытом месте в расщелинах камней. Почву любит бедную, сухую. На зиму нуждается в просушенном укрытии. Семена сеют весной. Растение разделяют осенью, а черенками размножают летом.
  • Арабис Фердинанда — совсем невысокий вид, высота его представителей до 5 сантиметров. При такой высоте куста он ценится за симпатичную зеленую с белым краями листву и продолжительное цветение. Цветки мелкие, белые либо розоватые. Во время цветения роскошная подушка из листовой розетки обильно прикрыта белыми цветами. Цветение очень долгое.

В ландшафтном дизайне

Многолетний арабис отлично вписывается в любые цветочные композиции и оранжереи, прекрасно дополняет террасы и современные строительные решения из камня. Неприхотливые кустики очень колоритно смотрятся по соседству с алыми тюльпанами, благородными ирисами, оригинальными алиссумом и прочими луковичными культурами раннего цветения. Малорослые разновидности обычно используются для создания красочного фона в розарии.

Пышными горными растениями как правило декорируют альпинарии и рокарии, ими украшают любые скальные стенки и конструкции. Прекрасно подходят для дизайна миксбордеров и оформления бордюров, укрепления склонов и формирования ярких акцентов на приусадебном наделе.

Посадка и размножение

Арабис высаживают на солнечные либо слегка затенённые места. При недостаточном освещении отростки вытягиваются, завязывается меньше цветочков. При застое воды, в особенности на тяжелых глинистых почвах, корни арабиса преют, поэтому желательно выбрать место на возвышенье.

Для образования густых цветущих шапок в пик цветения резухе необходимы влагопроницаемые некислые почвы, богатые питательными элементами, рыхлые и дышащие. Однако и на довольно скромном грунте уроженцы скал и песков будут расти и формироваться, радуя цветением, но не столь обильным и длительным.

При подготовке грунта тщательно подбирают корни многолетних сорняков. В посадочные лунки прибавляют крупный песок, щебень, доломитовую муку либо мел. Если на участке застаивается влага после дождей или таяния снега, необходимо подготовить дренаж:

  • Снять верхний плодородный пласт толщиной 10–15 сантиметров.
  • Уложить битый кирпич.
  • Насыпать песок слоем 10–15 сантиметров.
  • Сверху облицевать питательный грунт слоем 20–25 сантиметров.

Можно использовать для высадки щели и карманы между камнями. Кустики арабиса сажают на расстоянии 30 сантиметров друг от друга.

Посев

Арабис очень легко и просто культивировать из семян, купить которые можно в специализированных магазинах, садовых центрах или на цветочных выставках. Высев семян можно выработать непосредственно в открытую землю под зиму в октябре. Также резуху можно растить через рассаду, в этом случае посеять семена следует в апреле.

Для этого наполните контейнеры или ящики почвосмесью, состоящей из садовой почвы и меленьких камней либо песка (3:1). Семена необходимо заглубить в субстрат всего на полсантиметра, после этого емкость ставят в место, где температура окружающего воздуха примерно 20 градусов. Чтобы увеличить показатели всхожести семян, емкость нужно накрыть нетканым видом материала, к примеру, агроспаном.

Через 3–3,5 недели после появления сеянцев укрытие убирают, при этом полив необходимо сократить. Рассаду необходимо перенести в теплое и хорошо освещенное помещение. Уход за данной рассадой не составит какого-либо труда.

Ее лишь нужно поливать, когда это требуется, а также систематически аккуратно разрыхлять поверхность субстрата.

Деление каста

Таким способом размножаются исключительно махровые и другие декоративные сорта арабиса. Это даёт возможность сохранить все материнские свойства растения.

Заниматься делением куста арабиса следует только после достижения ими три или четырех лет. Молодые кустики делить не советуют. Проводить такой процесс необходимо в конце лета или, а начале осени по окончании периода цветения:

  • Для этого важно осторожно извлечь из грунта кустик и слегка стряхнуть землю с корней. С одного зрелого кустика можно получить до 20 юных растений.
  • С помощью острого ножа либо секатора куст арабиса нужно разрезать на необходимое количество деленок.

При этом важно сразу же обработать все места срезов толченым углем, для того, чтобы они быстрее зажили.

  • На приготовленном участке делают посадочные лунки на дистанции примерно 35–40 сантиметров друг от друга и высаживают деленки, затем обильно их поливают.

Черенкование

Этот метод размножения арабиса также применяется для выращивания декоративных сортов культуры.

Заготовлять посадочный материал рекомендуется по окончании цветения арабиса:

  • В качестве черенков можно применять листья вместе с пяточкой, из которой и образуются корни. Для получения такого посадочного материала лист следует не отрезать, а отрывать, чуть-чуть потянув на себя. Так вы будете иметь лист с куском коры, которую зовут “пяточкой”.
  • В качестве черенков можно применять и верхушечные побеги. Для их извлечения в конце цветения следует срезать верхушку побега длиной примерно 10 сантиметров. После этого убираются все нижние листочки.
  • Все черенки высаживаются в теплице или парнике под углом, после чего грядки рыхлятся и поливаются.
  • Черенки желательно накрывать пленкой либо отдельно пластиковыми бутылками каждый саженец.
  • Повседневный уход заключается в поддержании уровня влажности субстрата, проветривании черенков, ликвидации конденсата.
  • Когда листики снова станут эластическими, черенки можно сажать на постоянное место.

Особенности ухода за арабисом

Правильный уход за арабисом предполагает полив, удобрение, рыхление почвы и прополку, обрезку, защиту от вредителей.

Полив и подкормка

У арабиса прекрасно развита корневая система, которая может доставать влагу глубоко в почве. Поэтому он стабилен к засухе. Избыточное увлажнение может привес к загниванию корня. Правильно поливать взрослые экземпляры раз в неделю, а свежие растения чаще.

Удобрения как правило вносят весной до цветения. Взрослым экземплярам арабиса хватает одной подкормки за сезон. Годится комплексный минеральный состав, а из органики можно применять гумус.

Цветение и обрезка

Арабис цветет на протяжении месяца весной или летом, в зависимости от сорта. Альпийская модификация зацветает в апреле, а кавказская в июне, однако отдельные цветы на ней могут зарождаться весь сезон.

Арабис очень быстро растет и обрезка ему необходима. При ней убирают сильно разросшиеся ветви. Так он будет смотреться компактно и не заглушать растения, посаженные вблизи. Кроме того, это сделает лучше цветение в следующем сезоне.

Свет и температура

Арабис может расти, также на солнечных участках, и в полутени. На солнце будет наиболее пышным цветение, а в полутени растение скорее разрастается. В случае если снег истаивает рано, растение необходимо притенять, ведь у него могут высохнуть побеги от жаркого солнца.

Арабис — устойчивое растение, способное выжить даже при темпрературе воздуха ‑7 градусов. Может даже перезимовать под снегом при верной посадке. Весной же пострадавшие участки с лёгкостью восстанавливаются.

Пикировка

Когда у сеянцев покажется первая настоящая листовая пластина, следует произвести их пикировку, однако только в том случае, если вы намереваетесь выращивать резуху, как единичное растение. Для этого растеньица пикируют в отдельные стаканчики либо рассаживают на расстояние не меньше 0,3 метров. В том случае, если вы надеетесь использовать данный цветок, как почвопокровное растение, тогда пикировать его не нужно. За 10–12 суток до пикировки арабиса в открытую землю, необходимо заняться его закалкой.

Для данного растения переносят на улицу каждый день, при этом длительность закаливающих процедур нужно увеличивать мало-помалу. Во время пребывания рассады на свежем воздухе, обеспечьте ей основательную защиту от сквозняков. После того как растеньица целиком и полностью адаптируются к новым условиям, их можно будет сажать в открытую землю.

Сбор семян

Сбор семян начинают вслед за тем, как пройдут первые заморозки. Оптимальными критериями считается сухая и солнечная погода, так как в этом случае семена будут обладать самыми лучшими свойствами всхожести.

Выбирают самые большие соцветия, срезают вместе с частью стебля и просушивают в проветриваемом жилище, подвесив в воздухе. После того, как семена обсохнут, они хранятся в бумажных пакетах либо коробках.

Зимовка

Если вы захотели заготовить к будущему сезону посадочный материал арабиса, тогда в период цветения выберите несколько наиболее красивых соцветий и пометьте их любым подходящим способом. После первых холодов нужные кисти срезают с частью стебля и просушивают в тёплом, проветриваемом строении. Стручки лущат, упаковывают готовый материал по бумажным пакетикам и прячут на хранение в прохладное, тёмное помещение.

Обратите внимание! Собирать стручки необходимо только в ясную погоду, поскольку сырость сокращает процент всхожести семян.

Морозоустойчивость арабиса довольно относительна. Понижение температуры окружающего воздуха до ‑5…-7 °C растениям не страшно, однако суровую, малоснежную зиму без вспомогательного укрытия им не пережить. Поэтому в конце ноября срежьте побеги культуры на высоте 2–4 сантиметров и утеплите посадки лапником, нетканым материалом или сухими листьями.

Вредители и болезни

Резуха почти не поражается паразитами и всевозможными болезнями, но растение восприимчиво к влиянию вирусной мозаики и насекомого крестоцветная блошка. 1‑ая болезнь достаточно характера — на листьях зарождаются бурые пятнышки, которые растут, поражая всю зелень. От мозаики лечения нет, в связи с этим пораженную особь удаляют и жгут, а землю дезинфицируют.

С крестоцветной блошкой борются посредством Актеллика, Биотлина, Актары, Карбофоса, Искры. Использование народного средства — древесной золы — какого-либо эффекта не имеет.

Заключение

Посадка и уход за арабисом многолетним – это настоящая находка для декорации садового участка или клумбы возле дома. Арабис нетребовательный, поэтому его под силу вырастить в том числе и новичку. Рекомендуется рассадный способ. Уход обыкновенный, как за всеми прочими садовыми растениями.

описание, посадка и уход, виды и фото

Растение Арабис (лат. Arabis) относится к роду травянистых многолетников семейства Капустные, или Крестоцветные, насчитывающего более 100 видов. В природе цветок Арабис встречается в горах тропической Африки и в районах с умеренным климатом Северного полушария. Происхождение латинского названия ‘Arabis’ доподлинно не известно. Ботаническое название Arabis, вероятно, относится к тому факту, что многие виды являются родными для гор Аравии.В садоводстве культура используется более двухсот лет. В ландшафтном дизайне растение Арабис высаживают в миксбордерах и клумбах, для украшения бордюров, рабаток и альпийских горок. В нашей статье мы расскажем, как сажать и ухаживать за Арабисом в открытом грунте.

Содержание статьи

Описание растения Arabis

Арабис или Резуха — многолетнее раннецветущее почвопокровное растение.  Высота растения до 30 см. Стебли, стелющиеся, укореняющиеся. Листья зубчатые, опушенные. Арабис многолетний — медонос. Прикорневые листья часто собраны в розетку. Все виды Арабиса имеют привлекательную круглогодичную листву и скопления маленьких, белых, розовых или фиолетовых цветов.

Цветет Резуха обильно, с апреля и довольно долго, до 8 недель. В период цветения арабис хорошо разрастается. Резуха хорошо растет в песчаных, хорошо дренированных почвах на солнце. Сокращает количество листвы после цветения, чтобы способствовать хорошему росту. Незря данную культуру причисляют к растениям-коврикам для сада. От цветов растения исходит приятный запах, привлекающий пчел. Но некоторые виды Арабиса причисляют к сорнякам.

Вы также можете ознакомиться с цветком Иберис

Посадка и уход за многолетними цветами Арабис

Цветок Арабис достаточно легко выращивается из семян, которые продаются во флористических магазинах. Высевать семенной материал можно непосредственно в открытую почву. Лучше выбирать для таких целей октябрь. Если вы планируете сеять культуру весной, тогда оптимальным решением станет апрель. В данном случае лучше подойдет рассадный метод. Для него выбирают контейнеры или ящики, наполненные садовым грунтом с добавлением песчано-каменной смеси (пропорция – 3 к 1).

Заделывать семенной материал не нужно слишком глубоко – достаточно всего 5 мм. Для проращивания регулируют температуру в +20 градусов. Повысить всхожесть позволит укрытие из нетканого материала.

Как ухаживать за рассадой

Спустя 20-25 суток после появления всходов Арабиса, убирается укрытие, сокращаются поливы. Саму емкость ставят в теплое и светлое место. По мере необходимости рассаду следует поливать, а также немного рыхлить субстрат.

Проведение пикировки

Как только появится первый настоящий листик, предстоит провести пикировку растений. Сеянцы рассаживают на дистанции минимум в 30 сантиметров друг от друга, а опытные садоводы рекомендуют и вовсе рассадить культуры в отдельную тару.

Желая выращивать культуру как почвопокровник, пикировку можно не делать. Перед тем, как сажать растения в открытую почву, проведите закалывание растения. Этот процесс делают на протяжении 10-12 суток. Каждый день рекомендуется выносить растения на открытый балкон или на улицу. Но только избегайте мест, где сквозные ветры. После адаптации рассады к холодным условиям, пересадите ее в сад на выбранное место.

Посадка Арабиса в открытый грунт

Посадка Резухи выполняется под конец весны – в начале лета. Это делают до момента формирования у культуры трех настоящих листиков. Отдавайте предпочтение участкам с хорошим солнечным освещением, но и в полутени растения могут неплохо развиваться. Но цветение не будет таким пышным. Также при выборе места для Резухи учитывайте, что растения не любят сквозных ветров.

Как высаживать растение Резуха

Создайте для культуры оптимальные условия – выбирайте рыхлую, песчаную почву, желательно не очень влажную. Обязательно ее очищают от сорных растений, обогащают минеральными веществами. Чтобы улучшить водопроницаемость, внесите в садовый грунт немного мелких камешков.

Рассаживая кустики, придерживайтесь расстояния в 40 сантиметров. Достаточно посадить в каждую ямку до 4 сеянцев. После высадки предстоит полить участок. Если обогащения грунта не было до этого момента, тогда через 1-2 дня удобрите культуру минеральными веществами. Помните еще один важный момент – цветение Арабиса, выращенного из семян, начнется только на 2-й год после высадки.

Как выращивать цветок Арабис

Какие условия надо знать и соблюдать для безпроблемного ухода за Резухой — давайте ознакомимся ближе.

Правила полива и внесения удобрений

Почвопокровные многолетние цветы Арабис считаются засухоустойчивыми. Поэтому дополнительный умеренный полив им потребуется только в засушливые периоды года.

Подкармливать растения рекомендуется 1 раз в год, лучше всего в весеннюю пору. Использовать для таких целей следует перегной или компост. Также перед началом цветения понадобится внести под корень комплексные минеральные составы.

Как проводить обрезку растения

Проведение систематической стрижки и формировки кустиков может потребоваться, если цветок Арабис используется в коврово-мозаичных композициях или в качестве коврового цветника.

Также во избежание разрастания цветка, нарушения установленных границ, потребуется провести прищипывание длинных побегов. Черенки, что срезаются, можно легко применять для дальнейшего размножения.

Когда будет проведена весенняя обрезка, наращивание молодых побегов, может начаться повторное цветение. В июне обязательно избавляются от старых листиков, а длинные стебельки укорачиваются.

Пересадка Арабиса

Выращивание Арабиса включает также необходимость проведения пересадки. Данную агропроцедуру лучше выполнять через способ перевалки. Поэтапно этот процесс выглядит так:

  • готовят лунки для посадки в глубину до 25 сантиметров;
  • почва поливается под кустом, чтобы сделать ее умеренно влажной;
  • аккуратно разрыхляется земля, а растение извлекается совместно с земляным комом;
  • культура переваливается в лунку, засыпается почвой, немного уплотняется и поливается.

Пересадка не вредит Резухе, культура быстро адаптируется и начинает активно развиваться.

Сбор семян

При желании можно собрать семенной материал. Сбор семян осуществляется в сухое время года. Соцветия предстоит срезать совместно с цветоносами, разложить их на бумагу, установить температуру в +20…23 градуса. После досушивания семенной материал помещают в мешочки и кладут в холодильник.

Подготовка к зимовке

Цветок Арабис (Резуха) в наших условиях зимует плохо. Его необходимо подготавливать к такому процессу. После цветения культура обрезается до 3-4 сантиметров, а затем сверху засыпается листиками. Также поверх укладывается спанбод или геотекстиль. Только укрывной материал не должен касаться стеблей растений. Необходимо соорудить каркас из реек, а сверху уложить укрывной материал. Ткань обязательно фиксируется с помощью камней.

Самый простой способ размножения многолетнего растения Арабис — черенкование. Для этого выбираются здоровые, не цветущие розетки с небольшой длиной стебля, прикрепленного к родительскому растению. Обязательно сделайте чистый срез. Обращайтесь с черенками с помощью пинцета, если они очень маленькие. Обрежьте каждый черенок ниже узла и удалите листья с нижнего конца стебля. Готовый черенок должен иметь короткий стебель и розетку листьев сверху.

Акуратно поместите черенки в небольшой горшок с раннее подготовленой почвосмесью. Не переусердствуйте с поливом — это может погубить растение. Черенкам нельзя дать высохнуть, поэтому проверяйте и поливайте их осторожно. Храните черенки при температуре около 10-15 ° C, вдали от прямых солнечных лучей. Накройте, чтобы держать во влаге, но проветривайте растения часто. Удаляйте все черенки, которые быстро отмирают, чтобы не распространять инфекцию. Как только у черенков появятся новые корни и листья, высаживайте их по одному в выбранное вами место.

Какими методами можно размножить цветок Арабис

Рассмотрим два вегетативных методов размножения культуры.

Черенкование растения

Самый простой способ размножения многолетнего растения Арабис — черенкование. Для этого выбираются здоровые, не цветущие розетки с небольшой длиной стебля, прикрепленного к родительскому растению. Обязательно сделайте чистый срез. Обращайтесь с черенками с помощью пинцета, если они очень маленькие. Обрежьте каждый черенок ниже узла и удалите листья с нижнего конца стебля. Готовый черенок должен иметь короткий стебель и розетку листьев сверху.

Подготовленные к высадке черенки Арабиса

Акуратно поместите черенки в небольшой горшок с раннее подготовленой почвосмесью. Не переусердствуйте с поливом — это может погубить растение. Черенкам нельзя дать высохнуть, поэтому проверяйте и поливайте их осторожно. Храните черенки при температуре около 10-15 ° C, вдали от прямых солнечных лучей. Накройте, чтобы держать во влаге, но проветривайте растения часто. Удаляйте все черенки, которые быстро отмирают, чтобы не распространять инфекцию. Как только у черенков появятся новые корни и листья, высаживайте их по одному в выбранное вами место.

Метод деления кустарника

Кусты, которым больше 4 лет, делят на несколько частей. Сначала растения, что отцвели, поливают водой, а после с помощью деревянного колышка проводят рыхление грунта вокруг культуры.

Резуху следует извлечь из грунта, немного отряхнуть землю, разделить на несколько частей руками или острым ножом. Обработку срезов проводят с помощью измельчённого угля. Каждая деленка опускается в подготовленную ямку, сверху присыпается грунтом, а затем поливается.

Вредители и болезни многолетнего растения Арабис

Среди заболеваний растение может быть восприимчивым к белой ржавчине и мучнистой росе — для предотвращения этих заболеваний, оставляйте больше пространства вокруг стеблей и листьев. Если почва слишком влажная или плохо дренирована, у резухи может развиться корневая гниль.

Лучше всего исправить любые тяжелые, глинистые почвы с песком или даже гравием, чтобы сделать его более подходящим для этого растения.

Наиболее опасными вредителями для выращивания такого почвопокровного растения считают:

  • Моллюсков, которые начинают прогрызать дыры на листиках культуры, наиболее уязвимыми являются растения, что развиваются в местах застоя влаги.
  • Гусеницы капустной совки, они могут обгрызать листики, побеги и цветочки растения. Чтобы уничтожить вредителей, предстоит проводить систематические прополки участка, его мульчирование.

Чтобы бороться с такими вредителями, лучше всего использовать инсектициды – Карбофос, Актеллик, Актару. Лучше всего исправить любые тяжелые, глинистые почвы с песком или даже гравием, чтобы сделать его более подходящим для этого растения.

Вы также можете ознакомиться с таким удивительным цветком как Обриета

Советы по применению Арабиса в дизайне сада

Цветок Арабис многолетний хорошо подходит к рокариям, сухим ручьям или каменным стенам. Листва особенно эффективна, поднимаясь над скалами или каскадом над стенами.

Цветы образуют плотный, ползучий мат, отлично подходящий для горных садов, подпорных стен, крутых берегов и как почвенный покров для бедных, сухих, солнечных областей. «Ковер» из цветов прекрасно контрастирует с более крупными, насыщенными или вертикальными многолетниками. Резуха также хорошо смотрится в миксбордерах, разного рода клумбах. Отличным вариантом будет посадка растения по краям клумбы или цветника.

Популярные виды рода Arabis

На даный момент известно больше 100 видов Арабиса. Перечислим только самые востребованные в ландшафтном дизайне виды.

Арабис альпийский (Arabis alpina, или A. flaviflora)

Отличное растение для открытого грунта. В природе растет в Скандинавии, высокогорьях  Европы и Америки и за Уралом.

Арабис альпийский (A. alpina, или A. flaviflora)

Высота растения может достигать 35 см в высоту. Стебли у резухи альпийской прижатые к земле. Листики имеют овальную форму, а цветочки могут быть розового или белого цвета, обычно отличаются небольшим объемом – до 1 сантиметра. Соцветия – кистевидные, длительность цветения – до 1 месяца. Наиболее популярными садовыми формами считают:

  • Шнеесхаубе. В высоту до 25 сантиметров, имеют беленькие цветочки, их диаметр до 2 сантиметров.
  • Махровую. От Альпийской разновидности отличается только тем, что ее соцветия чуть крупнее.
  • Розовую. В высоту до 20 сантиметров, цветочки – розовенькие, соцветия достигают длины до 12 сантиметров.

Арабис кавказский или беловатый (Arabis caucasica)

Это вечнозеленое многолетнее растение растет на Кавказе, в Крыму, в горах Азии. Вырастает до 30 см.

Арабис кавказский

Листья небольшие, продолговатые. Резуха кавказская  очень быстро разрастается со средней скоростью до 0,2 м на 1 м. Листья растут круглый год, цветут с января по май, а семена созревают с апреля по июнь.
Подходит для: легких (песчаных), средних (суглинистых) и тяжелых (глинистых) почв, предпочитает хорошо дренированные почвы и может расти на питательно бедных почвах.

Наиболее распространенными садовыми формами являются:

  • Флоре-плено. Отличается красивыми махровыми цветочками белого оттенка.
  • Вариегату. Эти растения имеют листики с небольшими желтыми потертостями по краям.
  • Розабеллу. Цветет розовыми бутончиками.

Арабис низкорослый (Arabis pumila)

Родиной растения являются Альпы и Аппенины. Высота до 15 см. Цветки белые. Период цветения — май-июнь.

Фото Арабиса низкорослого

Этот почвопокровный цветок создает низкие вечнозеленые заросли. Белые соцветия  собраны в недольшие кисти. Хорошо растет на открытых, солнечных участках, не против и от полутени.

Арабис реснитчатолистный (Arabis blepharophylla)

Растет в горах Калифорнии. Низкорослое растение, высота до 8 см. Листва серо-зеленая. Окраска цветков темно-розовая.

Арабис реснитчатолистный

Густой многолетник с эффектными цветами. Лучше всего высаживать вдоль бордюров с хорошим дренажом почвы. отлично себя чувствует на полном или частичном освещении. Сортовые разновидности «Фрюлингшабер» и «Роут Сенсейшн» пользуются наибольшей популярностью. У них розовые соцветия.

фото, описание видов, выращивание, посадка, уход

Семейство Крестоцветные.

В естественных условиях произрастает от Арктики до тропиков Европы, Азии и Южной Америки.

Арабис(Arabis) или резуха обладает высокими декоративными качествами, которые позволяют широко использовать эту культуру на садовом участке. Она помогает создавать интересные композиции, эффектно смотрится пышным ковром, выигрышно заполняя пустоты, а также в сочетании с другими пестрыми цветами. Растение резуха весьма неприхотливо, уход за ним необременителен, и, посадив его в саду, можно быть уверенным, что оно даже на скудной почве без поливов и подкормок будет расти и развиваться. Но для того чтобы растение радовало глаз своей красотой и пышным цветением, нужно уделять ему хотя бы немного времени, учитывать при каких условиях этот цветок будет чувствовать себя наиболее комфортно.

Ботаническое описание растения резухи (с фото)

Согласно ботаническому описанию арабис – многолетнее, реже однолетнее растение со стелющимися и укореняющимися стеблями. В садоводстве в основном используются многолетние виды.

Это почвопокровник со стелющимися побегами, дающими корни, высотой не более 30 см. Листовые пластины ярко-зеленые, плотные, сердцевидные или цельные, изредка зубчатые, с густым ворсом на поверхности. Соцветия – кисти, состоящие из махровых или простых цветков диаметром 1. 5 см.

Цветки могут быть белого, розового, желтого, лилового оттенка, обладают сильным, приятным ароматом. Цветение наступает в начале мая. После цветения формируется плод – стручок с множеством плоских семян.

Цветет в мае — июне.

Каковы характерные особенности цветка арабиса или резухи, видно на фото, продемонстрированном ниже:

      

Виды и сорта резухи

Резуха альпийская (A. alpina).

   

Многолетнее травянистое стелящееся растение высотой до 30 см. Вегетативные побеги прямые, генеративные – сильноветвящиеся, имеют петлевидную форму, сильно прижаты к земле, зимой не отмирают, сохраняя весь сезон плотные куртины. Листья арабиса альпийского сердцевидно-стреловидные, прикорневые – овальные, густо опушенные, сохраняются и зимой. Цветки мелкие, диаметром до 1 см, белые или розовые, собраны в кисть. Цветение данного вида наступает в апреле, длится на протяжении месяца.

Сорта резухи альпийской:

«Шнеесхаубе» — белый сорт резухи альпийской, который представляет собой куст высотой около 25 см, с кистевидными соцветиями длиной до 15 см, состоящими из крупных цветков до 2 см в диаметре. Арабис белый является одним из наиболее популярных многолетников, который ценится за свою красоту и способность органично вписываться в любые садовые композиции;

«Махровая» — сорт с махровыми соцветиями среднего размера;

«Розовая» — куст высотой до 20 см с соцветиями до 12 см в длину, состоящими из розовых цветков диаметром 2 см.

Резуха кавказская (A. caucasica)

   

Многолетнее травянистое растение высотой 20-25 см. Листья арабиса кавказского мелкие, продолговатые, по краю зубчатые, густо опушенные, насыщенно-зеленые. Цветки мелкие, махровые, белые, собраны в кистевидные соцветия длиной около 8 см. Диаметр цветков составляет 1.5 см. Цветение наступает в июне, длится в течение 28 – 30 дней. Иногда на кусте отдельные цветки распускаются до начала сентября. Плод овально-удлиненный.

Сорта резухи кавказской:

«Флоре-плено» — сорт резухи кавказской, который отличается пышным цветением, в этот период куст густо покрыт белыми махровыми цветками на длинных цветоносах;

«Вариегата» — отличается листовыми пластинами с желтой кромкой;

«Розабелла» — эффектный сорт с крупными розовыми соцветиями;

«Кокцинеа» — сорт с пурпурными цветками;

«Литтл Треже Роуз» — сорт кавказского арабиса, который ценится за то, что в короткие сроки образовывает на участке эффектный ковер из ярко-зеленых листьев, скрывающихся за многочисленными мелкими цветками. Цветки могут иметь белый, розовый, лиловый и сиреневый окрас. Этот многолетник отличается неприхотливость к условиям произрастания и способностью успешно развиваться даже при отсутствии ухода;

«Lotti White» — сорт кавказского арабиса, который часто можно встретить на участках опытных садоводов и новичков. Это компактный многолетник высотой, не превышающей 15 см. Листья мелкие, насыщенно-зеленые. Белоснежные цветки собраны в кистевидные соцветия. Их диаметр составляет 15 мм. Это морозостойкий сорт, выдерживающий заморозки до -25 градусов.

На фото продемонстрированы сорта арабиса или резухи кавказской, посмотрев которые, можно понять, как они смотрятся на приусадебном участке:

      

Резуха стреловидная (A. sagittata).

   

Однолетнее или двулетнее травянистое растение 30-45 см высотой. Стебель и листья шершавые от ветвистых волосков, в нижней части — с примесью простых. Прикорневые листья резухи стреловидной в розетке, продолговатые, суженные в черешок; стеблевые — сидячие, более или менее отклоненные от стебля, с сердцевидным основанием и тупыми ушками, не заходящими друг за друга. Соцветие — узкая и длинная кисть. Цветки белые, 5-6 мм в диаметре, лепестки горизонтально отклоненные. Цветоножки при плодах 3-8 мм длиной. Стручки 2-6 см длиной, прямые, прижатые к цветоносу, линейные, сплюснутые; створки с выдающейся средней жилкой. Семена мелкие, коричневые, гладкие или мелкоточечные, узкокрылатые. Цветет в июне — июле, плодоносит в июле — августе. Размножается исключительно семенами.

Растет по берегам рек и озер, на пойменных лугах, на сухих прогреваемых береговых склонах, на выходах известняков, реже — в сосняках, на сорных местах.

Арабис реснитчатый или реснитчатолистный (A. blepharophylla)

Низкорослое травянистое растение высотой не более 8 см. Разрастается до 24 см в ширину, образует пышные куртины.

Листья и стебли темно-зеленые, густо опушены, поэтому имеют серый оттенок. Цветки насыщенно-розовые или сиреневые, собраны в кистевидные соцветия.

Цветение наступает в мае, длится по июнь. Данный вид резухи является одним из самых капризных. Требует особого ухода. Любит жару, не переносит заморозки. Недостаток или избыток влаги негативно влияют на это растение. Арабис реснитчатый не может расти на бедной почве, но избыток удобрений также негативно влияет на его самочувствие.

Сорта арабиса реснитчатолистного:

«Роут Сенсейшн» — сорт, отличающийся узкими, удлиненными листовыми пластинами ярко-зеленого оттенка и насыщенно-розовыми цветками;

«Фрюлингшабер» — растение с мелкими листьями темно-зеленого окраса, цветки нежно-розовые;

«Роуз делайт» — сорт арабиса реснитчатого, представляющий собой компактный многолетний куст высотой от 10 до 20 см. Его стебли тонкие, стелящиеся. Сорт обладает ярко-розовыми соцветиями, которые очень красиво смотрятся на фоне зеленых листьев. Цвести начинает в марте-апреле-мае, в зависимости от региона. Этот цветок прекрасно подходит для оформления участков с бедным грунтом, где другие декоративные растения не могут расти.

Резуха повислая (A. pendula).

   

Резуха повислая представляет собой травянистый однолетник или многолетник высотой до 120 см, имеет сильно ветвящийся стебель. Листья темно-зеленые, простые, покрыты жесткими волосками. Нижние листья крепятся к черешкам, верхние – сидячие с сердцевидным основанием, овальные, продолговатые или ланцетные, заостренные. На верхушках побегов формируются соцветия –кисти. Цветки мелкие, белые, с чашелистиками, покрытыми волосками. Плод – плоский, дугообразный стручок длиной до 10 см. Внутри плода содержатся семена длиной 2 мм. Цветение этого вида наступает в июле, длится по август.

Резуха песчаная (A. arenosa ).

   

Однолетнее или многолетнее травянистое растение высотой около 100 см с тонким нитевидным корнем. Побеги прямостоячие, сильно ветвистые, сверху голые, в нижней части имеется густое опушение. Листья сформированы в прикорневую розетку. На стеблевых листья имеются мелкие, жесткие волоски, из-за чего их поверхность шероховатая. Верхние листья простые, линейные, с небольшим опушением. Соцветие резухи песчаной – кисть с многочисленными цветками белого, розового и сиреневого оттенка. Цветение начинается в июне, длится по сентябрь.

Резуха Фердинанда Кобургского (A. ferdinandi-coburgii).

   

Арабис Фердинанда Кобургского – это многолетний травянистый почвопокровник, разрастающийся широким, пышным ковром. Его высота составляет не более 8 см. Побеги жесткие, разветвленные, быстро укореняются при соприкосновении с почвой. Листья светло-зеленые, блестящие, с тонкой белой каймой по краю. Кистевидные, рыхлые соцветия длиной около 10 см формируются на верхушках стеблей. Состоят из множества белых цветков диаметром 0.5 см. Цветение длится с мая по июнь.

Резуха Грандифлора розовая.

   

Арабис Грандифлора розовая представляет собой среднерослый многолетник с побегами высотой около 25 – 30 см. Ценится за крупные, до 2 см в поперечнике, нежно-розовые цветки. Стебли данного вида имеют свойство быстро распространяться на большие территории и образовывают пышный, яркий ковер. Данный вид может успешно расти на любой, даже скудной почве.

Уход за арабисом

Месторасположение. Резуха светолюбива, ей необходимы светлые, незатененные участки. Можно высадить арабис на открытых местах сада, где растение будет получать достаточно солнечного света.

Почва. К грунту данная культура нетребовательна, для ее посадки пригодны любые рыхлые, достаточно сухие почвы. В бедную почву рекомендуется внести минеральное или органическое удобрение. Если земля на участке плотная, следует внести небольшое количество песка.

Подкормка. Удобрение вносят перед началом цветения, используя для этого минеральные комплексы для садовых цветов или перегной.

Полив и другой уход. Чтобы кусты арабиса обильно цвели и формировали пышный ковер, при его содержании на участке необходимы регулярные поливы. После орошения обязательна прополка почвы и удаление сорной травы. Для сохранения опрятного вида растения требуется укорачивание сильно растущих и расходящися в стороны побегов. После цветения побеги подрезают на 1/3. Увядшие соцветия сразу устраняют для активизации повторного цветения и сохранения декоративности куста.

Укрытие на зиму. Большинство видов резухи обладают высокой морозостойкостью и не нуждаются в зимнем укрытии. Но некоторые разновидности и сорта арабиса выдерживают температуру не ниже -7 градусов. Стебли этих растений обрезают, оставляя длину не более 4 см, затем накрывают сухой листвой, лапником или укрывным материалом.

Особенности выращивания арабиса из семян

Размножение арабиса осуществляется несколькими способами: семенами, черенками, делением, отводками. Каждый из них имеет свои особенности. Какой способ выбрать, каждый садовод решает сам, но стоит учитывать, что выращивание резухи или арабиса альпийского и кавказского из семян наиболее предпочтительно.

   

Сажают арабис либо семенами в мае, прямо в открытый грунт, либо, выращивая рассаду, а затем, пересаживая ее на постоянное место после того, как минуют возвратные заморозки.

В теплых регионах можно высаживать семена в почву в апреле. Семена заглубляют на 0.5 см, после чего орошают гряду. Можно сначала вырастить рассаду из семян, а подросшие саженцы поместить в открытый грунт с наступлением теплых дней. Посевной материал помещают в небольшие ящики, наполненные смесью из садовой земли и песка с мелкой галькой в соотношении 1:3. Ящики с посевами убирают в теплое место с температурой 20 – 24 градуса. Для более высокой всхожести сооружают мини-парник из агроспана. Периодически укрытия снимают для проветривания парника, почву опрыскивают из пульверизатора. В таких условиях всходы появятся через месяц. После этого укрытие убирают, полив производят уже не так часто. При появлении первой пары листьев сеянцы пикируют в отдельные горшочки или в один большой контейнер на расстоянии 30 см друг от друга. Перед посевом в открытый грунт рассаду закаливают. Для этого в течение 14 дней выносят на улицу, постепенно увеличивая время пребывания. Держат вдали от сквозняков, которые негативно влияют на молодые неокрепшие растения. По окончании периода закаливания саженцы помещают на садовый участок на заранее отведенное для них место. Как отмечалось, оно должно быть достаточно открытым для солнечных лучей. В тени цветение будет не столь пышным, а размер цветков будет меньше, чем при хорошем освещении.

Как проводится работа на участке по посадке и уходу за арабисом многолетним или резухой на фото ниже хорошо продемонстрировано:

   

Размножение резухи делением и черенками

Кусты делят и рассаживают весной и осенью после цветения. Выбирают хорошо разросшийся куст, выкапывают его и осторожно, стараясь не повредить корни, с помощью острого ножа делят его на 3 – 4 равные части, чтобы у каждой оставались здоровые корни и точки роста. Саженцы заглубляют в посадочные ямы. Расстояние между ними должно составлять 30 – 40 см.

   

Черенкование проводят с середины мая до начала июня. Для этого с взрослого растения нарезают черенки длиной 10 см. С их нижней части убирают листья и помещают в песчаный грунт под углом. Черенки ежедневно опрыскивают и осторожно поливают. Корневая система у черенков сформируется в течение 3 недель. После этого их можно рассаживать на постоянное место.

Использование резухи в саду

Арабис – ценное растение, которое помогает ярко, красиво и необычно украсить участок, оживить его, сделать привлекательным и незаурядным.

   

Часто применяют данную культуру для оформления бордюров, каменистых горок, рокариев. Посадив арабис весной в саду, цветение его можно увидеть только в следующем году, поэтому, чтобы горка не выглядела пустой и блеклой, следует подсадить в это место какое-нибудь однолетнее растение. Оно не помешает расти многолетнику — резухе, но зато украсит горку уже в этом году.

Незаменима резуха для декорирования подпорных стенок, облагораживания проблемных мест на участке. Пышный ковер украсит приствольные круги кустарников и крупных садовых деревьев.

При выращивании арабиса стоит учитывать, что эта культура быстро разрастается и образует пышный ковер. Его можно высаживать отдельно от других растений для оформления поляны. Любое место, где высажена резуха смотрится ярко и нарядно.

   

Арабис является прекрасным медоносом. Его сильный приятный аромат привлекает пчел. Если необходимо, чтобы запах цветов сохранялся в саду как можно дольше, следует высаживать его на участке, закрытом от ветра.


Арабис альпийский посадка и уход фото

Арабис альпийский (резуха) – частый обитатель садов камней, который полюбился садоводам своей неприхотливостью.

В природе это многолетнее растение часто встречается в Евразии и Северной Америке в каменистых и песчаных местах. К растению охотно слетаются насекомые, поскольку оно является замечательным медоносом.

В культурных цветниках известен больше 200 лет, превратившись во множество форм и сортов. Имеет вырастающие до 35 см генеративные восходящие и ветвистые вегетативные побеги, которые крепятся многочисленными тонкими корешками.

Прикорневые листья имеют зачастую овальную форму, а стеблевые – серые сердцевидно-стреловидные. Ранней весной растение образует душистые белые или розоватые цветки до сантиметра в диаметре, собирающиеся в рыхлые кистевидные соцветия. Цветение проходит обычно в течение мая, а в июле появляется плод-стручок.

Выращивание

Труд выращивания не столь кропотлив. Наилучшие результаты в этом достигают на хорошо обработанных рыхлых песчаных почвах. Уместен даже бедный кислый грунт, который, однако, не слишком увлажнен.

На солнечном месте арабис альпийский намного обильнее цветет и приобретает более компактный вид. Потребности в уходе ограничиваются традиционной прополкой, рыхлением и разумным поливом лишь при пересыхании почвы.

Чтобы продлить цветение, отцветшие цветки рекомендуется сразу удалять, а чтобы аромат был сильнее, лучше высаживать культуру в безветренном месте.

В малоснежную зиму будет не лишним укрыть, хотя некоторые новые формы выведены с абсолютной морозоустойчивостью. Весной же важно убедиться в достаточном дренаже почвы, поскольку в противном случае от застойных зимних вод растение может погибнуть. Если снег тает слишком рано, кустики полезно укрыть, защитив побеги от пересыхания.

Выращивая резуху на своем участке, важно учитывать большую скорость ее разрастания, что может заглушить соседние растения. Решением этой проблемы становится обрезка куста, сохраняющая его пределы.

На одном месте может расти подряд несколько лет. Если со временем побеги вытянутся, а цветки и листовые пластины обмельчают, лучше заменить куст или хотя бы сильно обрезать ветви.

Размножение

Классический арабис альпийский размножается семенами, а его гибридные махровые формы – черенками и кустовым делением. Высевая семена под зиму или весной, можно ждать цветение на второй год.

При делении с одного кустика берут по 5-6 довольно развитых частей. Также можно отделить часть куста, полностью его не выкапывая. При посадке рекомендуется соблюдать расстояние в 30-35 см. Черенкуют арабис в мае-июне, отрезав 6-8 см верхушки зеленых побегов. Пару нижних листиков удаляют, и растение высаживают на притененное и хорошо увлажненное место, желательно прикрыв бумагой или “укрывным” материалом. Черенки укореняются 2-3 недели и ближе к осени того же года становятся подходящими к отправлению на постоянное место.

Ландшафтный дизайн

В саду арабис альпийский можно высадить между вымощенными плитами, вдоль дорожек, на альпийских горках, клумбах и в миксбордерах.

Он хорошо укрепляет склоны, а раннее цветение активно используется для подбивки тюльпанов, нарциссов, крокусов и прочих декоративных луковичных.

Вместе с алиссумом и обриетой он способен создавать красивый фон для кустов роз, кустарников, карликовых и молодых деревьев. Такая компания создаст прекрасные сочетания крупных и мелких цветов, особенно эффектные при контрасте оттенков.

После отцветания резуху срезают вместе с прочими весенними культурами, и на их место сажают покрывающие большую площадь культуры, например, петунию.

Как вырастить арабис многолетний из семян: опыт посадки и ухода

Цветущий арабис привлекает не только своей красотой, но и дивным, тонким ароматом. Посадите на своем участке этот чудесный неприхотливый многолетник, соблюдайте простые правила ухода, и он будет многие годы радовать вас своей красотой и ароматом.

В чем особенности арабиса?

В этот цветок я влюбилась с первого взгляда, как только увидела в магазине пакетик, на котором красовались нежно-розовые цветы.

Арабис по-другому называют резухой. Несмотря на такое прозвище, листочки у растения мягкие, порезаться невозможно.

  • Этот почвопокровник растет в природе в сухой, жаркой, каменистой местности.
     
  • Легко переносит бедные почвы.
     
  • Арабис идеально вписывается в концепцию неприхотливого, малоуходного сада.
     
  • Для невысоких кустиков арабиса (в высоту ок. 30 см) самое главное — чтобы не было застоев влаги.

Секреты ухода

Поливать только в засушливые периоды. Не допускать сильного разрастания. Арабис довольно быстро заселяет пустующие территории и даже может вытеснять своих соседей, тех, что скромнее и меньше ростом. Поэтому при посадке предусмотрите достаточно места для резухи или поставьте ограничители.

  1. После цветения обрезаю цветоносы. Такая процедура арабису на пользу: он разрастается пышной зеленью и дает еще более обильное цветение.
     
  2. Также слегка укорачиваю разрастающиеся побеги, чтобы арабис не заглушил соседние растения.
     
  3. Регулярно рыхлю почву, удаляю сорняки.
     
  4. Поливаю умеренно, только в самую засушливую погоду – при застое воды могут загнить корни.

Арабис – достаточно морозоустойчивое растение. Он может спокойно зимовать под слоем снега. Иногда после зимы в больших кустах появляются проплешины. Я засыпаю оголенные участки универсальным грунтом, смешанным с перегноем, и вскоре растение омолаживается: дает новые корни, стебли и листья.

Фото: арабис кавказский Розеа (Arabis caucasica Rosea)

Чем хорош в дизайне сада?

Почвопокровное неприхотливое растение. Цвести начинает рано, в теплых регионах – с середины апреля. Цветение продолжается 1 месяц.

  1. Поэтому ценность арабиса — не в цветах, а в сочной густой листве. В теплом климате это вечнозеленое растение. 
     
  2. Арабис любит солнечные жаркие места, хорошо растет на камнях, значит можно посадить в рокариях и на альпийских горках.
     
  3. Листочки, кстати довольно крупные для почвопокровника, имеют приятный серебристый оттенок. Поэтому арабис прекрасно дополнит ваш сад в серых тонах.

Сочетание с другими растениями

Арабис будет хорошо сочетаться с такими растениями, как:

  • лаванда,
  • ясколка Биберштейна,
  • можжевельники,
  • юкка,
  • очитки,
  • опунция,
  • маклея (боккония),
  • яснотка,
  • бруннера,
  • шалфей лекарственный,
  • обриета,
  • райграс бульбоосный,
  • чистец византийский (овечье ушко).

Удивительное цветение

Зацвел мой арабис на 2-й год после пересадки. Цветет он почти месяц, с середины апреля до середины мая. Когда весна бывает ранняя, то арабис зацветает еще раньше, в начале апреля. А если весна затяжная и прохладная, зацветает позже обычного и цветет дольше.

Цветущий арабис не только потрясающе красив – он наполняет сад потрясающим нежно-сладким ароматом. Растение является хорошим медоносом и привлекает большое количество полезных насекомых – бабочек, шмелей, пчел.

Фото: арабис кавказский

Как размножить

Кустики арабиса легко делятся, это самый доступный и простой способ размножения. Куст делят каждые 3-4 года, растение хорошо приживается.

Деленку пересаживать легко. Можно выкопать кустик и аккуратно разделить корни руками, либо же просто разрезать лопатой разросший куст и выкопать деленки.

Почву никак особенно готовить не нужно. Достаточно выкопать ямку, взрыхлить, присыпать кустик и умеренно, но регулярно поливать первое время. 

При семенном размножении цветение наступит только через год. 

Можно пришпиливыть побеги и ждать их укоренения. 

Размножается арабис семенами,
а махровые сорта – делением и черенкованием

Арабис из семян

Каждую весну на моей клумбе появляется розовое душистое облачко. Это цветет арабис. Он растет пышными кустиками, достигая в высоту 15–20 см и разрастаясь в ширину до 40–50 см.

Посеяла
  1. В конце марта посеяла семена в горшочки с универсальным грунтом и оставила на улице (у нас на юге в это время уже тепло). Глубина заделки семян – 0,5 см.
     
  2. Днем ставила контейнер с горшочками на солнце, на ночь и на время дождей заносила под навес.
     
  3. Поливала из пульверизатора, сбрызгивая землю в горшках 1 раз в 3 дня.

Всходы появились через 3 недели, когда воздух сильнее прогрелся.

Пересадила

После появления 2–3 листочков пересадила растения на постоянное место.

Сначала высадила с краю центральной клумбы, с западной стороны. Но потом поняла, что это была ошибка. Растения у меня на клумбах высажены «по росту», т. е. с краев – более низкорослые, а дальше, вглубь клумбы, высота растений увеличивается. И получалось, что высокорослые растения заслоняли солнце, и арабис получал мало света.

Осенью пересадила арабис на край противоположной клумбы – там света вдоволь. Так как арабис любит рыхлую почву, то для большего разрастания и буйного цветения при пересадке добавила в грунт песка.

Удобрила

У меня было 4 кустика арабиса. Высадила их на расстоянии 30–35 см друг от друга. В каждую лунку насыпала несколько гранул азотного удобрения для лучшего роста.

В дальнейшем удобряла арабис один раз в год, перед цветением.

Фото: арабис альпийский

Желаю всем дачникам, садоводам, огородникам, цветоводам огромных успехов в достижении намеченных целей и преображении нашего мира!

Т. Клепова, г. Ростов-на-Дону; Анна Еланская, журналист

виды цветов, посадка и уход

Арабис – красивый многолетник для альпийских горок, который не требует много внимания.

Посадки арабиса будут уместны в саду под деревьями.

Размножается растение быстро, превращаясь в плотный ковер. Как правильно посадить арабис и ухаживать за ним?

Посадка арабиса на рассаду с фото

Размножается растение семенами, поэтому посадка его проводится рассадным способом. В отдельных регионах России с более мягким климатом арабис высевают осенью в открытый грунт.

Семена растения мелкие, поэтому особо заглублять их не нужно. Для прорастания им нужен свет. Емкости для рассады наполняют субстратом и увлажняют, семена равномерно распределяют на поверхности грунта. Контейнеры накрывают нетканым материалом, чтобы увеличить влажность воздуха вокруг семян. Проращивание проводят при температуре 20 С. Весь процесс занимает дней 20-25. Так что запаситесь терпением и увлажняйте грунт по мере необходимости.

Как только появятся всходы, укрытие снимают, а контейнер выставляют на самое светлое место, полив немного сокращают, регулярно рыхлят почву.

Растет рассада арабиса медленно, пикируют ее, когда появится несколько настоящих листиков. Во время пикировки сеянцы высаживают в отдельные емкости или прореживают на расстоянии 30 см друг от друга. Если планируется посадка арабиса плотным ковром, то пикировкой можно не заниматься.

Когда рассада приживется, то ее постепенно начинают закалять. Для этого в течение двух недель контейнер регулярно выносят на свежий воздух. Следите, чтобы сеянцы не попали под дождь, холодный ветер или сквозняк. На ночь емкость в молодыми арабисами заносят в дом.

Как только рассада будет готова, а угроза заморозков минуте, растения переносят на постоянное место в сад.

Как посадить арабис в грунт

Для арабиса нужно правильно подобрать место, чтобы растение радовали цветением и хорошо росли.

Лучше всего арабис развивается на открытых солнечных участках, которые хорошо продуваются ветром. Можно, конечно, посадить растение в тенистой местности, но тогда куст будет не таким пышным, а цветение скудным и непродолжительным.

Почва для посадки арабиса на участке должна быть сухая, рыхлая и легкая. Ее предварительно перекапывают с органическими и минеральными удобрениями, очищают от сорных трав. В тяжелые по составу грунты при перекопке добавляют песок.

Во время посадки между растениями оставляют около 40 см. Чтобы получить плотный ковер в одну лунку высаживают 2-3 саженца. После посадки арабис хорошо поливают.

Важно! Если под перекопку не вносили удобрения, то через несколько дней саженцы можно подкормить.

Выращенный из семян арабис зацветет только на второй год.

Уход за арабисом в открытом грунте

Вырастить арабис из семян несложно, растение очень выносливое и хорошо переносит засуху, но вот излишний полив вреден. Поэтому в дождливый сезон растение поливают крайне редко, чтобы не спровоцировать болезни.

Единственным минусом в выращивании можно назвать частые прополки. Растение не переносит соседство с сорняками, они могут приглушить рост побегов. Регулярное рыхление почвы и удаление сорняков крайне необходимо для нормального роста куста. Как только молодые саженцы окрепнут, сорняки уже не смогут пробиться через плотный ковер.

Размножение арабиса

Понравившиеся сорта арабиса размножают не только семенами. Можно прибегнуть к следующим способам:

Черенкованию;

Делению куста;

Выращиванию отводков.

Черенкование – это единственный способ размножение махровых форм растения. При семенном размножении родительские качества растения не сохраняются. На черенки выбирают листья с пяточкой, срезая часть коры и стебля. Черенкование проводят, когда растение закончит цветение. Укореняют черенки в тепличке на протяжении месяца. Высаживают их наклонно, чтобы обеспечить правильный рост коневой системы. Как только растения тронутся в рост, их пересаживают на постоянное место.

Деление куста проводят после цветения. Взрослый куст выкапывают и разделяют на несколько частей.

Чтобы получить молодое растение при помощи отводков, осенью наклоняют побег к земле и присыпают плодородным грунтом. Верхушку побега прищипывают. Как только на месте листового узла появятся корни, отводок отсаживают на новое место.

Арабис осенью: как собрать семена и подготовить растение к зиме

Во время цветения наметьте самые крупные и красивые соцветия. Собирать семена нужно, когда они полностью созреют с наступлением первых заморозков. Лучше всего это делать в сухой солнечный день. Если собрать семена в пасмурную и влажную погоду, то они теряют всхожесть.

Семена хорошо просушивают в темном сухом месте, собирают в бумажный пакет и хранят до момента посадки. Чем свежее семена, тем лучше они всходят.

Арабис считается выносливым растением, но с приходом холодов его побеги погибают уже при -5 С. Выращивать растение как многолетник без укрытия нельзя. Поздней осенью все побеги арабиса срезают на уровне почвы, а место посадки хорошо мульчируют сухими листьями, торфом, лапником или укрывным материалом.

Трудности в выращивании арабиса

Так как арабис относится к капустным культурам, то и вредители у них схожие. С ранней весны растение подвергается нападению крестоцветной блошки. Не стоит тратить время и силы на опудривание посадок золой или табачной пылью, лучше сразу обработать комплексными препаратами.

Еще одной проблемой при выращивании является вирусная мозаика. Определить поражение можно по характерным симптомам – мелким бурым пятнам, которые постепенно сливаются в одно. К сожалению, вирусная мозаика неизлечима, поэтому с пораженным растением придется проститься. Место выращивания хорошо дезинфицируют крепким раствором марганцовки. Посадить арабис снова можно только через год.

Популярные сорта арабиса

Среди культивируемых сортов, некоторые завоевали особую популярность:

Арабис альпийский. Многолетник хорошо размножается черенкованием, цветет белыми или розовыми ароматными цветами с конца апреля на протяжении месяца.

Арабис бруовидный. Листья этого многолетника покрыты войлочным пушком. Соцветия собраны в рыхлые розетки по 3-6 цветков.

Арабис кавказский. Подвид альпийского арабиса. Цветет с начала июля до заморозков.

Арабис поломниковый. Растение предпочитает каменистую почву, белые соцветия собраны в рыхлые щитки.

Арабис низкорослый. Цветение его не представляет ценности, выращивают растение ради привлекательных плодов.

Посадив однажды арабис на своем участке, садовод навсегда полюбит эту культуру за ее неприхотливость и красивый вид.

Арабис – это многолетнее травянистое растение семейства крестоцветных, произрастающее преимущественно в горной местности и на каменистых склонах. Цветущий ковер из живописного арабиса встречается в горах Европы, Северной Америки и странах Азии. В чем уникальность этого растения, как его выращивать и ухаживать за ним, а также как лучше использовать стелящейся арабис в ландшафтном дизайне, вы сможете узнать в этой статье.

Арабис: сорта и разновидности

Невысокое почвопокровное растение высотой до 30 см – это идеальное решение для украшения садового участка, дендрария, рокария и альпинария . Уникальность арабиса заключается в композиции ярко изумрудной зелени и розоватых, кремовых, сиреневых или вовсе белоснежных соцветий, которыми обильно усыпано растение. Ни особенности климата, ни перепады температур не влияют на вечнозеленую окраску, а снежный покров надежно оберегает кустики в сильные морозы.

Арабис станет прекрасным украшение любой ландшафтной композиции

Своим неординарным названием культура обязана уникальным природным свойствам: листочки некоторых разновидностей арабиса покрыты жесткими волосками, от прикосновения к которым можно нечаянно поранить руки. Сегодня это горное растение именуется солнечным зайчиком. Согласитесь, это название не только приятнее звучит, но и в полной мере соответствует благоухающему цветочному ковру.

Селекционерами выведено порядка 200 разновидностей культуры, из них более 100 – это необычные по живописности гибридные виды, которые очень популярны среди садоводов. Среди них нельзя не отметить лидеров – кавказский арабис и альпийский.

Горная культура кавказский арабис обладает сверхмощной корневой системой: она способна проникать внутрь расщелин в горах и быстро укореняться в них. Изумрудные кустики достигают в высоту всего 15 см, зато в длину могут «расползаться» до 30-40 см. Интенсивно цветет арабис под теплыми майскими лучами солнца, одаривая садоводов нежнейшим ароматом и мелкой россыпью цветочков розоватого и белого оттенка. Прекрасно растет как в диком виде, так и на приусадебных участках и оранжереях.

Кавказский арабис

Арабис альпийский – это необыкновенно ароматный кустарник, усыпанный множеством кисточек белого и розоватого цвета. Время активного цветения попадает на середину апреля. Скромно выглядывая из-под горных трещин и между камней, растение достигает в высоту всего 18-20 см.

Арабис альпийский

Помимо этих разновидностей существует еще и мхообразный арабис, выбегающий (произрастает на Балканах), реснитчатолистный, проломниковый и прочие не менее красочные горные растения.

Арабис мхообразный

Цветут кустики чаще всего в мае, очень обильно и весьма продолжительно – 20-30 дней. Очаровательные кистевидные соцветия объединяют множество простых и махровых цветочков лимонного, лилового и розоватого цвета. Растение плодоносит стручками, внутри которых собраны коричневые семена.

Арабис реснитчатолистный

Посадка арабиса

Садоводы чаще всего запасаются семенным материалом в цветочных лавках и магазинах. Выбирая семена для посадки, нужно знать, что лучшее время для выращивания приходится на осень (середина октября) и разгар весны. К этому времени следует побеспокоиться о емкостях для посадки. Оптимальная температура грунта 20ºС.

Высаживайте арабис только в хорошо прогретый грунт

Сажать семена глубоко не нужно, достаточно погрузить их на глубину 5 мм от поверхности почвы. Добиться высокой всхожести поможет укрывной материал, который настилается поверх засеянного участка земли. Этот недорогой, но весьма эффективный прием существенно упростит процедуру выращивания арабиса, в том числе и его полив, создаст оптимальный дренаж. Все это гарантирует не только лучшие условия для всхода семян, но и быстрый рост и скорое цветение взрослого растения.

Внимание! Правильный посев семян, прополка и своевременный полив – это главные слагаемые успеха выращивания красивых и здоровых садовых растений.

Пересадка арабиса в открытый грунт производится уже после появления первых 2-3 листочков. Чтобы отдельные кустики хорошо разрастались, не мешая и не вытесняя друг друга, соблюдайте соответствующую схему расположения сеянок – 40 х 40 см. Если вы хотите добиться эффекта цветочного ковра, то посадите в одну лунку 3 и даже 4 растения.

Молодое растение арабиса

Цветение ожидайте уже на следующий год. Правда нередко встречаются сорта и разновидности арабиса, которые радуют роскошным цветением уже к концу летнего периода.

Внимание! Чтобы в следующем сезоне растение радовало вас красивым обильным цветом, стебельки, на которых располагались соцветия, нужно аккуратно подрезать. Оставьте 3-4 см и аккуратно припорошите грунтом.

Размножить культуру можно и черенкованием. Поэтому не спешите избавляться от срезанных веточек!

Уход за растением

Поливать растение нужно умеренно: лишь периодически и только в длительный засушливый период. Арабис очень неприхотлив к почвенному составу, и тем не менее он любит рыхлую почву. Именно поэтому особое внимание уделяется рыхлению земли и прополке сорняков. Смешав грунт с песком, вы обеспечите растению стремительный рост и разрастание, а уже спустя несколько месяцев арабис порадует садовода бурным выразительным цветением и умопомрачительным благоуханием.

Арабис не любит частый полив и не нуждается в нем

Поскольку растение прекрасно произрастает как в саду, так в горных расщелинах, это дает нам возможность говорить о нечувствительности арабиса к болезням и вредителям.

Удобрение и подкормка арабиса

Это горное растение очень неприхотливо и не нуждается в кропотливом уходе. Но если вы используете арабис в ландшафтном дизайне и хотите добиться пышного цветения, то мы рекомендуем подкармливать растение на протяжении всего вегетационного периода специальными минеральными удобрениями. Начинать подкармливать арабис можно сразу после высадки в грунт.

Размножение растения

Арабис традиционно размножается семенами , а его махровые разновидности – или черенкованием, или делением кустика. Если используется семенной материал, то посев осуществляется либо весной, либо в конце осени. Сеянцы в этом случае начнут цвести уже на второй год.

Арабис хорошо переносит деление куста и черенкование

С помощью другого способа (деления кустика ) с 3-4-х растений можно получить порядка 20 вполне зрелых деленок. Высаживать в грунт их лучше в конце августа, выдерживая расстояние между саженцами не менее 30 см.

Черенкованием лучше всего заниматься с мая по июнь. Для этого как нельзя лучше подойдет верхушка побега (7-8 см). Нижние 2 листочка обрываются и черенок помещается в подготовленные лунки.

Внимание! Не забудьте о поливе и притенении новоиспеченных кустиков!

Спустя 3 недели черенки хорошо укоренятся в почву. В конце лета их можно пересадить на постоянное место.

Арабис: сочетание с другими растениями

Многолетний арабис превосходно вписывается в любые цветочные композиции и оранжереи, идеально дополняет террасы и современные архитектурные решения из камня. Неприхотливые кустики очень эффектно смотрятся по соседству с алыми тюльпанами , благородными ирисами , неординарным алиссумом и другими луковичными культурами раннего цветения. Низкорослые разновидности обычно используются для создания живописного фона в розарии .

Арабис на клумбе

Пышными горными растениями чаще всего декорируют альпинарии и рокарии, ими украшают любые каменистые стенки и конструкции. Прекрасно подходят для обустройства миксбордеров и оформления бордюров, укрепления склонов и создания ярких акцентов на приусадебном участке.

Посадка арабиса и уход за ним: видео

Разновидности арабиса: фото




Общие характеристики

Многолетнее травянистое почвопокровное растение, высота цветоноса до 30 см. Стебли плетистые, стелющиеся, укореняющиеся. Листья цельные, зубчатые, густоопушенные, серебристо-белые. Прикорневые листья часто собраны в розетку.

Цветки и плоды

Цветки белые, розовые, лиловые, красные (в зависимости от вида и сорта), простые или махровые, мелкие (до 1,5 см в диаметре), собраны в плотные зонтиковидные кисти. Цветет очень обильно, рано (с апреля) и долго (до 8 недель в прохладную весну). В период цветения очень сильно разрастается. Медонос. Плод – стручок.

Оптимальные условия выращивания, посадка и уход

Высаживать лучше на открытое солнечное место с легкой питательной, хорошо дренированной почвой. Полутень допустима, но на солнечном месте растение становится более компактно и цветет гораздо пышнее.
Быстро разрастается и может легко заглушить соседние растения, поэтому можно проводить регулярную стрижку побегов, которая позволяет избежать этой проблемы и сохранить форму куста. Кроме того, благодаря этому на следующий год арабис цветет значительно лучше.
Для продления цветения в течение сезона рекомендуется обрезать отцветшие цветы. Достаточно зимостоек, но в малоснежную зиму арабис требует дополнительного укрытия. Не выносит застоя влаги.

Способы размножения

Простые формы арабиса размножают семенами (весной или под зиму), махровые – делением куста (в августе – начале сентября) и черенками (во второй половине мая), так как семян они не дают. Достигает оптимального для деления возраста в 4 года, когда каждый куст можно успешно разделить на 15-20 самостоятельных дочерних.

Применение

Великолепно смотрится в бордюре и на переднем плане миксбордера. Прекрасно подходит для альпинария (в качестве газона), каменистых горок и устройства сухих подпорных стенок. Цветы арабиса махровой формы используют для весенних букетов. Незаменим, если в короткий срок требуется озеленить большую площадь участка. Особенно хорош для укрепления склонов.

Виды, сорта, формы

Многолетнее растение до 35 см высотой. Побеги сильно ветвистые, прижатые к земле, в виде тонких плетей, образующих подушковидные куртины, не отмирающие на зиму. Прикорневые листья овальные, стеблевые – сердцевидно-стреловидные, стеблеобъемлющие, сероватые. Цветоносы прямые. Цветки белые или розовые до 1 см в диаметре, душистые, собраны в кистевидное соцветие до 5 см длиной. Цветет в апреле – мае 25-30 дней. Плодоносит в июле. Плод – стручок.

Имеет несколько декоративных форм:

(Arabis bryoides)

(Arabis procurrens)

Почвопокровное растение с мелкими розетками и невзрачными цветками 10-12 см высотой. Неприхотлив. Быстро образует плотные куртины. Хорош для закрепления склонов. Морозостоек, но в бесснежные зимы желательно укрытие хвойным лапником.

Арабис выбегающий var. vochinensis

Образует очень низкий нарядный коврик.

(Arabis caucasica)

Многолетник 5-10 см высотой, подушковидной формы. Листья с войлочным опушеннием, по краю реснитчатые, маленькие, овальные с острым кончиком собраны в розетки. Цветочки белые с 6-7 мм лепестками в рыхлом щитке по 3-6 шт появляются весной. Требует солнечного местоположения в расщелине камней альпинария. Почва должна быть богатой кальцием, бедной, сухой, хорошо дренированной. На зиму требуется воздушно-сухое укрытие.

Имеет несколько декоративных форм и сортов:

Арабис гибридный Арендса “Snowfix”

(Arabis arendsii “Snowfix”)

Садовый гибрид (A. aubrietioides x A. caucasica). Многолетнее растение до 20 см высотой. Стебли лежачие, приподнимающиеся на концах. Сорта с пурпурно-розовыми (“Coccinea”),розовыми (“Atrorosea”) светло-розовыми (“Rosabella”) не выгорающими на солнце крупными цветками. Предпочитают полутень.

Растения образуют низкие куртинки 5-15 см высотой. Цветки белые, собраны в кисти. Цветет в мае-июне. Цветки невзрачные. Интересен в пору плодоношения, благодоря оригинальным плодам.

(Arabis androsacea)

Подушковидный многолетник 5-10 см высотой. Листья мелкие, овальные с острым кончиком, собраны в розетки. Цветочки белые в рыхлом щитке появляются летом.

(Arabis blepharophylla)

Многолетнее растение высотой 8 см и диаметром кустика до 25 см. Листья серо-зеленые, цветки темно-розовые. Укрытие на зиму обязательно.

Многолетнее растение высотой 20-25 см. Отличается только окраской цветков, причем интенсивность розовой окраски у разных растений неодинакова. Зацветает на две недели позже белых немахровых видов.

Арабис Фердинанда Кобургского “Variegata”

(Arabis ferdinandi-coburgii “Variegata”)

Полувечнозеленое многолетнее растение высотой 5 см и кустиком диаметром до 30 см. Очень ценится за обильное цветение в мае, цветки белые. Имеет светло-зеленые с белым окаймлением листья. Иногда встречаются формы с розоватым окаймлением. Растение морозостойко при условии хорошего дренажа.

Миниатюрные цветы с нежными лепестками различной окраски, от светлой кремовой до яркой насыщенной, на ковре густой зелени – многие видели такое растение, но мало кто знает, как оно называется. Это арабис – почвопокровный многолетник, украшающий наши клумбы.

Безусловно, арабис нельзя назвать экзотом, поражающим воображение. Его размеры невелики, цветы скромны, а листья не отличаются оригинальной формой. И все же, арабис по праву заслужил любовь многих цветоводов, пленяя не только своей нежной красотой, но и покладистым нравом. Его высаживают и на просторах нашей страны, и по всему миру. Практически в каждом уголке земного шара можно увидеть ковер из воздушных соцветий.

Этот представитель царства Флоры имеет несколько названий. Официальное произошло, по одним данным, от слова «арабия» или «аравия», по другим – от греческого «arabos», переводящегося как «скрежетание». Еще одно, менее распространенное, имя этого растения – резуха.

Арабис выращивают не только как декоративный вид, украшающий ландшафт, но и в качестве медоносного растения. Пчел привлекает тонкий сладковатый аромат, разливающийся во время цветения. А мёд, полученный из резухи, обладает приятным, немного терпким, вкусом.

Согласно ботанической классификации род арабис (лат. Arabis) относят к семейству капустные или крестоцветные (лат. Brassicaceae). Самые известные ближайшие родственники резухи – капуста, горчица, левкой и сурепка. Род включает в себя не менее 110 видов, большинство из которых встречается лишь в дикой природе. Некоторые виды, например резуха стреловидная (волосистая или стрелолистая), включены в Красные книги отдельных областей.

Представителей рода объединяют общие черты: высокий полегающий стебель, опушенные цельные листья с зубчатым или гладким краем и небольшие (до 2 см в диаметре) цветки, собранные в кистевидные соцветия. В зависимости от сорта окраска лепестков может варьироваться. Самые часто встречающиеся оттенки – кремовый, светло-желтый, розовый и лиловый. После цветения созревают плоские семена, собранные в удлиненный стручок.

Родиной арабиса принято считать горные районы Европы, а также Центральную и Восточную Азию. Впрочем, сейчас проследить перемещение растения по земному шару очень сложно: резуха встречается почти на всех континентах – от арктических широт до тропиков Африки. Такому широкому распространению поспособствовали и ботаники-селекционеры, получившие новые формы и сорта арабиса.

Виды, формы и сорта арабиса

Несмотря на большое количество видов растения, встречающихся в естественной среде, для декоративного выращивания приспособлены не более 7-10 из них. Однако существует много различных форм и сортов, выведенных на основе окультуренных разновидностей арабиса.

Арабис альпийский (лат. Arabis alpina). Самый часто встречающийся на клумбах вид, распространенный по всему земному шару, от Африки и Азии до Урала и Дальнего Востока.

Это многолетнее растение, предельная высота которого – 35 см, имеющее два вида побегов: стелющиеся ветвистые и высокие одиночные. Имеет два вида опушенных листьев: длинные и зубчатые, собранные в прикорневую розетку и стреловидные, обхватывающие стебель. Цветы собраны в плотное кистевидное соцветие, а диаметр отдельного цветка составляет около 1 см. Распространенный окрас лепестков – белый или розовый.

Один из садовых гибридов – арабис кавказский (лат. Arabis caucasica), по мнению одних ботаников, является разновидностью резухи альпийской, а по утверждению других – самостоятельным видом. Выделяется более опушенными листьями и крупными (до 1,5 см) цветками. Распространен, преимущественно, в районах с достаточно теплым климатом: в предгорьях Кавказа, в Крыму, на Средиземноморском побережье.


А. альпийский, А. кавказский

В культуру введено достаточно большое количество гибридных форм растения:

  • Пурпурный (лат. Arabis alpina var. purpurea),
  • Махровый (лат. Arabis alpina var. flore-pleno),
  • Розовый (лат. Arabis alpina var. rosea),
  • Пестролистный (лат. Arabis alpina var. variegata).

Наиболее популярными сортами альпийского и кавказского арабиса можно назвать:

  • «Schneehaube» (Снежный купол) – однолетник или вечнозеленый многолетник с простыми листьями и кистевидными соцветиями преимущественно белого цвета.
  • «Arctic Joy» (Арктическая радость) – сорт с белоснежными цветами и вариегатными (пестрыми) листьями.
  • «Snowflake» (Снежинка) – похож на предыдущий, но листья имеют однородную темно-зеленую окраску.
  • «Lotti Deep Rose» (Лотти Дип Роуз) – очень яркие розово-бордовые цветы.
  • «Pink Pearl» (Розовая жемчужина) – нежные цветы приятного кремово-розового цвета.
  • «Hedi» (Хеди) – крупные пурпурные соцветия.

А. «Schneehaube», А. «Pink Pearl», А. «Hedi»

Арабис Арендса (лат. Arabis х arendsii) – садовый гибрид, созданный на основе кавказского и обриециевидного арабисов и введенный в культуру в начале ХХ века. Это высокий, относительно других разновидностей, многолетник с крупными цветками различных оттенков. Из всего многообразия можно выделить следующие сорта:

  • «La Fraicheur» (Свежесть) – сорт с пышными соцветиями всех оттенков розового от светлого до насыщенного.
  • «Rose Frost» (Морозная роза) – яркие малиновые лепестки с синеватым оттенком.
  • «Compinkie» (Компинки) – невысокий почвопокровник, украшенный яркими цветами.
  • «Rosabella» (Розабелла) – ярко-зеленые листья и светло-кремовые соцветия.

А. «La Fraicheur», А. «Compinkie», А. «Rosabella»

Остальные виды резухи в культуре встречаются не часто, однако в последнее время ведется активная работа по выведению новых сортов и форм на их основе.

Арабис Фердинанда Кобургского (лат. Arabis ferdinandi-coburgii). Встречается, преимущественно, на Балканах, в частности в Болгарии. Среди других видов выделяется низким ростом (предельные размеры 5-7 см) и широкой листовой розеткой. Особую декоративность растению придают крупные (относительно общего размера) опушенные листья. Наибольшее распространение получили пестролистные сорта с белым или розовым окаймлением листовой пластины.

Арабис выбегающий (лат. Arabis procurrens) – как и предыдущий представитель рода распространен, в основном, в странах Восточной Европы. Среднерослый (до 15 см) многолетний почвопокровник с мелкими цветами кремового, розового или сиреневого оттенков. Чаще всего в культуре можно встретить вариегатные сорта с узорчатыми листьями.

Арабис реснитчатолистный (лат. Arabis blepharophylla) – многолетник родом из горных районов Калифорнии. Невысокое (до 10 см) растение с широкой и раскидистой листовой подушкой. Цветы, как правило, окрашены в розовый или лиловый тона. В России практически не встречается, так как не морозостоек и требует обязательного зимнего укрытия.


А. Фердинанда Кобургского, А. выбегающий, А. реснитчатолистный

Арабис проломниковый (лат. Arabis androsacea) растет, преимущественно, в горах Ближнего Востока. Это низкорослый (около 10 см) почвопокровник с мелкими овальными густоопушенными листьями и цветками в рыхлых кистевидных соцветиях. Прекрасно смотрится как украшение каменистых участков ландшафта.

Арабис низкорослый (лат. Arabis pumila) – невысокое, как ясно из названия, многолетнее растение, распространенное в горах и предгорьях Альп. Листья собраны в плотную прикорневую розетку, а цветонос располагается на высоком побеге. Цветки – мелкие, преимущественно белые или кремовые, особой декоративной ценности не несут.

Арабис мохообразный (лат. Arabis bryoides) схож с предыдущими видами своими некрупными (до 10 см в высоту) размерами. Имеет небольшие опушенные листья овальной формы и мелкие беловатые цветы, собранные в рыхлое соцветие.

Арабис в ландшафтном дизайне

Несмотря на скромный внешний вид, арабис может прекрасно вписаться в убранство любого сада, выполняя сразу несколько функций.

Чаще всего резуху используют в качестве почвопокровного растения. Это неудивительно: во-первых, арабис невысок, а во-вторых, отличается хорошей скоростью роста. В короткие сроки он способен затянуть пустые участки, образовав симпатичную яркую полянку. Как правило, его высаживают в свободных промежутках между крупными многолетними цветами, а также кустарниками или в приствольных кругах деревьев. Причем хорошо смотрятся не только яркие цветы резухи, но и овальные пушистые листья в розетке.

Еще одно распространенное использование арабиса в ландшафтном дизайне – высадка в альпийских горках и растительных композициях с включением камней. Мощные мочковатые корни резухи в короткое время оплетают земляной ком, поэтому растением можно украсить сухие подпорные стенки, которые довольно сложно засадить какими-либо другими видами.

[!] При размещении арабиса в разных уголках сада стоит учитывать освещенность участка. Так, в затененных местах резуха имеет свойство сильно разрастаться и вытягиваться, а в более солнечных – её цветение ярче, а сами кустики более приземисты.

Арабис прекрасно смотрится и в бордюрах, а также более сложных цветниках – миксбордерах. Компаньонами к резухе в этом случае могут стать другие низкорослые многолетники, цветущие весной и летом – бархатцы, календула, алиссум.

Выращивание арабиса и уход за ним

Арабис – один из самых неприхотливых многолетников. Обратить особое внимание нужно лишь на состав почвы, полив и регулирование роста. Кроме того, при выращивании в умеренных и северных широтах некоторые виды требуют зимнего укрытия. Рассмотрим уход за резухой немного подробнее.

Местоположение, почва

Этот почвопокровник относится к той группе растений, которые одинаково хорошо растут и на тенистых, и на солнечных участках. Но, пожалуй, лучшим выбором станут открытые места с небольшим затенением. В этом случае побеги многолетника не вытянутся, а лепестки сохранят свой первоначальный оттенок в течение всего срока цветения. Кроме того, высаживать резуху лучше на территориях, лишенных сильных сквозняков. Таким образом приятный запах сохраняется дольше, а нежные стебли не полегают от сильного ветра.

Что касается почвы, подходящей для высадки, здесь следует ориентироваться на субстраты, преобладающие в природных районах произрастания многолетника. Известно, что арабис растет, как правило, в предгорьях и высоко в горах, там, где земля бедна и состоит, преимущественно, из камней. Воссоздать такую же почвосмесь на клумбе, конечно, не представляется возможным, однако можно добиться хорошей водо- и воздухопроницаемости субстрата, добавив в него крупнозернистого песка.

Полив, подкормка

Как и большинство представителей флоры горных районов, резуха не терпит излишнего увлажнения. Именно поэтому поливать арабис следует осторожно, не допуская перелива, и лишь в периоды сильной засухи. В остальное время растению будет достаточно естественной влаги.

Для многолетника вредны и высокие грунтовые воды. Арабис не стоит высаживать на берегах водоемов и там, где застаивается стаявший снег. Если подходящего сухого участка нет, клумбу с резухой можно сделать немного приподнятой.

В подкормке резуха не нуждается, получая все необходимые микроэлементы из почвы. Лишь некоторые, высокогорные, виды можно подкармливать известковыми удобрениями, устраняющими в субстрате.

Обрезка, формирование и цветение арабиса

Широко разрастающийся арабис нуждается в регулярной обрезке и прополке. При строгой планировке клумбы удалению подлежат растения, вышедшие за пределы отведенного участка. Если цели создать четко разграниченный растительный узор нет, выпалывать нужно только больные экземпляры.

Бурное цветение большинства распространенных видов резухи наступает, обычно, в начале мая – начале июня, а его продолжительность составляет от трех недель до месяца. Отдельные цветки появляются на растении практически все лето.

Для возобновления цветения отцветшие побеги следует удалять, тогда на их месте появятся новые, молодые цветоносы с бутонами.

Зимовка

Как правило, предельная зимняя температура, которую может выдержать арабис без укрытия, составляет около -10°С. Если в течение зимы столбик термометра опускается ниже, почвопокровник следует укрывать. Для этого прекрасно подойдут ветви хвойных деревьев, сухие листья или специальный укрывной материал.

Укрывать растение на зиму следует только с наступлением морозов, иначе в защитном слое могут завестись грызуны, устроив там свои норы.

Размножение арабиса

Резуха способна размножаться самыми разными способами:

  • семенами,
  • делением,
  • черенками,
  • отводками.
Семена

Семена арабиса можно получить со взрослого растения или приобрести в садоводческом магазине.

[!] Семена, собранные с гибридов или сортов, чаще всего не наследуют качества материнского растения, перерождаясь в стандартный вид.

Высевать посадочный материал можно в открытый грунт (под зиму) или в контейнеры на рассаду (весной). И в том, и в другом случае глубина заделки семян должна составлять не более 0,5 см.

Для весеннего выращивания рассады необходимо подготовить емкость, наполненную влажной торфо-песчаной землей с добавлением мелких камешков. В эту почвосмесь высеваются семена и проращиваются при температуре не менее 20°С. Последующий уход заключается только в нечастом поливе субстрата. Примерно через три недели появятся первые всходы. После того, как на сеянцах образуются 2-3 настоящих листика, их нужно аккуратно распикировать по отдельным горшочкам и начинать закаливать, время от времени вынося рассаду на открытый воздух.

Высаживать молодые сеянцы арабиса на постоянное место жительства в открытый грунт можно не ранее конца мая, после того, как установится стабильно теплая погода. Расстояние между растениями должно составлять 30-35 см, а в одну лунку позволительно разместить сразу 2-3 саженца. Со временем почвопокровник затянет все пустующие промежутки и образует красивый растительный ковер.

Деление

Делить резуху следует сразу после окончания цветения, выбрав самые взрослые и здоровые кустики. Их аккуратно выкапывают, отряхивают от земли и разрезают на 2-3 части, каждая из которых должна содержать хотя бы одну точку роста и достаточное количество корней. Срезы на корневом коме можно присыпать толченым углем, а затем высадить разделенные растения снова в открытый грунт. Расстояние между ними должно составлять не менее 35-40 см.

Этот способ отлично подойдет для размножения особо ценных сортов и гибридов.

Черенки

Арабис отлично размножается и черенкованием. Для этих целей подойдут верхушки молодых побегов текущего года длиной около 10 см. Нижние листья с побега удаляются, а сам он высаживается в теплое притененное место для укоренения. Черенком может стать и лист арабиса, выломанный от материнского куста с небольшой частью корня.

Для лучшей приживаемости высаженный черенок можно накрыть срезанной пластиковой бутылкой, устроив таким образом мини-тепличку. Время от времени саженцы нужно поливать, а тепличку проветривать. После появления корней черенки следует пересадить на постоянное место.

Вредители и болезни арабиса

Вредителям и болезням арабис, как правило, подвержен мало. Все заболевания, появляющиеся на резухе, связаны, в основном, с неправильным уходом за растением, например излишним поливом.

В остальном резуха не принесет своему владельцу никаких особых хлопот.

С удовольствием выращивайте арабис на своих клумбах, любуйтесь его нежным цветением и красивыми листьями. А если будут вопросы, задавайте их в комментариях, постараемся ответить.

(1 оценок, среднее: 5,00 из 5)

Роскошный ковёр из душистых цветков, а над ним роятся пчёлы и порхают бабочки – зрелище, больше похожее на иллюстрацию к волшебной сказке. Это цветёт арабис – многолетнее травянистое почвопокровное растение семейства Капустные, ближайший родственник редьки, горчицы и капусты. О происхождении звучного латинского названия культуры ботанические справочники умалчивают, а вот народное прозвище «резуха» объясняется довольно просто: листья и побеги арабиса густо покрыты жёсткими волосками, об которые легко пораниться.

В цветоводстве резуха известна более двух веков. Пышные кусты используются для оформления альпинариев, миксбордеров, бордюров и рабаток. Мелкие цветки культуры, окрашенные в белые, розовые, жёлтые и сиреневые тона, распускаются в конце весны и украшают сад в течение месяца, источая при этом дивный сладковатый аромат. Кстати, благодаря быстрому росту арабис в кратчайшие сроки способен превратить заброшенный пустырь в сплошное цветущее покрывало. Разве не чудо?

Сроки посадки

Выращивать арабис из семян можно как безрассадным способом, так и через рассаду. В открытый грунт семена сеют осенью, примерно в середине октября.

На рассаду посев осуществляется в апреле, а в конце мая – начале июня кустики высаживают на клумбу.

Технология посева

Место для арабиса должно быть солнечным и хорошо проветриваемым, лёгкая полутень тоже допустима, но развиваться и цвести растения будут менее активно. Почву культура предпочитает песчаную, питательную и не слишком влажную.

Перед посевом участок перекапывают с внесением органических и минеральных удобрений. Для повышения водо- и воздухопроницаемости под перекопку желательно добавить мелкие камни, песок или дерн. Семена заглубляют на 0,5–0,7 см и присыпают питательной грунтовой смесью или сухим торфом.

Рассадный период

Вырастить крепкие, жизнеспособные сеянцы арабиса тоже несложно. Вам понадобится невысокий рассадный контейнер и немного садовой земли, разбавленной песком в соотношении 3:1 (песок можно заменить мелкими камушками). Порядок проведения работ таков:

  • Грунтовую смесь засыпают в контейнер и разравнивают.
  • Семена культуры заделывают на глубину 0,5 см.
  • Посевы умеренно поливают, накрывают ёмкость агроволокном и убирают в тепло (около +20 °C).
  • Спустя 3–3,5 недели, когда семена прорастут, укрывной материал убирают и устраивают контейнер на светлом подоконнике. Уход за сеянцами традиционен: регулярный полив и осторожное рыхление субстрата.
  • Если вы планируете выращивать арабис отдельными кустами, в фазе первого настоящего листка распикируйте сеянцы в индивидуальные горшочки или пересадите их в более просторный ящик с интервалом в 30–35 см. Но если ваши кусты будут выполнять роль покрывала, то хлопотать с пикировкой необязательно.

С появлением третьего настоящего листка растеньица переносят в открытый грунт.

Высадка сеянцев

На постоянное место роста рассаду резухи высаживают по схеме 40?40 см. Чтобы в будущем ваш цветущий «ковёр» получился густым и плотным, в одну лунку можно сажать сразу по 3–4 сеянца. По завершении работ сеянцы поливают. В цветение арабис, выращенный из семян, вступит на следующий год.

Правила ухода

  • В поливе растения нуждаются только в периоды продолжительной засухи. Арабис относится к тем немногочисленным культурам, которые легче переносят жажду, нежели чрезмерное увлажнение. И даже в сильную жару подавать воду следует умеренно.
  • Пока кусты не подрастут, почву на участке необходимо регулярно пропалывать. В дальнейшем эту процедуру можно отменить, так как взрослый арабис сам не позволит сорнякам вольготно расти рядом с собой.
  • Обрезка – ещё одно обязательное мероприятие для резухи. Побеги культуры растут довольно быстро, и их приходится регулярно подстригать, чтобы сохранить красивую форму куста.
  • Увядшие цветки арабиса нужно периодически обрывать, чтобы освободить место для новых бутонов, тогда цветение будет более продолжительным.

Этих процедур резухе будет достаточно для качественного роста, но, если вам покажется, что растения развиваются недостаточно хорошо, подкормите их в середине лета комплексным удобрением для цветов.

Болезни и вредители

Что касается вредителей, то чаще всего в цветочном ковре пакостничает злейших враг всех культур семейства Капустные – крестоцветная блошка. Против неё многие цветоводы по старинке опудривают посадки древесной золой. Однако этот неудобный метод малоэффективен, гораздо результативней действуют современные препараты-инсектициды – «Биотлин», «Искра», «Акарин», «Карбофос», «Актара», «Актеллик».

Подготовка к зиме

Если вы решили заготовить к будущему сезону посадочный материал арабиса, то в период цветения выберите несколько самых красивых соцветий и пометьте их любым удобным способом. После первых заморозков нужные кисти срезают с частью стебля и сушат в тёплом, проветриваемом помещении. Стручки лущат, фасуют готовый материал по бумажным пакетикам и убирают на хранение в прохладное, тёмное место.

Обратите внимание! Собирать стручки следует только в ясную погоду, поскольку сырость снижает процент всхожести семян.

Морозоустойчивость арабиса весьма относительна. Понижение температуры до -5…-7 °C растениям не страшно, но суровую, малоснежную зиму без дополнительного укрытия им не пережить. Поэтому в конце ноября обрежьте побеги культуры на высоте 2–4 см и утеплите посадки лапником, сухими листьями или нетканым материалом.

Виды и сорта

Род Арабис насчитывает около 120 травянистых многолетников, но в культуре выращивают самые красивые из них:

  • Арабис альпийский – коренной обитатель высокогорных регионов Западной Европы и Северной Америки, произрастает также на Дальнем Востоке и на Урале. Высокорослое (около 35 см) растение с ветвистыми, прижатыми к земле, побегами. По мере разрастания кусты образуют плотные подушковидные куртины, усыпанные с апреля до июня мелкими (до 1 см в диаметре) цветками белого или розового окраса. Популярные в цветоводстве формы: Schneehaube, розовая, махровая. Сорта: Лапландия, Розовые вершины, Белые вершины, Встреча.
  • Арабис кавказский (беловатый) – по мнению некоторых учёных, является подвидом арабиса альпийского. В природе растёт в горах Средней и Малой Азии, на Кавказе, в Крыму и на побережье Средиземного моря. Среднерослое многолетнее растение высотой до 30 см с белоопушёнными продолговатыми листьями и довольно крупными (около 1,5 см в диаметре) белыми цветками. Вид характеризуется быстрым разрастанием и обильным цветением. Сорта: Флоре Плено, Сноуфикс, Розабелла, Вариегата.
  • Арабис бруовидный – миниатюрное подушковидное растение высотой не более 10–12 см, произрастающее в горах Греции, Албании и Болгарии с мелкими овальными густоопушёнными листьями. Белые цветки собраны в рыхлые щитковидные соцветия.
  • Арабис выбегающий (выступающий, возвышающийся) – в естественной среде произрастает на Балканах. Симпатичный почвопокровный многолетник высотой около 10–12 см с небольшими листовыми розетками и бледными мелкими цветками. Идеально подходит для укрепления осыпающихся склонов.
  • Арабис реснитчатолистный – уроженец горных районов Калифорнии. Компактное низкорослое (около 8 см) растение с сизо-зелёными листьями и тёмно-розовыми цветками. Сорта: Фрюлингшабер, Роуз Делайт, Роут Сенсейшн.
  • Арабис Фердинанда Кобургского – карликовый почвопокровник высотой 5 см с очень красивыми ярко-зелёными или пигментированными листьями и мелкими белыми цветками.

Кроме вышеупомянутых, для садоводов представляют интерес такие виды арабиса, как башенный, низкорослый, Арендса, проломниковый.

В саду арабис рекомендуется выращивать на первом плане смешанных цветников и вдоль дорожек. Низкорослые, обильно цветущие сорта идеально подходят для оформления альпийских горок и сухих подпорных стенок. Махровые цветки резухи очаровательно смотрятся в нежных, весенних букетах.

Рекомендуем также

Как выращивать семена и уход Arabis Caucasica

Многолетнее растение Арабис, также называемое резусом, является представителем семейства крестоцветных или капустных. Этот род насчитывает более 100 видов. В дикой природе такое растение можно встретить в районах с умеренным климатом Северного полушария, а также в горах тропической Африки.

Характеристики арабиса

Арабис выращивают как однолетние или многолетние растения. Используется как почвопокровное растение, так как имеет укореняющиеся побеги.Высота куста не превышает 0,3 фута. На поверхности зеленых листовых пластинок имеется густое опушение, форма их сердцевидная, они сплошные, иногда с зубчатым краем.

Не очень крупные густые кисти соцветий состоят из махровых или простых цветков, достигающих в диаметре 15 ярдов, они могут быть окрашены в белый, светло-желтый, розовый или пурпурный цвет. Обильноцветущее растение относительно длинное и начинается примерно в середине весеннего периода.

От соцветий исходит очень приятный запах, который привлекает в сад большое количество пчел.Плод представляет собой стручок с плоскими семенами внутри. Есть виды, у которых есть крылатые семена.

Уход за арабисом в саду

За растением нужно ухаживать так же, как за большинством обычных садовых растений. Требуется своевременный полив, прополка, подкормка, обрезка, а еще производить рыхление поверхности участка и следить за здоровьем. Этот цветок устойчив к засухе, и его лучше не поливать.

Это означает, что полив следует устраивать только при продолжительном засушливом периоде.Помните, что полив должен быть умеренным.

Аравия в начале своей жизни, чтобы гарантировать свободу от сорняков, требует частой прополки. Однако со временем цветок окрепнет, и он «давит» сорняки.

Быстрорастущие стебли необходимо систематически обрезать, чтобы растение оставалось аккуратным. Своевременное удаление цветков стало увядать и способствует более длительному цветению.

Арабис после цветения

Сбор семян

Когда резус зацветет, нужно выбрать самые эффектные соцветия и наметить их.После первых заморозков можно приступать к сбору семян, для этого выбран сухой солнечный день.

Дело в том, что если собрать семена в дождливый день, всхожесть у них будет относительно низкая. Сначала нужно обрезать соцветия и часть побега.

Их подвешивают в хорошо проветриваемом помещении и ждут, пока они высохнут. Затем семена извлекаются из соцветий и помещаются в картонную коробку, которая хранится в сухом затемненном месте.

Подготовка к зимовке

Без укрытия такой цветок выдерживает понижение температуры до минус 5-7 градусов.Если температура воздуха упадет еще ниже, это приведет к гибели непокрытых арабов.

С началом заморозков необходимо обрезать стебли, при этом их 20-40 отрезков должны оставаться на поверхности.

Затем участок покрывают слоем засохшей листвы, а можно накрыть укрывным материалом или еловыми ветками.

Виды и сорта арабики с фотографиями и названиями

Ниже будут описаны те виды и сорта, которые наиболее популярны у садоводов.

Arabis Alpina или Arabis Flaviflora

В естественных условиях этот вид встречается в северной части Скандинавии, в высокогорьях Западной Европы и Северной Америки, а также на Дальнем Востоке и Полярном Урале.

Высота такого многолетнего растения может достигать 0,35 фута. Генеративные стебли восходящие, а петлевидные вегетативные – прижатые к почве, они сильно разветвлены, зимой не погибают и образуют подушковидную завесу.

Форма стволовых листовых пластинок сердцевидно-стреловидная, прикорневая и овальная.Длина кистей около 50 дюймов, они состоят из ароматных цветков диаметром 10 дюймов, которые могут быть окрашены в белый или розовый цвет. Цветение начинается в апреле и продолжается около 4 недель.

Формы сада:

  • Neeshub. Высота куста не превышает 0,25 фута. Длина кистей около 15 ярдов, они состоят из крупных (диаметром 20 дюймов) белых цветов.
  • Двухместный. Соцветия имеют больший размер по сравнению с исходным видом, слева они также похожи.
  • Розовый.Высота куста не превышает 0,2 фута. Длина соцветия около 12 ярдов, они состоят из розовых цветков, диаметр которых достигает 20 дюймов.

Выше описана посадка и уход за ним Arabis Alpine.

Arabis Bryoides

Родиной этого растения является альпийский и субальпийский пояс горных районов Греции, Албании и Болгарии. Это многолетнее растение, имеющее форму подушки, достигает в высоту около 10 ярдов.

На поверхности небольшого инфузорийного листа пластинки имеют войлочно-овальную форму, собираются в выходном отверстии.Рыхлые щитковидные соцветия состоят из 3-6 цветков белого цвета.

Arabis Caucasica

По мнению некоторых ученых, это растение является подвидом альпийского арабиса. В естественных условиях его можно встретить в Крыму, Малой и Средней Азии, на Кавказе и в Средиземноморье. В период цветения высота этого многолетнего растения может достигать 0,3 фута.

Небольшие продолговатые листовые пластинки с крупными зубцами по краю на поверхности имеют густое опушение белого цвета, от которого их цвет выглядит зеленовато-серым.Кисти соцветий в длину достигают 8 ярдов, состоят из белых цветков диаметром 15 дюймов.

Цветение начинается в июне и длится 4 недели. Однако некоторые цветы могут цвести на кусте до осени. Плод – узкая длинная шишка.

Садовые формы:

  1. Флора-плен. Цветущие пышные, махровые цветки белого цвета расположены на длинных цветоносах.
  2. Variegata. По краю листа пластинки светло-желтого цвета.
  3. Розабелла.Цвета розовые.

Arabis Procurrens

В природе этот вид произрастает на Балканах. Высота такого почвопокровного растения около 12 ярдов. Есть мелкие листовые розетки и бледные цветки.

Часто этот тип используется для защиты ползучих спусков. Этот вид отличается неприхотливостью и морозостойкостью, но на зиму его рекомендуется укрывать.

Самый популярный сорт – Вариегата: зеленые листовые пластинки имеют широкую белую кайму, фиолетовые цветки собраны в пучок, со временем их окраска меняется на белый.

Arabis Pumila

В дикой природе это растение можно найти в Альпах и Апеннинах. Высота куста около 15 ярдов. Уродливые цветки окрашены в белый цвет. Цветение начинается в мае-июне. Это и вид декоративных цветов, и плодов, благодаря которым садоводы и выращивают его.

Arabis Androsacea

В природе этот вид встречается на высоте 2300 футов над уровнем моря на каменистых склонах Турции. Высота этого многолетнего растения от 5 до 10 ярдов. Частью розеток являются небольшие заостренные овальные листовые пластинки.Рыхлое щитковидное соцветие состоит из белых цветков.

Arabis Blepharophylla

В природе этот вид встречается в горах Калифорнии на высоте 500 футов над уровнем моря. Это почвопокровное многолетнее растение достигает в высоту 8 ярдов при диаметре куста примерно 0,25 фута. Цвет листьев зеленовато-серый, а цветы темно-розовые.

Популярный сорт:

  • Route Sensation. Листовые пластинки имеют удлиненную форму, а окраска цветков насыщенно-розовая.
  • Малингерер. У куста мелкие листья и розовые цветки.
  • Арабис Фердинанд из Кобургской разновидности (Arabis ferdinandi-coburgii «Variegata»)
  • Арабис Фердинанд из Кобургской разновидности

Высота такого полувечнозеленого растения не превышает 50 дюймов, а его диаметр может достигать 0,3 фута. Этот вид отличается длительным пышным цветением. Эффектные бледно-зеленые листовые пластинки имеют кайму желтого, белого или светло-розового цвета.

Цвет белые цветы. Очень красиво смотрятся широкие подушки из листовой розетки.Если есть хороший дренаж, то этот вид выдерживает минусовые температуры.

Arabis x arendsii или Pink Wall Cress

Род Arabis , семейство Brassicaceae , включает 100 видов травянистых растений , распространенных почти на всех континентах. Примерно видов : Arabis alpina, Arabis hirsuta, Arabis caucasica, Arabis glabra, Arabis aubrietioides, Arabis armena.

Общие названия : Rockcress, Pink Wall Cress.Этот вид обитает в Скалистых горах от Монтаны до Нью-Мексико. Это гибрид видов Arabis caucasica и Arabis aubrietioides.

Это небольшие травянистые и многолетние или полуполетние растения, достигающие 20 см в высоту. Имеют небольшие овальные листочки серовато-зеленого цвета; появляются в розетках вдоль стеблей. Самое интересное – это его ароматные цветы с 4 лепестками и розовой фуксией. Они цветут с конца весны до начала лета.

Они используются в горшках, в рокариях, в альпийских садах, в качестве покрытия склонов или бордюров. Они хорошо сочетаются с растениями родов Aubrieta, Alyssum и Armeria. Интересны они и как срезанный цветок.

Arabis x arendsii предпочитает полное солнце , выдержку и теплый климат. Они плохо переносят морозы и холодные и влажные зимы.

Это простые в выращивании, среднерослые растения, которые могут расти на бедных песчаных почвах. при условии, что они хорошо дренированы.

Обладает хорошей засухоустойчивостью; полить умеренно, дождавшись высыхания почвы.

Удобряйте медленным удобрением ранней весной.

Слегка подрезайте чернослив после цветения, чтобы придать им более компактный вид.

Устойчивы к вредителям , но чувствительны к избыточному поливу и влажности окружающей среды.

Они легко размножаются из семян, посеянных весной.Важно обновлять растения каждые 2 года, потому что они теряют привлекательность.

Arabis caucasica ‘Little Treasure Deep Rose’

Arabis caucasica, обычно называемый кресс-салатом, представляет собой нежное многолетнее растение для холодного сезона, которое производители часто выращивают для продажи ранней весной. Как следует из общего названия, кресс-салат широко выращивают в альпинариях, но также хорошо подходят как почвопокровное растение и в пограничных насаждениях. Арабис с его ранним цветением обычно продается ранней весной вместе с однолетними растениями, такими как анютины глазки, и раннецветущими многолетниками, такими как аквилегия, беллис и миозотис.

Arabis ‘Little Treasure Deep Rose’ дает обилие ярких розово-розовых цветов в середине весны. Во время цветения сладко ароматные цветы покрывают почти все растение. Он образует компактные низкорослые подушки из вечнозеленой листвы, достигающей 4-6 дюймов в высоту и 10-12 дюймов шириной. «Little Treasure Deep Rose» за свою впечатляющую цветочную силу и надежные садовые характеристики была удостоена знака качества Fleuroselect в 2006 году.

Little Treasure Deep Rose подходит для выращивания в зонах устойчивости USDA с 3 по 8 и в тепловых зонах AHS с 8 по 1.Как и многие растения в прохладное время года, арабис не переносит сильную летнюю жару на большей части территории Соединенных Штатов. Лучше всего он растет в солнечных местах на севере и в полутени при выращивании на юге. Чтобы сохранить качество растений, сохранить компактную форму и предотвратить «таяние», рекомендуется обрезать их после того, как они отцветут весной. После укоренения араби довольно устойчивы к засухе.

Распространение

‘Little Treasure Deep Rose’ легко размножается семенами и поставляется компанией Syngenta Flowers.Пропагаторы обычно запускают их в небольших лотках для пробок размером 288 или 220 ячеек. Сейте от трех до пяти семян на ячейку и не покрывайте семена смесью для проращивания или вермикулитом. Поскольку для прорастания необходим свет, закрытие семян может отрицательно повлиять на процесс прорастания. Семена следует увлажнить и переместить в теплую среду, где температура может поддерживаться на уровне 63-67 ° F для прорастания. Выращивание арабиса в камере для проращивания увеличит как скорость прорастания, так и процент прорастания, одновременно сократив время, необходимое для прорастания всех семян.Поддерживайте высокую влажность (95 процентов), пока семядоли не прорастут. Семена должны прорасти через 7-10 дней.

После прорастания постепенно уменьшайте влажность. Выращивайте их при температуре 60-65 ° F. Слегка уменьшите уровень влажности, позволяя питательной среде немного подсохнуть перед поливом, чтобы способствовать укоренению. Не держите их слишком влажными во время производства пробок, иначе возможны потери оборудования. Удобрения со сбалансированным водорастворимым источником обычно вносятся после появления настоящих листьев, применяя от 75 до 100 частей на миллион азота при каждом третьем поливе или 50 частей на миллион при каждом поливе.При таких температурах “Little Treasure Deep Rose” завершит стадию пробки через пять-семь недель.

Производство

Little Treasure Deep Rose чаще всего производится в контейнерах небольшого размера (5 дюймов или меньше) с единственной пробкой, установленной в центре горшка. При пересадке питательная среда горшка должна быть ровной с верхушкой втулки. Арабис лучше всего растет во влажной, хорошо дренированной среде со слабокислой pH 5,5-6,5. Когда полив необходим, тщательно полейте их и дайте почве немного подсохнуть между поливами.Кормушки умеренные. Обеспечение высокого или роскошного уровня плодородия заставит их казаться пышными и может задержать цветение. Фермеры обычно доставляют питательные вещества, используя либо постоянную программу жидких удобрений с дозировкой нитратов от 75 до 125 ppm, либо удобрения с контролируемым высвобождением, вводимые со скоростью, эквивалентной 1 фунту элементарного азота на ярд питательной среды.

Из-за их компактного роста обычно нет необходимости контролировать высоту растений. Однако в зимние месяцы, в периоды низкого уровня освещенности, при выращивании с высокой плотностью растений или с высокими уровнями питательных веществ может произойти чрезмерный рост растений, требующий определенной стратегии управления высотой.Рост арабиса часто можно контролировать, обеспечив достаточное расстояние между растениями. Может возникнуть необходимость, хотя и нечасто, использовать химические регуляторы роста растений для контроля роста кресс-салата. В северных частях страны я рекомендую применять B-Nine (даминозид) в концентрации 2500 ppm. Нанесение одного-двух распылителей с семидневными интервалами должно обеспечить адекватный контроль высоты.

Насекомые и болезни

Есть лишь несколько проблем с насекомыми или болезнями, с которыми могут столкнуться производители.Тля – самые неприятные насекомые-вредители арабиса. Гроверам может быть полезно рассмотреть возможность профилактического полива продуктов, содержащих ацетамиприд, динотефуран, имидаклоприд или тиаметоксам, чтобы обеспечить до 12 недель борьбы с тлей.

Ботритис – наиболее распространенное заболевание, наблюдаемое производителями. Ботритис может появиться в конце цикла выращивания, когда полог смыкается, когда они начинают цвести, или сразу после цветения. В большинстве случаев появление Botrytis можно предотвратить или уменьшить, обеспечив надлежащее расстояние, хорошую циркуляцию воздуха и относительную влажность ниже 70 процентов.Продажа растений, когда бутоны только начинают распускаться, и, при необходимости, проведение профилактической программы опрыскивания фунгицидами с использованием продуктов, содержащих азоксистробин, хлороталонил или фенгексамид, также могут помочь уменьшить возникновение Botrytis. Корневая гниль (Pythium и Rhizoctonia) вероятна, если арабис выращивается в чрезмерно влажных условиях.

Насекомых и болезней можно обнаружить с помощью регулярного мониторинга урожая; Стратегии контроля могут не потребоваться, если разведывательные мероприятия не укажут на необходимость принятия мер.

Форсирование

Arabis ‘Little Treasure Deep Rose’ легко заставить цвести, и его чаще всего выращивают для продажи ранней весной. У них есть обязательная потребность в холодах для цветения. Я рекомендую яровизировать их в последнем контейнере или в виде больших пробок (72 ячейки или больше) в течение минимум девяти недель при температуре 35-44 ° F. После обработки холодом кресс-салат зацветет при любом фотопериоде, и его можно заставить цвести. при естественной длине светового дня. Продолжительность фотопериода не влияет на время цветения или количество цветков.

Есть два общих подхода к производству цветущих контейнеров арабиса. Первый метод: посадите ненастроенные пробки в последний контейнер в период с ранней до середины осени, дайте им немного набухнуть, яровизируйте их и заставьте их зацвести ранней весной, используя низкие производственные температуры 50-60 ° F на 4-6 часов. недели. Вторая стратегия включает пересадку яровизированных пробок в последние контейнеры в конце зимы и выгонку их при температуре 50-60 ° F в течение пяти-семи недель.Арабисы – растения прохладного сезона, которые предпочитают выращивать при прохладных температурах. Обеспечение низких температур приведет к появлению высококачественных растений, но требует дополнительного производственного времени, чтобы растения достигли цветения.

Наличие

Семена Arabis caucasica ‘Little Treasure Deep Rose’ доступны для производителей через Syngenta Flowers (www.sg-flowers-us.com). Вилки можно приобрести у многих известных производителей вилок с многолетним опытом или у заводских брокеров.

Пол Пилон

Пол Пилон – консультант по садоводству, владелец компании Perennial Solutions Consulting (www.perennial-solutions.com) и автор книги Perennial Solutions: A Grower’s Guide to Perrennial Production. С ним можно связаться по телефону (616) 366-8588 или [электронная почта защищена]

Информация о выращивании и уходе за каменными кресс-салатами

Кресс-салат – многолетнее травянистое растение, принадлежащее к семейству капустных или горчичных. Цветы и листья кресс-салата съедобны. Выращивание кресс-салата не требует особых навыков и это растение хорошо подходит для начинающего садовода.

Кресс-салат имеет много применений в саду, но чаще всего он используется в качестве привлекательной границы в саду камней или свисает с каменной стены или уступа.Кресс-салаты – это альпийские растения, и они будут расти там, где другие растения не справятся, например, на холмах и склонах.

Почвопокровный пурпурный кресс-салат ( Aubrieta deltoidea ) прилегает к земле, как циновка, и с апреля по середину мая демонстрирует насыщенные пурпурные цветы и имеет прекрасный аромат. Кресс-салат ( Arabis caucasica ) чаще цветет белым или розовым. Оба образуют привлекательные низкие насыпи, которые отлично смотрятся на краю подпорной стены, где они получают полное солнце и отличный дренаж.

Как вырастить каменный кресс-салат

Кресс-салаты морозостойки в зонах 4-7 устойчивости растений USDA. Они легко выращиваются из семян и могут быть посеяны прямо в саду ранней весной или выращены в помещении за четыре-шесть недель до даты ваших последних ожидаемых заморозков.

Кресс-салат предпочитает солнечные лучи, но может переносить тень, особенно в более теплом климате. Космический кресс-салат на расстоянии от 15 до 18 дюймов (от 38 до 45,5 см) друг от друга, и они быстро заполнятся, образуя циновку на любом открытом пространстве.

Уход за каменными кресс-салатами

Независимо от того, какой тип вы выберете для выращивания, уход за кресс-салатом относительно минимален. Поливайте новые кресс-салаты регулярно и только тогда, когда почва становится сухой после того, как они укоренились.

Почвопокровные кресс-салаты хорошо растут на светлой почве с хорошим дренажем и слабокислой почвой. Применение легкой мульчи из сосновой хвои помогает сохранить влагу и повысить кислотность.

Удобрения с высоким содержанием азота могут применяться при первом посеве, а фосфорные удобрения – сразу после цветения.

Кресс-салат зацветет вторую весну после посадки и каждый год после нее. Регулярная обрезка для удаления мертвых цветов сохранит растение здоровым и будет способствовать его новому росту.

Обработка кресс-салата от вредителей или болезней возникает редко.

Теперь, когда вы знаете основы выращивания почвопокровного кресс-салата, вы можете добавить привлекательный вид альпинарию или стене.

Каменный кресс (Arabis caucasica aka A. albida)

Кресс-салат – это вечнозеленое травянистое многолетнее растение, произрастающее в горных районах от Средиземного моря до Восточной Азии, где оно растет на хорошо дренированных почвах и на открытом солнце.Это представитель семейства горчичных, Brassicaceae, в которое также входят капуста, конфета и бульон. Низкорослое растение образует рыхлый коврик с опушенными серо-зелеными прикорневыми листьями длиной до двух дюймов. Маленькие белые цветки с четырьмя лепестками и ранней весной образуются рыхлыми кистями. Сильно обрезайте растения после цветения, чтобы получить более привлекательные растения летом и усилить цветение в следующем году. Прекрасный выбор для посадки в расщелинах среди скал или в стенах.Кресс-салат предпочитает прохладный климат и лучше всего растет в зонах 7 и ниже. Он будет цвести в теплом климате, но тает в центре в летнюю жару. Название рода Arabis может происходить из Аравии, где некоторые роды являются аборигенами. Специфический эпитет caucasica относится к Кавказу, одному из мест обитания этого вида.

Тип: Вечнозеленое травянистое многолетнее растение

Цветение: Маленькие белые цветки с четырьмя лепестками в рыхлых кистях ранней весной

Размер: 8-10 дюймов x 18 дюймов

Свет: Полное солнце

Почва: Средняя, ​​от сухой до средневлажной, хорошо дренированная; хорошо переносит засуху и неплодородную почву.

Выносливость: Зоны 4-8

Уход: Обрезать после цветения

Вредители и болезни: Восприимчивость к корневой гнили, ложной мучнистой росе, серой гнили, белой ржавчине, тле

Размножение: Деление, черенки, семена

Сопутствующие растения: Алиссум, корзина с золотом, коралловые колокольчики, ползучий фолокс, куры и цыплята, цветок паске

Отличный выбор:
Вар. flore = plena (более стойкие цветы)
«Розабелла» (цветы увядающей розы)
«Снежок» (белые цветы на 4–6-дюймовых высоких растениях)
«Snow Cap» (крупные цветы)
var.Variegata (Желто-белые полосатые листья)

Learn2Grow

Семья

Brassicaceae

Ботаническое название

АРАБИС blepharophylla ‘Rose Delight’

Общее название растения

Rose Delight Rockcress, Роуз Rockcress

Общее описание

Ароматные и изящные бледно-розовые и фуксийные цветы рок-кресс-салата Rose Delight расцветают над плотной зеленой листвой в конце весны.Родительский вид – это недолговечный, вечнозеленый, образующий пучок многолетник, который произрастает в центральной и северной Калифорнии, где он растет на песчаных почвах и в прибрежных районах.

Овальные листья с мелкими зубчиками, атласно-зеленые, с опушенными краями. В конце весны на коротких стеблях появляются грозди крошечных цветков, привлекающих бабочек. Эти цветы имеют цвет от розово-розового до розово-фуксийного цветов, они очень яркие на пышном зеленом фоне листвы. Этот многолетник будет умеренно пересаживаться, а падающие растения естественным образом заменяются новыми.

Выращивайте «Rose Delight» на полном солнце (но в полутени в жарких летних регионах) и на песчаной, хорошо дренированной почве среднего или низкого плодородия. Поливайте свободно, пока он активно растет и цветет, но экономно или совсем не поливайте зимой. Он идеально подходит для приморских коттеджных садов или в качестве акцента или почвенного покрова в рокариях. Также хорошо растет в контейнерах.

Характеристики
  • AHS Heat Zone

    7–5

  • Зона устойчивости USDA

    5–8

  • Зона заката

    5, 6, 15, 16, 17

  • Тип установки

    Многолетник

  • Солнце

    Полное солнце

  • Высота

    4-8 дюймов / 10.2 см – 20,3 см (6)

  • Ширина

    10,2–20,3 см / 4–8 дюймов

  • Время цветения

    Поздняя весна, начало лета

  • Родной для

    Северная Америка, США, Калифорния

Элементы орнамента
  • Цветочный интерес

    Эффектный

  • Цветочный цвет

    Розовый, Фуксия, Роза

  • Цвет листвы (Весна)

    Зеленый

  • Цвет листвы (лето)

    Темно-зеленый

  • Цвет листвы (осень)

    Темно-зеленый

  • Цвет листвы (зима)

    Темно-зеленый

  • Ароматные цветы

    Есть

  • Ароматный фрукт

  • Ароматная листва

  • Кора или стебель ароматный

  • Номер лепестка цветка

    Одноместный

  • Повторить Блумер

  • Яркие фрукты

  • Съедобные фрукты

  • Эффектная листва

  • Текстура листвы

    Средний

  • Листва блеск

    матовый

  • Эвергрин

    Есть

  • Шоуи Барк

Особые характеристики
  • Использование

    Альпийский, Контейнер, Окантовка, Почвопокровное, Смешанный бордюр, Каменный сад / Стена

  • Острый или имеет шипы

  • Инвазивный

  • Привлекает

    Бабочки

  • Самосев

PERPETUAL FLOWERING2 координирует реакцию яровизации и многолетнее цветение Arabis alpina | Журнал экспериментальной ботаники

Аннотация

Цветочный репрессор APETALA2 (AP2) у Arabidopsis регулирует цветение через возрастной путь.Ортолог AP2 в альпийском многолетнем растении Arabis alpina , PERPETUAL FLOWERING 2 ( PEP2 ), как ранее сообщалось, контролирует цветение посредством пути яровизации путем усиления экспрессии другого репрессора цветков PERPETUAL PERPETUAL32 PEP1 ), ортолог Arabidopsis FLOWERING LOCUS C ( FLC ). Однако PEP2 также регулирует цветение независимо от PEP1. Чтобы охарактеризовать функцию PEP2 , мы проанализировали транскриптомы мутантов pep2 и pep1 .Большинство дифференциально экспрессируемых генов было обнаружено между pep2 и диким типом или между pep2 и pep1 , что подчеркивает важность роли PEP2 , которая не зависит от PEP1 . Здесь мы демонстрируем, что активность PEP2 предотвращает повышающую регуляцию генов идентичности цветочной меристемы A. alpina FRUITFUL ( AaFUL ), LEAFY ( AaLFY ) и AaLFY ) и AaLFY ), обеспечивая фиксацию цветков во время яровизации.Молодые проростки pep2 реагируют на яровизацию, подтверждая, что PEP2 регулирует возрастную реакцию на яровизацию независимо от PEP1. Основная роль PEP2 через путь, зависимый от PEP1 , имеет место после яровизации, когда он способствует активации PEP1 как в верхушке главного побега, так и в подмышечных ветвях. Эти множественные роли PEP2 в реакции яровизации вносят вклад в жизненный цикл A. alpina .

Введение

Адаптация растения к окружающей среде требует изменения признаков развития, среди которых время цветения является ключевым для обеспечения успешного производства потомства. В альпийских местообитаниях, в которых выживаемость молоди очень низкая, в основном преобладают многолетние виды (Billings and Mooney, 1968). В общем, привычка к многолетнему росту зависит от различного поведения меристем на одном и том же растении, так что одни останутся вегетативными, а другие начнут цветение (Амасино, 2009; Lazaro et al., 2018). Основным признаком окружающей среды, который способствует цветению у альпийских видов, является длительное воздействие холода – процесс, называемый яровизацией. Альпийская среда характеризуется коротким вегетационным периодом и длительными периодами снежного покрова. Таким образом, для обеспечения репродуктивного успеха альпийские растения закладывают цветочные почки в ответ на продолжительный холод за несколько месяцев или лет до цветения (Diggle, 1997; Meloche and Diggle, 2001). Однако длительные холода не всегда приводят к цветению.Это особенно верно для многолетних видов, поскольку большинство из них имеют длительную ювенильную фазу и не способны зацвести в молодом возрасте (Bergonzi and Albani, 2011).

Молекулярные механизмы, регулирующие цветение в ответ на яровизацию или возраст растения, в основном изучались на однолетнем модельном растении Arabidopsis thaliana . Фактор транскрипции MADS box FLOWERING LOCUS C (FLC) является основным регулятором цветения в ответ на яровизацию (Michaels and Amasino, 1999; Sheldon et al., 2000). FLC транскрипционно регулирует гены цветочных интеграторов, такие как SUPPRESSOR OF OVEREXPRESSION OF CONSTANS1 ( SOC1 ), и гены, участвующие в возрастном пути, что предполагает взаимодействие между этими двумя путями (Deng et al. , 2011; Mateos et al. др. , 2017). Сравнительные исследования арабидопсиса и альпийского многолетнего растения Arabis alpina продемонстрировали, что ортолог FLC у A. alpina , ВЕЧНОЕ ЦВЕТЕНИЕ1 ( PEP1 ) также контролирует цветение в ответ на яровизацию.Кроме того, PEP1 способствует многолетнему росту, подавляя цветение в подмножестве пазушных меристем после яровизации (Wang et al. , 2009; Lazaro et al. , 2018). Цветочные почки A. alpina образуются при длительном нахождении в условиях яровизации. Продолжительность яровизации определяет реактивацию ПЭП1 в соцветии. После недостаточной яровизации мРНК PEP1 реактивируется, что приводит к появлению фенотипов реверсии цветков, таких как прицветники и ветви вегетативного соцветия (Lazaro et al., 2018). В подмышечных ветвях продолжительность яровизации не влияет на экспрессию PEP1 , а транскрипт PEP1 является высоким независимо от продолжительности яровизации (Lazaro et al. , 2018). Судьба этих подмышечных ветвей определяется комбинированным действием возрастного пути и PEP1 (Wang et al. , 2011; Park et al. , 2017).

У Arabidopsis возрастной путь регулируется двумя miRNA и их мишенями.В молодом возрасте высокие уровни miRNA 156 (miR156) препятствуют цветению. По мере того как растения стареют, накопление miR156 постепенно снижается, тогда как уровни miR172 следуют противоположному паттерну и постепенно увеличиваются во время развития (Wu et al. , 2009). Биологическая функция miR156 осуществляется его мишенями, которые кодируют членов семейства транскрипционных факторов SQUAMOSA PROMOTER BINDING PROTEIN-LIKEs (SPL) (Schwab et al. , 2005; Wu and Poethig, 2006; Wu et al. , 2009; Xu et al., 2016). Исходя из этого, SPL9 и SPL15, как сообщается, активируют транскрипцию miRNA172b , которая, в свою очередь, подавляет экспрессию небольшого подсемейства APETALA2-подобных факторов транскрипции с помощью механизма трансляции (Aukerman and Sakai, 2003; Chen, 2004; Mathieu и др. , 2009; Wu и др. , 2009; Hyun и др. , 2016). Это подсемейство включает шесть членов: AP2, ЦЕЛЬ РАННЕЙ АКТИВАЦИИ, TAGGED1–3 (TOE1 – TOE3), SCHLAFMUTZE (SMZ) и SCHNARCHZAPFEN (SNZ) (Aukerman and Sakai, 2003; Schmid et al., 2003; Mathieu et al. , 2009 г .; Янт и др. , 2010). Arabis alpina имеет ярко выраженную ювенильную фазу, и образец Pajares должен расти в течение как минимум 5 недель в течение длинных дней (LD), прежде чем он сможет зацвести в ответ на яровизацию (Wang et al. , 2011; Bergonzi и др., , 2013). Роль miR156 сохраняется в A. alpina , поскольку линии с повышенной экспрессией miR156b блокируют цветение в ответ на яровизацию, тогда как линии мимикрии (MIM156), используемые для снижения активности miRNA, цветут при яровизации в возрасте 3 недель (Bergonzi et al., 2013). Однако комплементарное временное накопление miR156 и miR172 во время развития не связано у A. alpina (Bergonzi et al. , 2013). Подобно A. thaliana , накопление miR156 снижено в верхушке побега растений A. alpina , которые стареют и приобретают способность цвести в течение долгих дней, но экспрессия miR172 низкая (Bergonzi et al. , 2013). Чтобы наступило цветение и наблюдали повышение уровня miR172 на верхушке побега, необходима яровизация (Bergonzi et al., 2013). Однако яровизация эффективна только для зрелых (старых) растений, но не для ювенильных (молодых) растений, которые все еще имеют высокие уровни miR156 (Bergonzi et al. , 2013). Начало цветения во время холода у зрелых растений коррелирует с постепенным увеличением экспрессии генов идентичности органов цветка LEAFY ( AaLFY ), FRUITFUL ( AaFUL ) и APETALA1 (32 AaAP1). Лазаро и др. , 2018).У многолетних растений, таких как яблоня и тополь, гомологи репрессора цветов TERMINAL FLOWER1 ( TFL1 ) регулируют ювенильный период. Трансгенные линии Malus domestica и Populus trichocarpa со сниженной экспрессией TFL1 имеют укороченную ювенильную фазу (Kotoda et al. , 2006; Mohamed et al. , 2010). Точно так же трансгенные растения A. alpina , в которых экспрессия AaTFL1 была снижена, могут цвести, даже если они яровизированы в молодом возрасте (Wang et al., 2011). Интересно, что эти линии могут зацвести после короткого (6 недель вместо 12 недель) периода яровизации. Эти результаты снова предполагают взаимодействие между возрастом и путями яровизации.

У Arabidopsis AP2 влияет на множество процессов развития, включая время цветения в зависимости от возраста и развитие цветков (Yant et al. , 2010). Сильные рецессивные мутантные аллели ap2 , такие как ap2-12 , цветут рано как в LD, так и в короткие дни (SD) (Yant et al., 2010). Точно так же поражения в ортологе A. alpina из AP2 , PEP2 , как сообщается, имеют фенотип времени цветения (Bergonzi et al. , 2013). pep2 Мутанты цветут без яровизации и демонстрируют скомпрометированные многолетние признаки, аналогичные мутантным растениям pep1-1 (Bergonzi et al. , 2013). Эффект PEP2 на цветение сначала был связан с путем яровизации, поскольку он способствует экспрессии PEP1 (Bergonzi et al., 2013). В двухнедельных проростках pep2-1 уровни транскрипта PEP1 снижены по сравнению с растениями дикого типа (Bergonzi et al. , 2013). Однако PEP2 также играет независимую от PEP1 роль в регуляции времени цветения у A. alpina , поскольку цветение ускоряется у двойного мутанта pep1-1 pep2-1 по сравнению с одиночными мутантами (Bergonzi и др., , 2013).

Здесь мы показываем, что во время яровизации PEP2 репрессирует экспрессию генов идентичности меристемы цветков AaFUL , AaLFY и AaAP1 .Яровизация ускоряет цветение молодых растений pep2-1 , что указывает на то, что PEP2 регулирует возрастную реакцию на яровизацию. Кроме того, мы сообщаем, что PEP1 -зависимая роль PEP2 имеет место после яровизации, потому что PEP2 требуется для активации PEP1 после возврата к теплым температурам. Участие PEP2 в двух различных аспектах реакции яровизации способствует многолетнему жизненному циклу A.Альпина .

Материалы и методы

Растительный материал, условия роста и фенотипирование

Генотипы A. alpina , использованные в этом исследовании, представляли собой Pajares (дикий тип), мутант pep2-1 и мутант pep1-1 . Образец Pajares был собран в горах Cordillera Cantábrica в Испании на высоте 1400 м (42 ° 59’32”N, 5 ° 45’32”W). Как мутант pep2-1 , так и мутант pep1-1 были выделены в результате мутагенеза EMS (этилметансульфонат) на фоне Pajares (Wang et al., 2009 г .; Bergonzi et al ., 2013; Nordstrom et al ., 2013). Для фенотипического анализа растения выращивали в ЛД (16 часов света и 8 часов темноты) при температуре от 20 ° C днем ​​до 18 ° C ночью. Все яровизированные обработки проводили при 4 ° C в условиях стандартного отклонения (8 часов света и 16 часов темноты).

Время цветения молодых растений дикого типа, pep2-1 и pep1-1 оценивали как количество листьев при цветении и как количество дней до первого открытого цветка после яровизации.Растения выращивали в течение 3 недель в шкафах LD, яровизировали в течение 12 недель и возвращали в камеры LD после холода.

Характеристика времени цветения и признаков соцветия с разной продолжительностью яровизации у мутанта pep2-1 была проведена вместе с диким типом и мутантом pep1-1 в эксперименте, ранее опубликованном (рис. 6 в Lazaro et al. др. , 2018). Те же данные для контрольных растений дикого типа были использованы в Lazaro et al. (2018).Растения выращивали в течение 5 недель в теплице LD, яровизировали в течение 8, 12, 18 и 21 недель и возвращали в условия теплицы LD в тот же день. Время цветения измеряли, записывая дату раскрытия первого цветка после яровизации. Количество цветущих и вегетативных ветвей, а также количество прицветников в соцветии измеряли в конце цветения, за исключением растений, яровизированных в течение 8 недель, когда измерения проводились через 14 недель после яровизации.

Используемые здесь генотипы Arabidopsis были Columbia-0 (Col-0) дикого типа, ap2-7 и Col FRI San Feliu-2 (Sf-2) (Lee and Amasino, 1995).Мутант ap2-7 был скрещен с Col FRI Sf-2, и растения FRI ap2-7 были выделены из самоопыленного потомства F 2 , которое показало гомеотические дефекты ap2 и позднее цветение.

Для экспериментов по продолжительности цветения Arabidopsis общее количество листьев (розеточных и стеблевых листьев) подсчитывали в момент раскрытия первого цветка.

Конструирование плазмид и трансформация растений

Чтобы получить трансгенное растение ap2-7 PEP2 –VENUS, a 7.Геномную область размером 4 т.п.н. PEP2 , охватывающую 4 т.п.н. выше начала трансляции и 1195 п.н. ниже остановки трансляции, клонировали с помощью ПЦР (номер доступа NCBI LT669794.1). Впоследствии кодирующая последовательность VENUS: 9Ala была вставлена ​​либо после ATG, либо перед кодоном STOP PEP2 с использованием метода неполного удлинения праймера полимеразой (PIPE) (Klock et al. , 2008). Праймеры, используемые для клонирования PIPE, суммированы в дополнительной таблице S1 на сайте JXB онлайн.Сгенерированные фрагменты рекомбинантной ДНК были интегрированы в бинарный вектор pEarlyGate301 и трансформированы в Col с помощью опосредованного Agrobacterium цветка (Clough and Bent, 1998). Отобранные гомозиготные линии Col ProPEP2 :: VENUS :: PEP2 N6-1-3 и Col ProPEP2 :: PEP2 :: VENUS C2-1-9 были скрещены с ap2-7 .

Анализ экспрессии генов

Анализ экспрессии гена

проводили на генах дикого типа, pep1-1, и pep2-1. Для образцов pep2-1 гомозиготные растения были отобраны после генотипирования из сегрегационной популяции с использованием расщепленного амплифицированного полиморфного (CAP) маркера (прямой праймер, CAGCTGCACGGTATGTTTTTC; обратный праймер, GCTTTGTCATAAGCCCTGTGde 1) и 1 Idestion.

Для анализа паттерна экспрессии PEP1 дикого типа и pep2-1 выращивали в течение 6 недель в LD и яровизировали в течение 12 недель. Верхушки основных побегов собирали перед яровизацией, во время яровизации и после яровизации (через 1, 2, 3 и 4 недели после возвращения растений к теплым температурам).Подмышечные вегетативные верхушки собирали с растений, растущих в ЛД через 2, 3 и 4 недели после яровизации. В каждом образце было объединено в среднем 10 вершин.

Экспрессия транскриптов PEP1 , AaSOC1 , AaFUL , AaTFL1 , AaLFY и AaAP1 транскриптов в молодых и взрослых транскриптах 32 pep1 и 32-1 32-1 -1 был обнаружен в проростках, выращенных в течение 3 недель (молодые) или 6 недель (взрослые) в LD и яровизированных в течение 12 недель.Верхушки основных побегов собирали перед яровизацией и в холодное время года на 4, 8 и 12 неделях яровизации. Для анализа AaSPL5 , AaSPL9 , AaSPL15 и miR156 верхушка главного побега была собрана с 3-, 4- и 6-недельных растений дикого типа и pep2-1 растений, растущих в LD. . В каждом образце было объединено в среднем 14 вершин. Уровни экспрессии были нормализованы как для AaPP2A , так и для AaRAN3 , за исключением miR156, который был нормализован до SnoR101.

Экспрессию транскрипта FLC анализировали в верхушке побега растений FRI и FRI ap2-7 , выращенных в течение 10 дней перед яровизацией, в течение 40 дней яровизации и 10 дней и 20 дней после возвращения к яровизации. Условия теплицы LD. Уровни экспрессии были нормализованы до UBC21 . Общую растительную РНК экстрагировали с помощью набора RNeasy Plant Mini (Qiagen), а обработку ДНКазой выполняли с помощью набора Ambion, не содержащего ДНК (Invitrogen), для уменьшения любого загрязнения ДНК.Тотальную РНК (1,5 мкг) использовали для синтеза кДНК посредством обратной транскрипции с использованием обратной транскриптазы SuperScript II (Invitrogen) и oligo dT (18) в качестве праймера. Аликвоту 2 мкл разведения кДНК (1: 5) использовали в качестве матрицы для каждой количественной ПЦР (qPCR). Для анализа miR156 и SPL s общая РНК экстрагировалась с использованием miRNeasy ® Mini Kit (Qiagen), а обработка ДНКазой выполнялась с помощью набора Ambion DNA-Free (Invitrogen) для уменьшения загрязнения ДНК. Аликвоту РНК 200 нг использовали для обратной транскрипции miR156 и SnoR101 с использованием праймеров, специфичных для miR156 и SnoR101.qPCR выполняли с использованием системы реального времени CFX96 и CFX384 (Bio-Rad) и системы детекции iQ SYBR Green Supermix. Каждая точка данных была получена из двух или трех независимых биологических повторов и показана как среднее ± стандартное отклонение.

Праймеры, использованные для кПЦР для PEP1 , AaSOC1 , AaFUL , AaTFL1 , AaLFY , AaAP1 1 AaSPL1 AaSPL5 9023 AaAP1 AaSPL5 902A32, AaSPL5 902A32, AaSPL5 902A32, , miR156 и SnoR101 были описаны ранее (Wang et al., 2009, 2011; Bergonzi et al., 2013; Mateos et al. , 2017; Lazaro et al. , 2018). Праймеры, используемые для кПЦР для FLC и UBC21 , также были описаны в другом месте (Chechowski et al. , 2005; Crevillen et al. , 2013).

Статистический анализ

Статистический анализ был выполнен с использованием программного обеспечения R. Чтобы обнаружить существенные различия в экспрессии генов, мы установили коэффициент ложного обнаружения (FDR), равный 0.05 при проведении множественных попарных сравнений с использованием скорректированных по Бенджамини – Хохберга значений P . Процедуры со значительными различиями обозначаются буквами или звездочками. Для физиологического анализа pep2-1 мы провели несколько попарных тестов Бонферрони (α = 0,05) для выявления значительных различий между диким типом и pep2-1 . Здесь непараметрический тест не может быть проведен из-за связей, созданных во время присвоения ранга.

RNAseq анализ

Для анализа дифференциальной экспрессии генов мы использовали метод секвенирования РНК (RNAseq) на верхушках 3-недельного дикого типа и мутантов pep2-1 и pep1-1 . pep2-1. гомозиготных растений генотипировали из сегрегационной популяции с использованием маркера CAP, описанного выше. РНК выделяли, как описано выше, и полную целостность РНК подтверждали на Agilent BioAnalyzer. Подготовка библиотеки и секвенирование были выполнены в Центре генома Макса Планка в Кельне, Германия (https://mpgc.mpipz.mpg.de/home/). RNAseq выполняли с тремя биологическими повторами на образец. Библиотеки готовили из 1 мг тотальной РНК с использованием набора TruSeq RNA (Illumina) и секвенировали односторонние чтения 100 пар оснований на HiSeq2500 (Illumina).Считывания из всех образцов были картированы на эталонном геноме A. alpina (Willing et al. , 2015) с использованием TopHat (Trapnell et al. , 2009) с параметрами по умолчанию. Впоследствии CuffDiff (Trapnell et al. , 2010) использовался для оценки уровня мРНК каждого гена путем вычисления количества фрагментов на килобазу модели экзона на миллион отображенных считываний (FPKM). Для расчета дифференциальной экспрессии генов среди образцов использовали значения FPKM. Log 2 -кратное изменение (L 2 FC) ≥1 для генов с повышенной регуляцией и L 2 FC ≤ –1 для генов с пониженной регуляцией, оба имеют значение q (скорректировано P – значение) ≤0.05, был использован для дальнейшего анализа.

Обогащение онтологии генов

(GO) было выполнено с помощью подключаемого модуля BiNGO (Maere et al. , 2005), реализованного в Cytoscape V3.5.1 (Cline et al. , 2007). Для определения обогащенных генов применялся гипергеометрический тест, а для ограничения количества ложноположительных результатов выполнялась коррекция FDR Бенджамини-Хохберга (Benjamini and Hochberg, 1995). FDR был установлен на 0,05.

Данные о секвенировании этого исследования были депонированы в Gene Expression Omnibus (GEO) под номером доступа GSE117977.Последовательности изученных генов можно найти в базах данных GenBank / EMBL под следующими номерами доступа: PEP2 (AALP_AA7G245300), кДНК PEP1 (FJ755930), кодирующая последовательность AaLFY (кодирующая последовательность JF43623956), (JF436957), AaAP1 (KFK41337.1), кодирующая последовательность AaTFL1 (JF436953) и AaFUL (KFK27856.1).

Результаты

PEP2 влияет на экспрессию генов, участвующих во многих физиологических реакциях растений и ответах на развитие, включая цветение

Для обзора роли PEP2 в A.alpina мы провели анализ RNAseq. Мы сравнили транскриптомы верхушек 3-недельных мутантов pep2-1 и pep1-1 с диким типом (Pajares). Трехнедельные растения дикого типа и мутантные растения являются вегетативными и не претерпели перехода к цветению (Wang et al. , 2011; Bergonzi et al. , 2013; Park et al. , 2017; Lazaro и др. , 2018). Среди транскриптомов большинство дифференциально экспрессируемых генов было обнаружено в pep2-1 .В общей сложности 253 гена были активированы, а 223 гена были подавлены в pep2-1 по сравнению с диким типом (фиг. 1A, B; дополнительный набор данных S1). Напротив, только 47 генов были активированы, а 98 генов подавлены в pep1-1 по сравнению с диким типом (рис. 1A, B; дополнительный набор данных S2). Гены, по-разному экспрессируемые между pep1-1 и диким типом, находятся под влиянием PEP1 , тогда как на гены, дифференциально экспрессируемые между pep2-1 и диким типом, влияет PEP2 через как PEP1, -зависимый, так и гены. PEP1 -независимый путь.Чтобы идентифицировать гены, на которые влияет PEP2 через PEP1 -независимый путь, мы сравнили транскриптомы pep2-1 с pep1-1 (рис. 1C, D; дополнительный набор данных S3). В общей сложности 504 гена были значительно активированы, а 251 ген был значительно подавлен в pep2-1 по сравнению с pep1-1 (фиг. 1C, D). Интересно, что количество дифференциально экспрессируемых генов, обнаруженных между pep2-1 и pep1-1 , было выше, чем количество генов, обнаруженных при сравнении отдельных мутантов с диким типом.Анализ GO показал, что наиболее обогащенной категорией для активированных генов в pep2-1 по сравнению с диким типом и в pep2-1 по сравнению с pep1-1 был биосинтез глюкозинолатов, которые участвуют в защите против нападения травоядных и патогенов (дополнительный рисунок S1) (Keith and Mitchell-Olds, 2017). Перекрытие в чрезмерно представленных категориях ГО в наборе генов, активируемых в pep2-1 по сравнению либо с диким типом, либо с мутантом pep1-1 , было очень высоким, чего следовало ожидать, поскольку было больше генов. В pep2-1 активирована повышенная регуляция по сравнению с диким типом, чем в pep1-1 по сравнению с диким типом (рис.1А; Дополнительный рис. S1A, B). Среди обычно обогащенных категорий генов с пониженной регуляцией в pep2-1 мы обнаружили апоптоз и десумоилирование белка (дополнительный рисунок S1C, D).

Рис. 1.

Дифференциально экспрессируемые гены у мутантов pep2 и pep1 A. alpina . (A и B) Диаграмма Венна для значительно активированных (A) и подавленных (B) генов в pep2-1 по сравнению с диким типом (WT) и pep1-1 по сравнению с WT.(C и D) Диаграмма Венна для значительно активированных (C) и подавленных (D) генов в pep2-1 по сравнению с WT и в pep2-1 по сравнению с pep1-1. (E – G) Гены времени цветения по-разному экспрессируются в pep2-1 по сравнению с WT (E), pep1-1 по сравнению с WT (F) и pep2-1 по сравнению с pep1-1 (G). Значения экспрессии основаны на RNAseq.

Рис. 1.

Дифференциально экспрессируемые гены в pep2, и pep1 A.alpina мутанты. (A и B) Диаграмма Венна для значительно активированных (A) и подавленных (B) генов в pep2-1 по сравнению с диким типом (WT) и pep1-1 по сравнению с WT. (C и D) Диаграмма Венна для значительно активированных (C) и подавленных (D) генов в pep2-1 по сравнению с WT и в pep2-1 по сравнению с pep1-1. (E – G) Гены времени цветения по-разному экспрессируются в pep2-1 по сравнению с WT (E), pep1-1 по сравнению с WT (F) и pep2-1 по сравнению с pep1-1 (G).Значения экспрессии основаны на RNAseq.

Цветочные активаторы и репрессоры были идентифицированы среди дифференциально экспрессируемых генов в pep2-1 . Например, ортолог A. alpina из SOC1 ( AaSOC1 ) был активирован в pep2-1 по сравнению с диким типом (фиг. 1E; дополнительный набор данных S1). Этот эффект PEP2 на AaSOC1 осуществляется через PEP1 , поскольку AaSOC1 дифференциально экспрессировался между pep1-1 и диким типом, но не в pep2-1 по сравнению с pep1-1 (фиг.1F, G; Дополнительные наборы данных S2, S3; Mateos et al , 2017). Регламент AaSMZ PEP2 отличается от регламента PEP1 . AaSMZ был активирован в pep2-1 по сравнению с диким типом и подавлен в pep1-1 по сравнению с диким типом (фиг. 1E, F; дополнительные наборы данных S1, S2). Напротив, AaSPL15 был активирован в мутанте pep1-1 по сравнению с диким типом, а не в pep2-1 по сравнению с диким типом, что указывает на то, что PEP2 не контролирует экспрессию AaSPL15 ( Инжир.1E, F; Дополнительные наборы данных S1, S2). Среди генов времени цветения, вовлеченных в PEP1 -независимую роль PEP2 , были цветочные репрессоры AaTFL1 и AGAMOUS-LIKE 19 ( AaAGL19 ). AaTFL1 подавлялся, когда мы сравнивали pep2-1 как с диким типом, так и с pep1-1 , предполагая, что эффект PEP2 на AaTFL1 не зависит от PEP1 (рис. 1E– G; Дополнительные наборы данных S1 – S3).Сходным образом транскрипты AGAMOUS-LIKE 19 ( AaAGL19 ) специфически подавлялись в мутанте pep2-1 (Fig. 1E-G; Supplementary Datasets S1-S3). Мы также обнаружили, что ортолог AaULP1c (убиквитин-подобная протеиназа), кодирующий протеазу SUMO, и CIS-CINNAMIC ACID-ENHANCED 1 ( AaZCE1 ) дифференциально специфично экспрессируется в pep2-1 (рис. 1C – E; дополнительные наборы данных S1, S2). Интересно, что и ULP1c , и ZCE1 у Arabidopsis контролируют цветение через FLC .Мутации в ULP1c и его гомологе ULP1d у Arabidopsis вызывают фенотип раннего цветения, который, по крайней мере частично, может быть обусловлен подавляющей регуляцией FLC (Conti et al. , 2008; Castro et al. , 2016). ZCE1 участвует в регуляции роста и развития растений с помощью цис- -фенилпропаноидов, и было показано, что он контролирует время закрепления посредством усиления экспрессии FLC (Guo et al. , 2011).

PEP2 может дополнять мутант Arabidopsis ap2

Как мутант pep2 у A. alpina , так и мутант ap2 у Arabidopsis демонстрируют раннее цветение и аналогичные дефекты цветков, включая отсутствие лепестков и трансформацию чашелистиков в плодолистики (Bowman et al. , 1991 ; Bergonzi et al., 2013; Nördstrom et al. , 2013). Чтобы проверить, имеют ли оба гена общие функции, мы экспрессировали PEP2 на мутантном фоне ap2-7 под контролем его собственного промотора.Мы слили геномную область 7,4 т.п.н. PEP2 , охватывающую 4 т.п.н. выше начала трансляции и 1,2 т.п.н. ниже остановки трансляции, с флуоресцентным белком VENUS на N- или C-конце. Трансгенные линии были впервые получены на фоне Col. Гомозиготные линии, полученные для N-концевой VENUS (Col ProPEP2 :: VENUS :: PEP2 N6-1-3) и C-концевой VENUS (Col ProPEP2 :: PEP2 :: VENUS C2-1-9), были впоследствии перешел на ap2-7 . При выращивании в SD конструкции PEP2 дополняли фенотип раннего цветения мутанта ap2-7 (рис.2A – D). Более того, гомеотические дефекты мутанта ap2 были восстановлены с помощью PEP2 , что указывает на то, что ген A. alpina PEP2 контролирует время цветения и идентичность органов цветка аналогично AP2 (рис. 2E – H). .

Рис. 2.

PEP2 может дополнять цветущий и цветочный фенотип мутанта Arabidopsis ap2-7 . (A и B) Фенотипы Col дикого типа, мутант ap2-7 , Col ProPEP2 :: VENUS :: PEP2 N6-1-3 и ap2-7 ProPEP2 :: VENUS :: PEP2 Линии N6-1-3, выращенные в SD (A), и количество цветущих листьев (B).(C и D) Col, мутант ap2-7 , Col ProPEP2 :: PEP2 :: VENUS C2-1-9 и ap2-7 ProPEP2 :: PEP2 :: VENUS C2-1- 9 линий, выращенных в SD (C) и количество цветущих листьев (D). (A и C) Фотографии всего растения были сделаны через 57 дней после прорастания (DAG). Масштабная линейка = 3 см. В (B) и (D) буквы обозначают значимые различия между генотипами, определенные путем множественных попарных сравнений с использованием скорректированных по Бенджамини – Хохберга значений P (значение a 0,05).Планки погрешностей указывают стандартное отклонение. (E и F) Соцветие Col дикого типа (E) ap2-7 (F), ap2-7 ProPEP2 :: VENUS :: PEP2 N6-1-3 (G) и ap2-7 ProPEP2: : PEP2 :: VENUS C2-1-9 (H) записано 73 DAG в SD.

Рис. 2.

PEP2 может дополнять цветущий и цветочный фенотип мутанта Arabidopsis ap2-7 . (A и B) Фенотипы Col дикого типа, мутант ap2-7 , Col ProPEP2 :: VENUS :: PEP2 N6-1-3 и ap2-7 ProPEP2 :: VENUS :: PEP2 Линии N6-1-3, выращенные в SD (A), и количество цветущих листьев (B).(C и D) Col, мутант ap2-7 , Col ProPEP2 :: PEP2 :: VENUS C2-1-9 и ap2-7 ProPEP2 :: PEP2 :: VENUS C2-1- 9 линий, выращенных в SD (C) и количество цветущих листьев (D). (A и C) Фотографии всего растения были сделаны через 57 дней после прорастания (DAG). Масштабная линейка = 3 см. В (B) и (D) буквы обозначают значимые различия между генотипами, определенные путем множественных попарных сравнений с использованием скорректированных по Бенджамини – Хохберга значений P (значение a 0,05).Планки погрешностей указывают стандартное отклонение. (E и F) Соцветие Col дикого типа (E) ap2-7 (F), ap2-7 ProPEP2 :: VENUS :: PEP2 N6-1-3 (G) и ap2-7 ProPEP2: : PEP2 :: VENUS C2-1-9 (H) записано 73 DAG в SD.

Чтобы проверить, сохраняется ли эффект PEP2 на экспрессию PEP1 в Arabidopsis для AP2 и FLC , мы объединили мутацию ap2-7 с сильным аллелем FRI из San Feliu- 2 (Sf-2), который усиливает экспрессию Col FLC .Хотя мутация ap2 ускоряла цветение на фоне FRI Sf-2, экспрессия FLC не изменялась в верхушках этих растений на разных стадиях развития (до, во время или после 40 дней яровизации) ( Дополнительный рис. S2). Эти результаты показывают, что, хотя роль AP2 и PEP2 в отношении регуляции времени цветения и идентичности цветковых органов сохраняется, AP2 не контролирует экспрессию FLC на фоне FRI Sf-2 (дополнительный рис.S2B).

PEP2 контролирует возрастную реакцию A. alpina на яровизацию

Затем мы исследовали, является ли PEP1 -независимая роль PEP2 сходной с ролью AP2 у Arabidopsis и, следовательно, регулирует ли он цветение по возрастному пути. Сначала мы проанализировали накопление miR156 и уровень транскрипта A. alpina SPL5 , 9 и 15 ( AaSPL5, 9 и 15 ) в вершинах pep2-1 и проростки дикого типа, выращенные в течение 3, 4 и 6 недель в LD (дополнительный рис.S3). Накопление miR156 в верхушке побега снижалось у более старых проростков, но сходная картина наблюдалась у pep2-1 и дикого типа (дополнительный рисунок S3A). Уровни транскриптов AaSPL5 , 9 и 15 увеличивались по мере старения растений (дополнительный рис. S3B – D). Для AaSPL5 и 15 мы не наблюдали значительных различий между pep2-1 и диким типом, тогда как уровни мРНК AaSPL9 различались между двумя генотипами только у 6-недельных проростков (дополнительный рис.S3B – D). Эти результаты согласуются с предыдущими исследованиями на Arabidopsis, демонстрирующими, что AP2 контролирует цветение по возрастному пути ниже генов miR156 и SPL . Поскольку ранее было показано, что возрастное влияние на цветение у A. alpina проявляется только после яровизации (Wang et al. , 2011; Bergonzi et al. , 2013), мы проверили, соответствует ли PEP2 играет возрастную роль у яровизированных растений. Для этого мы яровировали 3-недельные проростки дикого типа и pep2-1 в течение 12 недель и измерили время цветения после возвращения к теплым температурам.Мы также включили в этот эксперимент мутант pep1-1 , чтобы исключить PEP1 -зависимый эффект PEP2 на время цветения. Согласно предыдущим исследованиям, в этих условиях дикий тип не цвел после яровизации, а рос только вегетативно (рис. 3; Wang et al. , 2011; Bergonzi et al ., 2013). Интересно, что pep2-1 цветет в среднем с 18 листьями и через 17 дней после яровизации, тогда как яровизированный pep1-1 цветет с 27 листьями, аналогично не яровизированным растениям pep1-1 , непрерывно выращиваемым в LD (рис.3; Дополнительный рис. S4; Wang et al. , 2009 г .; Bergonzi et al. , 2013). Эти данные позволяют предположить, что яровизация ускоряет цветение у молодых растений pep2-1 , но не у растений pep1-1 . Фенотип времени цветения у мутантов также отличается от фенотипа LDs, когда pep1-1 цветет раньше, чем pep2-1 (Bergonzi et al. , 2013). В целом, эти результаты предполагают, что PEP2 регулирует зависимый от возраста ответ на яровизацию PEP1 -независимым образом.

Рис. 3.

PEP2 регулирует возрастную реакцию A. alpina на яровизацию. (A) Изображение 3-недельного дикого типа (WT), pep1-1 и pep2-1 , яровизированных в течение 12 недель с последующими 2 неделями в LD. Масштабная линейка = 5 см. (B) Время цветения показано как количество листьев при цветении 3-недельного WT, pep1-1 и pep2-1 , яровизированных в течение 12 недель. WT не цвести (NF).Звездочка означает значительную разницу в общем количестве листьев, определенную с помощью теста Стьюдента t (значение P <0,01). Планки погрешностей указывают стандартное отклонение.

Рис. 3.

PEP2 регулирует возрастную реакцию A. alpina на яровизацию. (A) Изображение 3-недельного дикого типа (WT), pep1-1 и pep2-1 , яровизированных в течение 12 недель с последующими 2 неделями в LD. Масштабная линейка = 5 см. (B) Время цветения показано как количество листьев при цветении 3-недельного WT, pep1-1 и pep2-1 , яровизированных в течение 12 недель.WT не цвести (NF). Звездочка означает значительную разницу в общем количестве листьев, определенную с помощью теста Стьюдента t (значение P <0,01). Планки погрешностей указывают стандартное отклонение.

Чтобы понять, как молодые растения pep2-1 ускоряют цветение в ответ на яровизацию, мы проанализировали экспрессию PEP1 , AaSOC1 , AaFUL , AaTFL1 , AaLFY a и a.Трехнедельные верхушки дикого типа pep2-1 и pep1-1 с главного побега собирали до и во время яровизации на 4, 8 и 12 неделях. В соответствии с предыдущими результатами, полученными на проростках, неяровизированные трехнедельные растения pep2-1 показали более низкие уровни мРНК PEP1 , чем у дикого типа (рис. 4A; Bergonzi et al. , 2013). Тем не менее, транскрипт PEP1 снижался аналогичным образом в pep2-1 и растениях дикого типа, а PEP1 заглушался через 4 недели на холоду (рис.4А). Эти данные позволяют предположить, что, несмотря на первоначальное различие в экспрессии PEP1 , отсутствие PEP2 не влияет на транскрипцию PEP1 в молодых вершинах во время яровизации. Экспрессия AaSOC1 постепенно повышалась во время яровизации, следуя той же схеме для трех генотипов (рис. 4B). Напротив, AaFUL , AaLFY и AaAP1 показали дифференциальное увеличение у дикого типа и мутантов через 8 и 12 недель яровизации (рис.4C, E, F). В молодых растениях дикого типа уровни мРНК AaFUL , AaLFY и AaAP1 не повышались, что указывает на то, что цветение еще не началось (рис. 4C, E, F). Более того, мутант pep2-1 показал более высокие уровни AaLFY и AaAP1 , чем pep1-1 после 12 недель яровизации (фиг. 3, 4E, F). Интересно, что мутант pep2-1 также показал сниженную экспрессию AaTFL1 в конце обработки холодом по сравнению с pep1-1 (рис.4D). Взятые вместе, наши результаты показывают, что PEP2 активирует AaTFL1 и репрессирует AaFUL , AaLFY и AaAP1 в молодых вершинах во время яровизации (рис. 3). Эта роль PEP2 не зависит от PEP1 , учитывая, что pep1-1 растений, яровизированных в молодом возрасте, зацвело позже, чем pep2-1 , и что экспрессия PEP1 была снижена в той же степени у дикого типа. и pep2-1 во время яровизации (Фиг.3, 4A).

Рис. 4.

PEP2 регулирует экспрессию AaFUL , AaTFL1 , AaLFY и AaAP1 во время яровизации. Относительная экспрессия PEP1 (A), AaSOC1 (B), AaFUL (C), AaTFL1 (D), AaLFY (E) и AaAP1 (F). Верхушки побегов трехнедельного дикого типа (WT) pep1-1 и pep2-1 собирали до и в течение 12 недель яровизации.Буквы обозначают значительные различия между WT, pep1-1 и pep2-1 в каждый момент времени, определяемый множественными попарными сравнениями с использованием скорректированных по Бенджамини – Хохберга значений P (α-значение 0,05). Графики без букв не показывают существенных различий. Планки погрешностей указывают стандартное отклонение.

Рис. 4.

PEP2 регулирует экспрессию AaFUL , AaTFL1 , AaLFY и AaAP1 во время яровизации.Относительная экспрессия PEP1 (A), AaSOC1 (B), AaFUL (C), AaTFL1 (D), AaLFY (E) и AaAP1 (F). Верхушки побегов трехнедельного дикого типа (WT) pep1-1 и pep2-1 собирали до и в течение 12 недель яровизации. Буквы обозначают значительные различия между WT, pep1-1 и pep2-1 в каждый момент времени, определяемый множественными попарными сравнениями с использованием скорректированных по Бенджамини-Хохберга значений P (α-значение 0.05). Графики без букв не показывают существенных различий. Планки погрешностей указывают стандартное отклонение.

Чтобы выяснить, консервативна ли регуляция этих генов идентичности меристем цветков с помощью PEP2 у взрослых растений, мы проверили экспрессию AaFUL , AaLFY и AaAP1 во время яровизации. Шестинедельные растения дикого типа и растения pep2-1 подвергались 12-недельному воздействию холода, и уровни мРНК AaLFY , AaAP1 и AaFUL анализировали в верхушке побега перед яровизацией и 1, Через 3, 5, 8 и 12 недель яровизации.Уровни мРНК AaFUL были выше у pep2-1 , чем у дикого типа уже после 8 недель яровизации (дополнительный рисунок S4A). Для экспрессии AaLFY и AaAP1 значительное увеличение наблюдалось у мутанта pep2-1 только в конце 12 недель холода (дополнительный рис. S4B, C). В целом, эти результаты предполагают, что PEP2 задерживает цветение, подавляя AaFUL , AaLFY и AaAP1 в конце 12 недель яровизации, когда PEP1 уже подавлен в верхушках обоих молодых и взрослые растения.

PEP2 необходим для активации экспрессии PEP1 после яровизации

Чтобы проверить PEP1 -зависимую роль PEP2 , мы подвергли мутант pep2-1 и растения дикого типа разной продолжительности яровизации. Оба генотипа выращивали в течение 5 недель в LD, яровизировали в течение 8, 12, 18 и 21 недель и переносили обратно в тепличные условия LD (рис. 5A, B). Мутант pep2-1 показал сокращение количества дней до появления цветков по сравнению с диким типом при любой продолжительности холода (рис.5С). Кроме того, соцветия в pep2-1 показали снижение фенотипов реверсии цветков и усиление приверженности ветвей соцветий к цветению (рис. 5D-G). Эти результаты показывают, что PEP2 контролирует время цветения и архитектуру соцветий у A. alpina . Однако ответ pep2-1 все еще варьировался в зависимости от продолжительности яровизации, предполагая, что другие цветочные репрессоры могут вносить вклад в цветение в ответ на яровизацию.Кроме того, PEP2 необходим для поддержания пазушных отростков, которые расположены чуть ниже соцветия в вегетативном состоянии, поскольку все пазушные ветви мутанта pep2-1 участвуют в репродуктивном развитии (рис. 5; Bergonzi et al. , 2013).

Как было показано ранее для дикого типа, мРНК PEP1 активируется в апикальной меристеме побега главного побега после ненасыщающей яровизации (рис. 6; Wang et al. , 2009; Lazaro et al. al., 2018). Это нестабильное молчание мРНК PEP1 после холода было отменено в мутанте pep2-1 , что позволяет предположить, что PEP2 необходим для активации экспрессии PEP1 в апикальной меристеме побега после недостаточной яровизации (фиг. 6). Роль PEP2 в активации PEP1 после яровизации также наблюдается в подмышечных ветвях. Все пазушные ветви мутанта pep2-1 готовы к цветению (рис.5B) и показали очень низкую экспрессию PEP1 по сравнению с вегетативными ветвями дикого типа (фиг. 6). Эти результаты предполагают, что основной вклад PEP2 заключается в активации транскрипции PEP1 после яровизации как в апикальной меристеме побегов, так и в вегетативных подмышечных ветвях.

Рис. 5.

Мутантные растения pep2 зацветают раньше, чем растения дикого типа, и демонстрируют пониженные ревертированные фенотипы. (A) Растения дикого типа (WT), подвергнутые яровизации в течение нескольких периодов (8, 12, 18 и 21 неделя) с последующими 3 неделями в LD.(B) pep2-1 мутантные растения, подвергнутые яровизации в течение нескольких периодов (8, 12, 18 и 21 неделя) с последующими 3 неделями в LD. Масштабная линейка = 10 см. (C) Время до появления цветков растений WT и pep2-1 , подвергшихся разной продолжительности яровизации, измерялось как количество дней до первого распустившегося цветка. (D) Процент цветущих ветвей соцветий (FB) у WT и мутанта pep2-1 , подвергшихся яровизации в течение 8, 12, 18 и 21 недель в момент раскрытия последнего цветка в соцветии.(E) WT перевернутое соцветие у растений, яровизированных в течение 8 недель. (F) pep2-1 мутантное соцветие в растениях, яровизированных в течение 8 недель. Масштабная линейка = 2 см. (G) Количество прицветников в соцветии WT и мутанта pep2-1 , подвергшихся яровизации в течение 8, 12, 18 и 21 недель во время раскрытия последнего цветка в соцветии. Этот эксперимент был проведен вместе с мутантом pep1-1 в эксперименте, ранее опубликованном (рис. 6 в Lazaro et al., 2018). Данные для контроля WT в двух статьях аналогичны. Звездочки обозначают значительные различия между диким типом и мутантом pep2-1 в каждый момент времени, определенный с помощью множественных попарных тестов Бонферрони (α-значение 0,05). Планки погрешностей указывают стандартное отклонение.

Рис. 5.

Мутантные растения pep2 зацветают раньше, чем растения дикого типа, и демонстрируют пониженные реверсивные фенотипы. (A) Растения дикого типа (WT), подвергнутые яровизации в течение нескольких периодов (8, 12, 18 и 21 неделя) с последующими 3 неделями в LD.(B) pep2-1 мутантные растения, подвергнутые яровизации в течение нескольких периодов (8, 12, 18 и 21 неделя) с последующими 3 неделями в LD. Масштабная линейка = 10 см. (C) Время до появления цветков растений WT и pep2-1 , подвергшихся разной продолжительности яровизации, измерялось как количество дней до первого распустившегося цветка. (D) Процент цветущих ветвей соцветий (FB) у WT и мутанта pep2-1 , подвергшихся яровизации в течение 8, 12, 18 и 21 недель в момент раскрытия последнего цветка в соцветии.(E) WT перевернутое соцветие у растений, яровизированных в течение 8 недель. (F) pep2-1 мутантное соцветие в растениях, яровизированных в течение 8 недель. Масштабная линейка = 2 см. (G) Количество прицветников в соцветии WT и мутанта pep2-1 , подвергшихся яровизации в течение 8, 12, 18 и 21 недель во время раскрытия последнего цветка в соцветии. Этот эксперимент был проведен вместе с мутантом pep1-1 в эксперименте, ранее опубликованном (рис. 6 в Lazaro et al., 2018). Данные для контроля WT в двух статьях аналогичны. Звездочки обозначают значительные различия между диким типом и мутантом pep2-1 в каждый момент времени, определенный с помощью множественных попарных тестов Бонферрони (α-значение 0,05). Планки погрешностей указывают стандартное отклонение.

Рис. 6.

PEP2 необходим для активации экспрессии PEP1 после яровизации. Относительная экспрессия PEP1 в апикальной меристеме побега и в вегетативных подмышечных меристемах дикого типа (WT) и мутанта pep2-1 до, во время и после 12 недель яровизации.Буквы обозначают значимые различия между WT и pep2-1 в каждый момент времени, определяемый множественными попарными сравнениями с использованием скорректированных по Бенджамини – Хохберга значений P (α-значение 0,05). Подробную информацию о существенных различиях можно найти в дополнительной таблице S3. Планки погрешностей указывают стандартное отклонение.

Рис. 6.

PEP2 необходим для активации экспрессии PEP1 после яровизации. Относительная экспрессия PEP1 в апикальной меристеме побега и в вегетативных подмышечных меристемах дикого типа (WT) и мутанта pep2-1 до, во время и после 12 недель яровизации.Буквы обозначают значимые различия между WT и pep2-1 в каждый момент времени, определяемый множественными попарными сравнениями с использованием скорректированных по Бенджамини – Хохберга значений P (α-значение 0,05). Подробную информацию о существенных различиях можно найти в дополнительной таблице S3. Планки погрешностей указывают стандартное отклонение.

Обсуждение

Понимание роли длительного воздействия низких температур на цветение имеет особое значение для многолетних видов, которые перезимуют несколько раз в течение своего жизненного цикла.У многолетников умеренного климата длительное воздействие холода контролирует более поздние стадии цветения, такие как равномерное распускание почек весной, тогда как у альпийских видов оно обеспечивает формирование цветков до того, как растения попадут в благоприятные условия окружающей среды для цветения (Diggle, 1997; Meloche and Diggle, 2001; Lazaro и др. , 2018). Поддержание вегетативного развития после цветения, которое важно для стратегии многолетней жизни, регулируется сезонным циклом репрессоров цветов и дифференциальным ответом меристем на индукционные стимулы цветка из-за возрастных факторов (Wang et al., 2009, 2011; Koskela et al. , 2012). Здесь мы охарактеризовали роль цветочного репрессора A. alpina PEP2 , ортолога Arabidopsis AP2. Предыдущие исследования показали, что PEP2 контролирует цветение посредством PEP1 -зависимого и PEP1 -независимого пути (Bergonzi et al ., 2013). Наш транскриптомный анализ показал, что PEP2 влияет на экспрессию генов, участвующих в нескольких процессах развития.Однако многие из идентифицированных генов могут регулироваться не напрямую с помощью PEP2, а посредством сложных последующих генетических взаимодействий (Fig. 1; Supplementary Fig. S1). Мы также обнаружили, что промоторы и репрессоры цветов по-разному экспрессируются в мутанте pep2 . В Arabidopsis белок AP2 был иммунопреципитирован из промоторной области SOC1 (Yant et al. , 2010). Однако в нашем исследовании эффект PEP2 на AaSOC1 , по-видимому, проявляется через PEP1 (рис.1). Чтобы охарактеризовать роль PEP1 -зависимой и PEP1 -независимой роли PEP2 в цветении, мы также использовали физиологический анализ и проследили экспрессию генов времени цветения и меристемы в течение жизненного цикла A. alpina . Эти данные показали, что PEP2 контролирует (i) возрастную реакцию на яровизацию и (ii) временную смену цветочного репрессора PEP1 , обеспечивая активацию экспрессии PEP1 после яровизации.

PEP2 контролирует возрастную реакцию на яровизацию

PEP2 может спасти фенотип раннего цветения мутанта Arabidopsis ap2-7 , предполагая, что его роль во времени цветения может быть сохранена (рис. 2). В Arabidopsis AP2 посттранскрипционно регулируется miR172, а miR172b помещается в возрастной путь, поскольку он транскрипционно контролируется miR156-мишенями SPL9 и SPL15 (Wu et al., 2009 г .; Hyun et al. , 2016). AP2 также негативно регулирует свою собственную экспрессию, напрямую связываясь со своим собственным геномным локусом, а также с локусами своих регуляторов miR156e , miR172b и FUL , предполагая, что AP2 транскрипционно регулируется множеством петель обратной связи. (Schwab и др. , 2005; Янт и др. , 2010; Balanza и др. , 2018). Белок AP2 был также иммунопреципитирован из хроматина цветочных интеграторов и генов, необходимых для развития цветочной меристемы, таких как SOC1 , AGAMOUS ( AG ) и AP1 (Yant et al., 2010). Транскрипция генов, таких как SOC1 и FUL , также контролируется вышестоящими регуляторами в пути старения. Сообщалось, что SPL9 связывается с первым интроном SOC1 , а SPL15 – с FUL и miR172b (Wang et al. , 2009; Hyun et al. , 2016). В целом, эта сложная генетическая цепь, включающая AP2, может способствовать быстрому жизненному циклу Arabidopsis, в котором переход цветков происходит вскоре после приобретения репродуктивной способности.В отличие от Arabidopsis, у A. alpina репродуктивная способность не связана с началом цветения. Arabis alpina растения становятся способными к цветению после выращивания в течение 5 недель в условиях LD, но начинают цветение только тогда, когда они подвергаются яровизации (Wang et al. , 2009). Это говорит о том, что цветение A. alpina регулируется сильным взаимодействием между возрастом и путями яровизации. Члены семейств SPL и AP2 (e.грамм. AaSPL15 и AaTOE2 ) транскрипционно репрессируются PEP1 в дополнение к посттранскрипционной и посттрансляционной регуляции miRNA (Chen, 2004; Bergonzi et al. ., 2013; Hyun et al. , 2016). ; Сюй и др. , 2016; Матеос и др. , 2017). Хотя FLC у Arabidopsis нацелен на аналогичный набор генов, сильное взаимодействие между возрастом и путем яровизации наиболее очевидно у A. alpina (Deng et al., 2011; Mateos et al. , 2017). Яровизация в A. alpina обеспечивает условия, при которых влияние возраста на цветение становится очевидным, поскольку он заглушает PEP1 . Постепенные изменения в накоплении miR156 и экспрессии генов SPL можно наблюдать в верхушке побега растений A. alpina , которые стареют в LDs (Bergonzi et al ., 2013). Однако накопление нижестоящих регуляторов в пути старения, таких как miR172, увеличивается только на верхушке побега во время яровизации и при переходе от цветков (Bergonzi et al ., 2013). Здесь мы показываем, что экспрессия miR156 и AaSPL5 и 15 не зависит от растений pep2 , выращенных в LDs (Fig. 1E-G; Supplementary Fig. S3). Учитывая, что PEP2 частично действует через PEP1 , отсутствие эффекта pep2-1 на AaSPL15 может быть связано либо с остаточной экспрессией PEP1 в мутанте pep2-1 , либо с существованием компенсаторных генетических механизмов. Интересно, что уровни мРНК AaSPL9 были снижены у 6-недельных проростков pep2-1 по сравнению с проростками дикого типа (дополнительный рис.S3). Этот эффект PEP2 на AaSPL9 , однако, не может быть объяснен петлями обратной связи, описанными в Arabidopsis, поскольку ожидается, что уровни транскрипта AaSPL9 будут выше у pep2-1 , чем у дикого типа (дополнительный рис. S3; Янт и др. , 2010).

Ранее сообщалось, что ортолог A. alpina из TFL1 ( AaTFL1 ) влияет на эффект яровизации в зависимости от возраста, хотя его характер экспрессии не различается между ювенильными и взрослыми верхушками до яровизации ( Wang et al., 2011). Здесь мы показываем, что яровизация ускоряла цветение у молодых проростков pep2-1 по сравнению с pep1-1 , предполагая, что PEP2 также регулирует зависимый от возраста ответ на яровизацию в пути, независимом от PEP1 (рис. 3) . Интересно, что в нашем анализе RNAseq количество транскриптов AaTFL1 было снижено в мутанте pep2-1 , что позволяет предположить, что PEP2 вместе или через AaTFL1 устанавливает возрастной порог для цветения в ответ на яровизацию.Однако одно из основных различий между AaTFL1 и PEP2 заключается в том, что линии с пониженной активностью AaTFL1 не зацветают без яровизации. Эти результаты предполагают, что PEP2 играет дополнительную роль в регуляции времени цветения у A. alpina . Транскриптомные эксперименты на Arabidopsis также показали, что мРНК TFL1 подавляется в соцветиях ap2 по сравнению с диким типом (Yant et al. , 2010).Однако ChIP-Seq не обнаружил прямого связывания AP2 с локусом TFL1 , и поэтому неясно, есть ли прямой или косвенный эффект AP2 на транскрипцию TFL1 (Yant et al. , 2010). .

PEP2 обеспечивает активацию PEP1 после яровизации

Предыдущие исследования на A. alpina показали, что PEP2 контролирует цветение в ответ на яровизацию посредством усиления экспрессии PEP1 (Bergonzi et al ., 2013). Здесь мы показываем, что основная роль PEP2 в активации PEP1 происходит после яровизации. Экспрессия PEP1 в A. alpina временно подавляется во время длительного воздействия холода, чтобы определить судьбу соцветий, в то время как она высоко экспрессируется в пазушных ветвях после яровизации для подавления цветения (Wang et al. , 2009; Lazaro et al. , 2018). Недавно мы показали, что продолжительность яровизации влияет на реактивацию PEP1 в верхушке побега после возвращения к теплым температурам (Lazaro et al., 2018). Фенотипы, коррелированные с высокими уровнями мРНК PEP1 после яровизации (например, реверсия цветков и наличие вегетативных пазушных ветвей), почти отсутствовали у мутанта pep2-1 (рис.5; Lazaro et al. , 2018). Соответственно, уровни мРНК PEP1 были снижены у яровизированных растений pep2-1 по сравнению с диким типом как в стебле соцветия, так и в пазушных ветвях (рис.6; Wang et al. , 2009; Lazaro et al. ., 2018). Эти результаты предполагают, что PEP2 вносит вклад в жизненный цикл многолетнего растения и контролирует характерные для многолетнего растения признаки путем активации PEP1 после яровизации. У Arabidopsis интрогрессия аллеля FRI из образца Sf-2 в Col увеличивает продолжительность низких температур, необходимых для подавления FLC (Searle et al. , 2006). Образцам северного арабидопсиса, таким как Lov-1, требуется несколько месяцев яровизации для достижения сайленсинга FLC и, как и для A.alpina Pajares, более короткая продолжительность низких температур вызывает реактивацию FLC (Shindo et al. , 2006). Связь между AP2 и FLC у Arabidopsis не ясна. AP2 не связывается с локусом FLC в экспериментах ChIP-Seq, и в нашем исследовании экспрессия FLC не была изменена в растениях, где мутантный аллель ap2-7 был интрогрессирован в фон Col FRI Sf-2. (Дополнительный рис. S3; Янт и др., 2010). Однако, поскольку наиболее сильное различие в экспрессии PEP1 в мутанте pep2-1 наблюдалось после яровизации, следует проанализировать влияние AP2 в образце Lov-1, чтобы исключить роль AP2 на . Реактивация FLC после недостаточной яровизации.

Нестабильное молчание FLC включает изменения в накоплении триметилирования h4 по Lys27 (h4K27me3) (Angel et al. , 2011; Coustham et al., 2012). Паттерн метки h4K27me3 в локусе PEP1 также коррелирует с изменениями уровней мРНК PEP1 в A. alpina (Wang et al. , 2009). PEP1 показывает гораздо большее и более широкое увеличение h4K27me3 во время холода, чем FLC , а уровни h4K27me3 быстро снижаются на PEP1 после коротких периодов яровизации (Wang et al. , 2009; Angel et al. , 2011; Лазаро и др. , 2018).Хотя белки, регулирующие модификации гистонов в локусе PEP1 , неизвестны, сброс эпигенетической памяти FLC у Arabidopsis зависит от присутствия компонентов TrxG и деметилаз, содержащих домен Jumonji C (JmjC) EARLY FLOWERING 6 ( ELF6) и РОДСТВЕННИК РАННЕГО ЦВЕТАНИЯ 6 (REF6) (Noh et al. , 2004; Yun et al. , 2011; Crevillen et al ., 2014). Было показано, что AP2 обладает способностью взаимодействовать с фактором ремоделирования хроматина HISTONE DEACETYLASE 19 (HDA19) для транскрипционной репрессии одной из своих мишеней (Krogan et al., 2012), но AP2 никогда не был связан с гистоновыми деметилазами.

Мы недавно продемонстрировали, что PEP1 стабильно подавляется в апикальной меристеме побегов взрослых растений, которые начинают цветение при длительном воздействии холода (Lazaro et al. , 2018). У молодых растений аналогичная продолжительность яровизации не может вызвать цветение, даже если PEP1 заглушается во время холода (Lazaro et al. , 2018). Обязанность цветков во время яровизации коррелирует с более высокой экспрессией генов идентичности цветочной меристемы, AaFUL , AaLFY и AaAP1 , которые репрессируются PEP2 (Lazaro et al., 2018). Это очевидно по преждевременной активации уровней мРНК AaFUL , AaLFY и AaAP1 в яровизированных растениях pep2-1 по сравнению с диким типом (фиг.4; дополнительный рисунок S4). Хотя связь между сбросом PEP2 и PEP1 не ясна, похоже, что достижение приверженности цветков во время яровизации отрицательно коррелирует с повышением регуляции PEP1 после возврата к теплым температурам (Lazaro et al., 2018). У Arabidopsis не известно, что AP2 влияет на транскрипцию FLC . Однако сообщалось, что AP2 транскрипционно репрессируется с помощью FUL, а растения, сверхэкспрессирующие FUL , демонстрируют сниженную экспрессию FLC (Balanzà et al. , 2014, 2018). Эти результаты предполагают, что FUL может регулировать транскрипцию FLC независимо или через AP2 . Это также может указывать на то, что в A. alpina роль PEP2 в экспрессии PEP1 может включать другие регуляторы времени цветения, гены, участвующие в пути возраста, и гены, обеспечивающие приверженность цветков во время яровизации.Однако, поскольку PEP1 также транскрипционно регулирует гены в этих генетических путях, также могут иметь место механизмы обратной связи (Mateos et al. , 2017).

Заключение

Наше исследование демонстрирует, что PEP2 играет инструментальную роль в A. alpina , контролируя возрастную реакцию на яровизацию и способствуя активации PEP1 после яровизации. Поскольку обе роли PEP2 сосредоточены на том, была ли достигнута приверженность цветков во время яровизации, это предполагает, что они не могут быть полностью независимыми.Вышестоящие регуляторы генов идентичности меристем цветков, такие как PEP2, могут контролировать реакцию на яровизацию отдельных меристем и вносить вклад в сложную архитектуру растений многолетних растений.

Дополнительные данные

Дополнительные данные доступны по адресу JXB онлайн.

Набор данных S1. Транскрипты, идентифицированные как дифференциально экспрессируемые в pep2-1 по сравнению с диким типом.

Набор данных S2. Транскрипты, идентифицированные как дифференциально экспрессируемые в pep1-1 по сравнению с диким типом.

Набор данных S3. Транскрипты идентифицированы как дифференциально экспрессируемые в pep2-1 по сравнению с pep1-1 .

Рис. S1. GO-обогащенных категорий в эксперименте RNAseq.

Рис. S2. Активность AP2 не влияет на экспрессию FLC у Arabidopsis.

Фиг.S3. Уровни экспрессии miR156, AaSPL5 и AaSPL15 не различаются между растениями дикого типа и pep2-1 , растущими в длинные дни.

Рис. S4. PEP2 регулирует возрастную реакцию A. alpina на яровизацию.

Рис. S5. PEP2 контролирует экспрессию AaFUL , AaTFL1 , AaLFY и AaAP1 во время яровизации взрослых растений.

Таблица S1. Праймеры, используемые для PIPE-клонирования локуса PEP2 .

Таблица S2. Статистические различия на дополнительном рис. S2, определенные путем множественных попарных сравнений с использованием скорректированных по Бенджамини – Хохберга значений P , сравнивающих уровни мРНК FLC между FRI и FRI ap2-7 на разных стадиях развития.

Таблица S3. Статистические различия на фиг. 6, определенные путем множественных попарных сравнений с использованием скорректированных по Бенджамини – Хохберга значений P , сравнивающих уровни мРНК PEP1 между pep2-1 и диким типом на разных стадиях развития.

Сокращения

    Сокращения

  • DAG

  • LD

  • SD

Благодарности

Мы хотели бы поблагодарить SPP1530 ​​и CEPLAS за финансирование MCA, SPP1529 за финансирование AP и KN, а также стипендию Purkyně от ASCR до AP. Мы также хотели бы поблагодарить Маргарет Кокс за критическое прочтение рукописи.

Список литературы

Амасино

Р

.

2009

.

Цветочная индукция и монокарпическая жизнь в сравнении с поликарпической

.

Биология генома

10

,

228

.

Angel

A

,

Song

J

,

Dean

C

,

Howard

M

.

2011

.

Переключатель на основе Polycomb, лежащий в основе количественной эпигенетической памяти

.

Природа

476

,

105

108

.

Аукерман

MJ

,

Сакаи

H

.

2003

.

Регулирование времени цветения и идентичности цветочных органов с помощью микроРНК и ее APETALA2 -подобных генов-мишеней

.

Заводская ячейка

15

,

2730

2741

.

Balanzà

V

,

Martínez-Fernández

I

,

Ferrándiz

C

.

2014

.

Последовательное действие FRUITFULL как модулятора активности цветочных регуляторов SVP и SOC1

.

Журнал экспериментальной ботаники

65

,

1193

1203

.

Balanzà

V

,

Martínez-Fernández

I

,

Sato

S

,

Yanofsky

MF

,

Kaufmann

GC2

,

Феррандис

С

.

2018

.

Генетический контроль остановки меристемы и продолжительности жизни Arabidopsis с помощью пути FRUITFULL – APETALA2

.

Nature Communications

9

,

565

.

Benjamini

Y

,

Hochberg

Y

.

1995

.

Контроль ложного обнаружения – практичный и эффективный подход к множественному тестированию

.

Журнал Королевского статистического общества B: Методологический

57

,

289

300

.

Bergonzi

S

,

Albani

MC

.

2011

.

Репродуктивная компетентность с ежегодной и постоянной точки зрения

.

Журнал экспериментальной ботаники

62

,

4415

4422

.

Bergonzi

S

,

Albani

MC

,

Ver Loren van Themaat

E

,

Nordström

KJ

,

Wang

R

e PD

,

Муфта

G

.

2013

.

Механизмы возрастной реакции на зимнюю температуру в многолетнем цветении Arabis alpina

.

Наука

340

,

1094

1097

.

Биллингс

WD

,

Муни

HA

.

1968

.

Экология арктических и альпийских растений

.

Биологические обзоры Кембриджского философского общества

43

,

481

529

.

Bowman

JL

,

Smyth

DR

,

Meyerowitz

EM

.

1991

.

Генетические взаимодействия между цветочными гомеотическими генами Arabidopsis

.

Девелопмент

112

,

1

20

.

Castro

PH

,

Couto

D

,

Freitas

S

и др.

2016

.

SUMO протеазы ULP1c и ULP1d необходимы для развития и реакции на осмотический стресс у Arabidopsis thaliana

.

Молекулярная биология растений

92

,

143

159

.

Чен

X

.

2004

.

МикроРНК как репрессор трансляции APETALA2 в развитии цветка Arabidopsis

.

Наука

303

,

2022

2025

.

Cline

MS

,

Smoot

M

,

Cerami

E

и др.

2007

.

Интеграция данных биологических сетей и экспрессии генов с использованием Cytoscape

.

Протоколы природы

2

,

2366

2382

.

Зажим

SJ

,

Изогнутый

AF

.

1998

.

Цветочный окунание: упрощенный метод Agrobacterium -опосредованной трансформации Arabidopsis thaliana

.

Заводской журнал

16

,

735

743

.

Conti

L

,

Цена

G

,

O’Donnell

E

,

Schwessinger

B

,

Dominy

P

,

Sadanandom 9.

2008

.

Небольшие убиквитиноподобные протеазы-модификаторы, ЧРЕЗВЫЧАЙНО ТОЛЕПНЫЕ К SALT1 и -2, регулируют реакцию на солевой стресс у Arabidopsis

.

Заводская ячейка

20

,

2894

2908

.

Coustham

V

,

Li

P

,

Странно

A

,

Lister

C

,

Song

J

,

Dean

C

C

C

2012

.

Количественная модуляция сайленсинга поликомб лежит в основе естественной изменчивости яровизации

.

Наука

337

,

584

587

.

Crevillén

P

,

Sonmez

C

,

Wu

Z

,

Dean

C

.

2013

.

Генная петля, содержащая цветочный репрессор FLC, разрушена на ранней фазе яровизации

.

Журнал EMBO

32

,

140

148

.

Crevillén

P

,

Yang

H

,

Cui

X

,

Greeff

C

,

Уловка

M

,

9000 Cao 9000 Cao

Декан

С

.

2014

.

Эпигенетическое репрограммирование, предотвращающее наследование яровизированного состояния между поколениями

.

Природа

515

,

587

590

.

Czechwski

T

,

Stitt

M

,

Altmann

T

,

Udvardi

MK

,

Scheible

WR

.

2005

.

Общегеномная идентификация и тестирование превосходных эталонных генов для нормализации транскриптов в Arabidopsis

.

Физиология растений

139

,

5

17

.

Deng

WW

,

Ying

H

,

Helliwell

CA

,

Taylor

JM

,

Peacock

WJ

,

000

000 Dennis

.

2011

.

FLOWERING LOCUS C (FLC) регулирует пути развития на протяжении жизненного цикла Arabidopsis

.

Proceedings of the National Academy of Sciences, USA

108

,

6680

6685

.

Diggle

P

.

1997

.

Экстремальная преформация в альпийских условиях Polygonum viviparum : архитектурный анализ и анализ развития

.

Американский журнал ботаники

84

,

154

.

Guo

D

,

Wong

WS

,

Xu

WZ

,

Sun

FF

,

Qing

DJ

,

Li

N

2011

.

Ген 1, усиленный цис-коричной кислотой, играет роль в регуляции Arabidopsis bolting

.

Молекулярная биология растений

75

,

481

495

.

Hyun

Y

,

Richter

R

,

Vincent

C

,

Martinez-Gallegos

R

,

Porri

A

,

9 Coupland 9.

2016

.

Многослойная регуляция SPL15 и сотрудничество с SOC1 интегрируют эндогенные пути цветения в меристеме побегов Arabidopsis

.

Клетка развития

37

,

254

266

.

Кейт

RA

,

Mitchell-Olds

T

.

2017

.

Проверка гипотезы оптимальной защиты в природе: изменение профиля глюкозинолатов в растениях

.

PLoS One

12

,

e0180971

.

Klock

HE

,

Koesema

EJ

,

Knuth

MW

,

Lesley

SA

.

2008

.

Сочетание метода неполного удлинения праймера полимеразой для клонирования и мутагенеза с микрокринингом для ускорения усилий в области структурной геномики

.

Белки

71

,

982

994

.

Koskela

EA

,

Mouhu

K

,

Albani

MC

,

Kurokura

T

,

Rantanen

M

,

0003

0003

Coupland

G

,

Elomaa

P

,

Hytönen

T

.

2012

.

Мутация в TERMINAL FLOWER1 отменяет фотопериодические требования для цветения земляники Fragaria vesca

.

Физиология растений

159

,

1043

1054

.

Kotoda

N

,

Iwanami

H

,

Takahashi

S

,

Abe

K

.

2006

.

Антисмысловая экспрессия MdTFL1 , гена, подобного TFL1 , снижает ювенильную фазу в яблоке

.

Журнал Американского общества садоводческих наук

131

,

74

81

.

Krogan

NT

,

Hogan

K

,

Long

JA

.

2012

.

APETALA2 негативно регулирует множественные гены идентичности органов цветка у Arabidopsis, рекрутируя корепрессор TOPLESS и гистондеацетилазу HDA19

.

Девелопмент

139

,

4180

4190

.

Lazaro

A

,

Obeng-Hinneh

E

,

Albani

MC

.

2018

.

Расширенная яровизация регулирует судьбу соцветий Arabis alpina , стабильно подавляя PERPETUAL FLOWERING1

.

Физиология растений

176

,

2819

2833

.

Ли

I

,

Амасино

RM

.

1995

.

Влияние яровизации, фотопериода и качества света на фенотип цветения растений Arabidopsis , содержащих ген FRIGIDA

.

Физиология растений

108

,

157

162

.

Maere

S

,

Heymans

K

,

Kuiper

M

.

2005

.

BiNGO: плагин Cytoscape для оценки чрезмерной представленности категорий генной онтологии в биологических сетях

.

Биоинформатика

21

,

3448

3449

.

Mateos

JL

,

Tilmes

V

,

Madrigal

P

,

Severing

E

,

Richter

R

,

000

Rijkenberg, C

Rijkenberg

Муфта

G

.

2017

.

Дивергенция регуляторных сетей, управляемых ортологичными факторами транскрипции FLC и PEP1 у видов Brassicaceae

.

Proceedings of the National Academy of Sciences, USA

114

,

E11037

E11046

.

Матье

J

,

Янт

LJ

,

Mürdter

F

,

Küttner

F

,

Schmid

M

.

2009

.

Подавление цветения мишенью miR172 SMZ

.

PLoS Biology

7

,

e1000148

.

Meloche

CG

,

Diggle

PK

.

2001

.

Преформация, архитектурная сложность и гибкость развития у Acomastylis rossii (Rosaceae)

.

Американский журнал ботаники

88

,

980

991

.

Майклс

SD

,

Амасино

RM

.

1999

.

LOCUS C кодирует новый белок домена MADS, который действует как репрессор цветения

.

Заводская ячейка

11

,

949

956

.

Mohamed

R

,

Wang

CT

,

Ma

C

и др.

2010

.

Populus CEN / TFL1 регулирует первое начало цветения, идентичность пазушных меристем и высвобождение покоя у Populus

.

Заводской журнал

62

,

674

688

.

Noh

B

,

Lee

SH

,

Kim

HJ

,

Yi

G

,

Shin

EA

,

000 Lee

M

ung

Дойл

MR

,

Амасино

RM

,

Но

YS

.

2004

.

Дивергентные роли пары гомологичных белков фактора транскрипции класса jumonji / цинковый палец в регуляции времени цветения Arabidopsis

.

Заводская ячейка

16

,

2601

2613

.

Nordström

KJ

,

Albani

MC

,

James

GV

,

Gutjahr

C

,

Hartwig

B

,

,

,

,

Муфта

G

,

Schneeberger

K

.

2013

.

Идентификация мутации путем прямого сравнения данных полногеномного секвенирования от мутантов и индивидов дикого типа с использованием k-мер

.

Nature Biotechnology

31

,

325

330

.

Парк

JY

,

Kim

H

,

Lee

I

.

2017

.

Сравнительный анализ молекулярных и физиологических признаков между многолетником Arabis alpina Pajares и однолетним Arabidopsis thaliana Sy-0

.

Научные отчеты

7

,

13348

.

Schmid

M

,

Uhlenhaut

NH

,

Godard

F

,

Demar

M

,

Bressan

R

,

000

000 J

000 D

000 D

000

9000 D Weigel

2003

.

Рассечение путей индукции цветков с использованием анализа глобальной экспрессии

.

Девелопмент

130

,

6001

6012

.

Schwab

R

,

Palatnik

JF

,

Riester

M

,

Schommer

C

,

Schmid

M

,

Weigel

.

2005

.

Специфические эффекты микроРНК на транскриптом растений

.

Клетка развития

8

,

517

527

.

Searle

I

,

He

Y

,

Turck

F

,

Vincent

C

,

Fornara

F

,

Kröber

RA

RA

Муфта

G

.

2006

.

Фактор транскрипции FLC дает ответ цветения на яровизацию путем репрессии компетентности меристемы и системной передачи сигналов у Arabidopsis

.

Гены и развитие

20

,

898

912

.

Sheldon

CC

,

Rouse

DT

,

Finnegan

EJ

,

Peacock

WJ

,

Dennis

ES

.

2000

.

Молекулярная основа яровизации: центральная роль FLOWERING LOCUS C ( FLC )

.

Proceedings of the National Academy of Sciences, USA

97

,

3753

3758

.

Shindo

C

,

Lister

C

,

Crevillen

P

,

Nordborg

M

,

Dean

C

.

2006

.

Вариация эпигенетического молчания FLC вносит вклад в естественные вариации в ответе яровизации Arabidopsis

.

Гены и развитие

20

,

3079

3083

.

Trapnell

C

,

Pachter

L

,

Salzberg

SL

.

2009

.

TopHat: обнаружение сплайсинговых соединений с помощью RNA-Seq

.

Биоинформатика

25

,

1105

1111

.

Trapnell

C

,

Williams

BA

,

Pertea

G

,

Mortazavi

A

,

Kwan

G

000

G

000

9000 Salon M0002 Salon M

9000 Salon

,

Wold

BJ

,

Pachter

L

.

2010

.

Сборка и количественное определение транскриптов с помощью RNA-Seq выявляет неаннотированные транскрипты и переключение изоформ во время дифференцировки клеток

.

Nature Biotechnology

28

,

511

515

.

Ван

R

,

Албани

MC

,

Винсент

C

,

Бергонци

S

,

Луан

M

,

Cai

,

Kai

Castillo

R

,

Coupland

G

.

2011

.

Aa TFL1 дает возрастную реакцию на яровизацию у многолетнего растения Arabis alpina

.

Заводская ячейка

23

,

1307

1321

.

Wang

R

,

Farrona

S

,

Vincent

C

,

Joecker

A

,

Schoof

H

,

000 Blanco

Turck

,

Coupland

G

,

Albani

MC

.

2009

.

PEP1 регулирует многолетнее цветение Arabis alpina

.

Природа

459

,

423

427

.

Willing

EM

,

Rawat

V

,

Maumus

F

, et al.

2015

.

Отсутствие симметричного метилирования CG и длительная активность ретротранспозона сформировали геном Arabis alpina

.

Природные растения

1

,

14023

.

Wu

G

,

Park

MY

,

Conway

SR

,

Wang

JW

,

Weigel

D

,

Poethig

.

2009

.

Последовательное действие miR156 и miR172 регулирует время развития у Arabidopsis

.

Ячейка

138

,

750

759

.

Wu

G

,

Poethig

RS

.

2006

.

Временная регуляция развития побегов Arabidopsis thaliana с помощью miR156 и его мишени SPL3

.

Девелопмент

133

,

3539

3547

.

Xu

M

,

Hu

T

,

Zhao

J

,

Park

MY

,

Earley

кВт

,

Wu

G2

Поэтиг

RS

.

2016

.

Функции развития miR156-регулируемых генов SQUAMOSA PROMOTER BINDING PROTEIN-LIKE ( SPL ) в генах Arabidopsis thaliana

.

PLoS Genetics

12

,

e1006263

.

Янт

L

,

Матье

J

,

Dinh

TT

,

Ott

F

,

Lanz

C

,

000 Hollmann

C

,

000 Hollmann

Шмид

М

.

2010

.

Оркестровка перехода цветков и развития цветков у Arabidopsis с помощью бифункционального транскрипционного фактора APETALA2

.

Заводская ячейка

22

,

2156

2170

.

Yun

H

,

Hyun

Y

,

Kang

MJ

,

Noh

YS

,

Noh

B

,

Choi

2011

.

Идентификация регуляторов, необходимых для реактивации FLOWERING LOCUS C во время репродукции Arabidopsis

.

Планта

234

,

1237

1250 9000 3.

© Автор (ы) 2018. Опубликовано Oxford University Press от имени Общества экспериментальной биологии.

Это статья в открытом доступе, распространяемая в соответствии с условиями лицензии Creative Commons Attribution License (http: // creativecommons.org / licenses / by / 4.0 /), который разрешает неограниченное повторное использование, распространение и воспроизведение на любом носителе при условии правильного цитирования оригинальной работы.

Добавить комментарий

Ваш адрес email не будет опубликован. Обязательные поля помечены *