Рдест это: Рдест – это… Что такое Рдест?

Содержание

Рдест - это... Что такое Рдест?

Рдест[1] (лат. Potamogéton) — многолетние водные растения; род семейства Рдестовые. Отдельные побеги или части растений свободно плавают в воде непосредственно на поверхности или под поверхностью воды.

Родовое латинское наименование Potamogeton происходит от греч. ποτάμι, что значит река, и γείτων, что значит сосед, и указывает на среду обитания растений этого рода.

Ботаническое описание

Листья очерёдные, черешчатые или сидячие, разнообразной формы и размеров, от нитевидных и линейных до овальных и почти округлых. Могут быть все только подводные или же подводные и плавающие на поверхности воды.

Соцветие — колос серовато-зелёного или коричневато-зелёного цвета. Цветки обоеполые, мелкие, многочисленные, сближенные или расставленные. Околоцветники из четырёх округлых створчатых долей, тычинок четыре, без нитей. Цветут в июле—августе.

Возможны два варианта опыления цветков: соцветия возвышаются над водой, и цветки опыляются ветром; соцветия лежат на поверхности воды, и тогда возможны гидрофилия и зоофилия.

Плодики с деревянистым околоплодником, состоят из четырёх костянковидных долей.

Размножаются вегетативно и семенами. Семена распространяются птицами и водой.

Распространение и экология

Рдесты — растения-космополиты. Они растут повсюду в мире в стоячих или медленно текущих пресных или солоноватых водоёмах, часто образуя обширные заросли.

На 2010 год были известны 143 вида[2].

Виды

Значение и применение

Виды рдеста большого практического значения не имеют.

Они содержат много извести и потому могут служить удобрением[4].

Рдестами питаются водные моллюски, насекомые, рыбы. Там же, в зарослях рдестов, на их подводных частях, а иногда на нижней части листьев, они мечут икру.

Некоторые виды рдеста служат пищей для водоплавающих птиц, ондатр, бобров. Чаще плодики с деревянистым околоплодником служат не столько для питания, сколько для перетирания пищи, являясь гастролитами.

Массовое развитие рдестов в водоёмах затрудняет движение маломерных судов, способствует заиливанию и зарастанию водоёмов.

Разное

В Толковом словаре живого великорусского языка В. И. Даля приведено такое определение: РДЕСТ, рдестник м. растение жогла, Potamogeton; P. natans, водяная капуста; Р. pusillus, наплав, кундурак

[5].

Примечания

Литература

  • Биологический энциклопедический словарь / Гл. ред. М. С. Гиляров; Редкол.: А. А. Баев, Г. Г. Винберг, Г. А. Заварзин и др.. — 2-е изд., исправл.. — М.: Советская энциклопедия, 1989. — С. 532. — 864 с. — 150 600 экз. — ISBN 5-85270-002-9

Ссылки

Рдест - это... Что такое Рдест?

Рдест[1] (лат. Potamogéton) — многолетние водные растения; род семейства Рдестовые. Отдельные побеги или части растений свободно плавают в воде непосредственно на поверхности или под поверхностью воды.

Родовое латинское наименование Potamogeton происходит от греч. ποτάμι, что значит река, и γείτων, что значит сосед, и указывает на среду обитания растений этого рода.

Ботаническое описание

Листья очерёдные, черешчатые или сидячие, разнообразной формы и размеров, от нитевидных и линейных до овальных и почти округлых. Могут быть все только подводные или же подводные и плавающие на поверхности воды.

Соцветие — колос серовато-зелёного или коричневато-зелёного цвета. Цветки обоеполые, мелкие, многочисленные, сближенные или расставленные. Околоцветники из четырёх округлых створчатых долей, тычинок четыре, без нитей. Цветут в июле—августе.

Возможны два варианта опыления цветков: соцветия возвышаются над водой, и цветки опыляются ветром; соцветия лежат на поверхности воды, и тогда возможны гидрофилия и зоофилия.

Плодики с деревянистым околоплодником, состоят из четырёх костянковидных долей.

Размножаются вегетативно и семенами. Семена распространяются птицами и водой.

Распространение и экология

Рдесты — растения-космополиты. Они растут повсюду в мире в стоячих или медленно текущих пресных или солоноватых водоёмах, часто образуя обширные заросли.

На 2010 год были известны 143 вида[2].

Виды

Значение и применение

Виды рдеста большого практического значения не имеют.

Они содержат много извести и потому могут служить удобрением[4].

Рдестами питаются водные моллюски, насекомые, рыбы. Там же, в зарослях рдестов, на их подводных частях, а иногда на нижней части листьев, они мечут икру.

Некоторые виды рдеста служат пищей для водоплавающих птиц, ондатр, бобров. Чаще плодики с деревянистым околоплодником служат не столько для питания, сколько для перетирания пищи, являясь гастролитами.

Массовое развитие рдестов в водоёмах затрудняет движение маломерных судов, способствует заиливанию и зарастанию водоёмов.

Разное

В Толковом словаре живого великорусского языка В. И. Даля приведено такое определение: РДЕСТ, рдестник м. растение жогла, Potamogeton; P. natans, водяная капуста; Р. pusillus, наплав, кундурак[5].

Примечания

Литература

  • Биологический энциклопедический словарь / Гл. ред. М. С. Гиляров; Редкол.: А. А. Баев, Г. Г. Винберг, Г. А. Заварзин и др.. — 2-е изд., исправл.. — М.: Советская энциклопедия, 1989. — С. 532. — 864 с. — 150 600 экз. — ISBN 5-85270-002-9

Ссылки

Рдест - это... Что такое Рдест?

Рдест[1] (лат. Potamogéton) — многолетние водные растения; род семейства Рдестовые. Отдельные побеги или части растений свободно плавают в воде непосредственно на поверхности или под поверхностью воды.

Родовое латинское наименование Potamogeton происходит от греч. ποτάμι, что значит река, и γείτων, что значит сосед, и указывает на среду обитания растений этого рода.

Ботаническое описание

Листья очерёдные, черешчатые или сидячие, разнообразной формы и размеров, от нитевидных и линейных до овальных и почти округлых. Могут быть все только подводные или же подводные и плавающие на поверхности воды.

Соцветие — колос серовато-зелёного или коричневато-зелёного цвета. Цветки обоеполые, мелкие, многочисленные, сближенные или расставленные. Околоцветники из четырёх округлых створчатых долей, тычинок четыре, без нитей. Цветут в июле—августе.

Возможны два варианта опыления цветков: соцветия возвышаются над водой, и цветки опыляются ветром; соцветия лежат на поверхности воды, и тогда возможны гидрофилия и зоофилия.

Плодики с деревянистым околоплодником, состоят из четырёх костянковидных долей.

Размножаются вегетативно и семенами. Семена распространяются птицами и водой.

Распространение и экология

Рдесты — растения-космополиты. Они растут повсюду в мире в стоячих или медленно текущих пресных или солоноватых водоёмах, часто образуя обширные заросли.

На 2010 год были известны 143 вида[2].

Виды

Значение и применение

Виды рдеста большого практического значения не имеют.

Они содержат много извести и потому могут служить удобрением[4].

Рдестами питаются водные моллюски, насекомые, рыбы. Там же, в зарослях рдестов, на их подводных частях, а иногда на нижней части листьев, они мечут икру.

Некоторые виды рдеста служат пищей для водоплавающих птиц, ондатр, бобров. Чаще плодики с деревянистым околоплодником служат не столько для питания, сколько для перетирания пищи, являясь гастролитами.

Массовое развитие рдестов в водоёмах затрудняет движение маломерных судов, способствует заиливанию и зарастанию водоёмов.

Разное

В Толковом словаре живого великорусского языка В. И. Даля приведено такое определение: РДЕСТ, рдестник м. растение жогла, Potamogeton; P. natans, водяная капуста; Р. pusillus, наплав, кундурак

[5].

Примечания

Литература

  • Биологический энциклопедический словарь / Гл. ред. М. С. Гиляров; Редкол.: А. А. Баев, Г. Г. Винберг, Г. А. Заварзин и др.. — 2-е изд., исправл.. — М.: Советская энциклопедия, 1989. — С. 532. — 864 с. — 150 600 экз. — ISBN 5-85270-002-9

Ссылки

РДЕСТ - это... Что такое РДЕСТ?

РДЕСТ

(Potamogeton), род растений сем. рдестовых (Potamogetonaceae) порядка наядовых. Многолетние, б. ч. подводные травы, иногда верхние листья плавают на поверхности воды. Цветки мелкие, обоеполые, в колосьях, обычно находящихся над водой; протогиничны, опыляются ветром, у нек-рых видов — водой (все стадии перехода от анемофилии к гидрофилии). Ок. 100 видов, по всему земному шару; в СССР — св. 40 видов, многие повсеместно. Растут в стоячих или медленно текущих пресных или солоноватых водах, на глуб. до 2,5— 3 м, образуя иногда обширные заросли. Наиб, известны Р. плавающий (Р. nаtans), Р. пронзённолистный (P. perfoliatus), Р. курчавый (P. crispus), P. гребенчатый (P. pectinatus), P. блестящий (P. lucens) и др. Виды Р.— важный компонент пресноводной флоры. Заросли Р.— места нереста мн. видов рыб и убежища для молоди, нек-рые виды — корм ондатры, бобра и водоплавающих птиц; способствуют зарастанию водоёмов.

Рдест плавающий: цветущий побег (а — цветок).

.(Источник: «Биологический энциклопедический словарь.» Гл. ред. М. С. Гиляров; Редкол.: А. А. Бабаев, Г. Г. Винберг, Г. А. Заварзин и др. — 2-е изд., исправл. — М.: Сов. Энциклопедия, 1986.)

рдест

род трав сем. рдестовых. Включает ок. 100 видов многолетних водных растений, распространённых в умеренных областях всего земного шара. В России 41 вид, встречающийся повсеместно в пресноводных водоёмах. Листья разнообразной формы, плавающие на поверхности воды, обычно плотные, кожистые, погружённые в воду, перепончатые, прозрачные. Цветки мелкие, в колосовидных соцветиях. Плоды – некрупные орешки или костянки. Заросли рдестов – обычные места нереста рыб. Некоторые виды – корм водных млекопитающих (бобра, ондатры, нутрии) и птиц. Быстрый рост рдестов и других водных растений приводит к зарастанию водоёмов. Рдесты используют в аквариумах, способствуют очищению воды. Некоторые виды – аккумуляторы радиоизотопов.

.(Источник: «Биология. Современная иллюстрированная энциклопедия.» Гл. ред. А. П. Горкин; М.: Росмэн, 2006.)

.

РДЕСТ ПЛАВАЮЩИЙ (Potamogeton natans) » Домашний аквариум


В природных условиях рдест плавающий или как его еще называют – толга плавучая, растет в водоемах в европейской части России, Беларуси, Украине. Растение можно встретить в реках и заболоченных прудах Западной Европы, Скандинавии, Балканском полуострове, Северной Америки, Центральной Азии, Северной Африки, Китае и Японии.
Плавающий рдест – это многолетнее растение, имеющее клубнеобразное корневище и листья округлой или яйцевидной формы, расположенными на мелковетвистых стеблях длина которых может достигать 1,5 м. Основная часть листьев растения плавают на поверхности воды. Листья сравнительно большие, длиной до 12 см и шириной около 3-5 см. Верх листа блестящий, как будто вскрытый лаком.

Рдест плавающий завсегдатай фактически всех водоемов. Во время засухи, при высыхании водоема, растение, как ни в чем не бывало, продолжает расти вне воды. В приемлемых условиях содержания растение может зацвести, в период с июля по август, выпустив надводное колосовидное соцветие, высотой до 10 см, с невзрачными цветками зеленоватого цвета, которое опыляется на ветру. Во время цветения растения все его подводные листья пропадают. Плавающий рдест предпочитает проточную воду, этим объясняется то, что его чаще можно встретить в реках, чем в водоемах со стоячей водой. В некоторых водоемах растение так разрастается, что образует плотный ковер из листьев, что в некоторых случаях мешает судоходству.


Сразу хотелось бы сказать, что растение редко встречается в аквариумах любителей и связано это, прежде всего с тем, что оно малопривлекательно. Вся декоративность данного вида проявляется, если смотреть на него сверху, что не всегда возможно из-за аквариумной крышки. Тем не менее растение с успехом можно применять, например, в нерестовых аквариумах, где оно может служить прекрасным субстратом для нереста многих видов рыб. Растение также хорошо обогащает воду кислородом.

Параметры воды должны удовлетворять следующим условиям: температура 23-30°С, жесткость dH 7-15°, кислотность pH 7,0-8,0.

Грунт должен быть заиленным, с большим содержанием глины.


Размножают рдест плавающий семенами и вегетативно, черенками. В зимний период растение пропадает, образуя зимние почки, которые с началом весны дают жизнь новому растению.

 


Растение обладает рядом целебных свойств и используется в медицине при ранах и различных воспалительных процессах в организме. Кроме того плоды рдеста служат едой для многих видов рыб, населяющих водоемы где растет растение.
Обнаружили ошибку или мёртвую ссылку?

Выделите проблемный фрагмент мышкой и нажмите CTRL+ENTER.
В появившемся окне опишите проблему и отправьте Администрации ресурса.

Рдесты

30.05.2016

Если при езде на моторе, с вами случилась неприятность, известная как «намотал на винт», то на 99% виновником ее послужили водные растения рода рдестов. Этот род принадлежит к одноименному семейству и включает до ста видов. Из них наиболее обычными в наших широтах являются пять: Рдест плавающий, Рдест курчавый, Рдест пронзеннолистный, Рдест блестящий и Рдест гребенчатый

СТРОЕНИЕ И БИОЛОГИЯ

Все рдесты – пресноводные расте­ния, и лишь немногие из них (например, рдест гребенчатый) способны развивать­ся в приморских лагунах и солоноватых озерах. Рдесты – многолетние растения. В тропиках и субтропиках они вегетируют круглый год, а в наших широтах перези­мовывают с помощью корневищ и ниж­них частей побегов или за счет образую­щихся в пазухах листьев и на верхушках стеблей зимующих почек – сильно уко­роченных побегов с тесно сближенными мелкими листьями.

     За счет образования отчленяющих­ся боковых побегов и зимующих почек рдесты способны быстро размножаться, нередко полностью заполняя небольшие водоемы.

     Рдесты закрепляются на дне водо­ема с помощью более или менее длин­ных корневищ, от узлов которых отхо­дят простые или разветвленные корни с длинными корневыми волосками. Обыч­но они остаются прикрепленными к грун­ту, но отдельные побеги и части побегов могут отделяться от родительской особи и свободно плавать в воде, продолжая свое развитие.

     Колосовидные соцветия рдестов расположены на безлистных ножках и во время цветения обычно возвышаются над поверхностью воды. Цветки у всех рдестов обоеполые. Опыление у большин­ства видов осуществляется с помощью ветра. У рдеста гребенчатого длинные и гибкие соцветия не возвышаются над водой, а плавают на ее поверхности, где и опыляются. Опылителями могут быть улитки и некоторые насекомые, поедающие пыльцу.

     Плод у рдестов состоит из 1–4 плодиков. Плодики плавают очень короткое время или даже совсем не могут плавать. Исключение – рдест плавающий, у которого плодики долго не тонут и могут разноситься водой на большие расстояния. Важ­ную роль в распространении плоди­ков рдестов играют также рыбы и водоплавающие птицы, поедающие их ради мясистого околоплодника.

 

РДЕСТЫ И РЫБЫ

     Листья и побеги рдестов слу­жат пищей для таких рыб как белый амур, сазан, серебряный карась, красноперка.

     В зарослях рдестов мечут икру многие виды рыб, а их личинки и мальки находят там убежище.

Многолетние наблюдения на не­которых озерах Европы показывают, что обилие рдестов – важный фактор благополучия популяций многих рыб. Например, когда в 1970–1980 гг. в озере Тьюкимеер исчезли рдестов, то в пита­нии угрей резко снизилась доля гамма­русов. Одновременно, возросла числен­ность судака, а популяции плотвы, окуня и ерша, наоборот, сократились. Скорее всего, это также явилось следствием ис­чезновения рдестов.

 

Рдест плавающий легко узнаваем по ветвистым стеблям. Когда водоем вы­сыхает, он становится надземным растением с плотными листьями.

У рдеста курчавого стебель красноватый, четырехгранный, листья сидячие ланцетовидные, волнистые, с мелкими зубчиками по краям. Растение полностью погружено в воду, только початки с цветками поднимаются над водой и опыля­ются ветром.

У пронзеннолистного рдеста стебли длинные, ветвистые. Листья округлые, полупрозрачные, по краю слегка волнистые, с плохо выраженными поперечными жилками.

У рдеста блестящего листья крупные, овальные, блестящие. Один из рде­стов, предпочитающих проточную воду.

Стебель у рдеста гребенчатого разветвленный, а листья нитевидные, очень тонкие. Растет на мелководных участках.


Номер выпуска

6/2016

Статью прочитало  

15213
  Рейтинг: 3.1

Рдест - растение для пруда

Просторные заросли рдеста можно встретить в медленнотекущих солоноватых и пресных озерах всего мира. Это водяное многолетнее растение характеризуется поочередными листьями самой разной формы и размера. Они могут плавать на воде или быть погруженными.

Корни длинные, а отдельные части могут отделяться, свободно плавать на поверхности и постепенно становиться самостоятельными развитыми экземплярами.

Цветение рдеста проходит летом, когда растение пускает колосовидные соцветия с мелкими цветками болотных, а порой розовых оттенков.

В целом рдест не представляет высокой декоративной ценности, однако значение его для искусственного водоема неоценимо. Это растение является прекрасной пищей для жителей водоема, после отмирания образует плодородный ил, а главное – обогащает воду кислородом, помогая пышному развитию водяной экосистемы.

Кроме того, он прекрасно уживается с большинством прибрежных и глубоководных растений, предлагая взаимовыгодное соседство.

Разнообразие видов

Рдесты представлены восемью родами и сотней видов. Хотя посадка этой культуры диктуется зачастую практическими, а не эстетическими побуждениями, среди этого множества разновидностей можно выбрать ту, которая лучше адаптируется к созданным условиям и впишется в дизайн пруда.

Среди плавающих представителей флоры выделяют рдест альпийский с длинными нитевиными красноватыми листиками и злаковый - с подводными листьями, отмирающими на значительной глубине, а на суше делающимися кожистыми. Чаще всего встречается рдест плавающий (фото 1), живущий преимущественно в воде со слабым течением и продолжающий жизнь, даже если водоем на некоторое время пересыхает.

Фото 1. Рдест плавающий

Среди разновидностей с погруженными листьями можно отметить растущий на мелководье гребенчатый вид с сильно разветвленными стеблями и узкими листиками, курчавый с гофрированными зубчатыми листьями (фото 2), сильно ветвистый пронзеннолистый вид, а также рдесты Гайя, блестящий, сплюснутый и много других.

Фото 2. Рдест курчавый

Особенности выращивания

Зачастую рдест отлично развивается на солнце и в полутени, в стоячей  или медленой воде, хотя некоторые приоритеты могут диктоваться видовыми особенностями. Разной может быть и рекомендуемая глубина погружения: плавающие растения для пруда могут развиваться и в очень мелкой воде, а погруженным может потребоваться аж до полутора метра. Лучшей почвой станет для данной культуры плодородный ил.

В уходе эти растения-оксигенераторы совсем не капризны. Могут зимовать на самом дне водоема и не требуют укрытия. Но желательно не забывать, что абсолютная неприхотливость может сыграть злую шутку с ценителями аккуратных садовых прудиков. Если не ограничивать его распространение, рдест может настолько разрастись в пруду, что захватит большую часть водной поверхности и превратит ее в болото.

Также важно учитывать, что если растение уже принялось в водоеме, избавиться от него будет практически нереально.

Размножается рдест черенками и корневищными отрезками, полученными весной или осенью, и семенами, которые закатывают в глину и отправляют непосредственно в грунт водоема.

ABRC

Тип ресурса: плазмида

Наличие: есть в наличии

Доноры:

Дата пожертвования: 15.07.2009

Дата выпуска: 15.07.2009

Описание:

AT3G25800, клонированный в двухгибридном векторе pDEST-AD, автоактивация DB-ORF не обнаружена.

Требование роста: рост в среде LB при 37 ° C в течение ночи

Маркер: ампициллин

Фон: Col (Колумбия)

Комментарий ABRC: Этот материал содержит технологию Gateway ™, принадлежащую ThermoFisher Scientific (ранее известную как Life Technologies / Invitrogen Corporation).Распространяется в соответствии с Политикой открытой архитектуры шлюза.

Формат Поставляется: бактериальный укол

Базовая / Коммерческая цена: 13 $ / 104 $

Таксон: Arabidopsis thaliana 3702.

Нет данных о контроле качества для этого запаса.

Примечание

Шлюз (TM) _Open_Architecture

Когда он был первоначально запущен в 1999 году, в отношении технологии шлюза существовало несколько ограничений на использование, которые требовали дополнительного лицензирования.Эти ограничения включали использование в исследованиях промышленными организациями, распространение исследовательских материалов академическими исследователями и любое коммерческое использование. В 2003 году мы ввели открытую архитектуру шлюза в ответ на острую потребность исследовательских сообществ в открытом доступе к технологии шлюза для научных исследований. Большинство общегеномных инициатив финансируются правительственными агентствами, которые требуют, чтобы все ресурсы и информация, включая данные, программное обеспечение и биологические материалы, были открытыми.Мы поняли, что наша политика была слишком строгой, и вместо того, чтобы позволить вам проводить исследования с использованием передовых технологий, мы препятствовали этому, защищая интеллектуальную собственность. Наше видение, включая стратегические направления бизнеса, такие как корпоративное лицензирование, должно соответствовать потребностям наших клиентов. Мы считаем, что разделяем с вами общие стремления поддерживать и содействовать передовым исследованиям в области наук о жизни; Таким образом, мы представили новую открытую архитектуру для Gateway Technology. Согласно новой политике лицензирования:

Академические и государственные исследователи могут создавать и свободно распространять клоны входа в Gateway (содержащие сайты attL1 и attL2) и клоны экспрессии (содержащие сайты attB1 и attB2) для исследовательского использования без лицензионных сборов или лицензионных отчислений.

Теперь любая организация может свободно распространять клоны входных данных шлюза, созданные академическими или государственными исследователями, для использования в исследованиях без уплаты лицензионных сборов или лицензионных отчислений, а также может распространять клоны выражения шлюза, созданные академическими или государственными исследователями, для использования в исследованиях за номинальную плату до 10 долларов США за клон.

Права на проведение реакции рекомбинационного клонирования Gateway в исследовательских целях с этими распределенными клонами передаются путем покупки фермента Invitrogen TM Gateway Clonase TM.

Мы не будем выдвигать иск против покупателя о нарушении прав на основании производства, использования или продажи терапевтического, клинического диагностического, вакцины или профилактического продукта, разработанного покупателем в ходе исследования, при условии, что ни один из методов, заявленных в соответствующих патентах, не использовался в изготовление такого продукта.

Мы считаем, что эта политика открытого доступа к клонам Gateway для научных исследований - лучший способ поддержать ваши усилия по развитию глобальных наук о жизни.Мы стремимся к тому, чтобы новая информация и ресурсы были доступны для более широкого сообщества, во-первых, устраняя необоснованные лицензионные ограничения, а во-вторых, предоставляя ресурсы, необходимые в качестве ключевого дистрибьютора и партнера.

Идентификация клонов с положительной экспрессией GATEWAY, когда оба вектора pENTRY и pDEST содержат один и тот же маркер для бактериальной селекции.

Технология клонирования GATEWAY (Invitrogen) использует преимущество сайт-специфической рекомбинации бактериофага λ.Жизненный цикл λ чередуется между литической и лизогенной стадиями. ДНК может быть вставлена ​​или вырезана из генома хозяина Escherichia coli путем рекомбинации между конкретными сайтами AttB (бактериальный) и AttP (фаг). Этот процесс опосредуется белками λ int (интеграза) и xis (эксцизионаза), а также белком-хозяином IHF (фактор интеграции-хозяина). Технология клонирования GATEWAY использует этот процесс для направленной вставки фрагментов ДНК в специально адаптированные векторы. Эти векторы содержат отрицательный селектируемый маркер, ген ccdB, для селекции против нерекомбинантных клонов.Промотор или фрагменты гена делают GATEWAY совместимыми с адапторными праймерами и амплифицируют с помощью ПЦР. Эти фрагменты используются в реакции клоназы ВР для создания клонов ENTRY. Обычно вектор pDONR, используемый для создания таких клонов ENTRY, выбирают таким образом, чтобы маркер селекции антибиотика отличался от маркера вектора pDEST, который в конечном итоге генерирует клон экспрессии. Это способствует отбору клона экспрессии и отбору против клона PENTRY. Теперь, когда создано множество векторов pENTRY и pDEST, которые доступны в складских центрах, гены устойчивости к антибиотикам предопределены и не всегда могут быть совместимы друг с другом.С этой проблемой часто сталкиваются исследователи растений, поскольку многие библиотеки кДНК полной длины были созданы с использованием векторов pDONR-TOPO, pDONR221 или pENTR1A, которые все устойчивы к канамицину у бактерий, и многие векторы pDEST были адаптированы из традиционной трансформации растений. векторы, которые также часто устойчивы к канамицину у бактерий. В следующем протоколе описаны способы, с помощью которых можно эффективно использовать такие сложные комбинации векторов для получения подходящего экспрессионного клона без необходимости преобразовывать клон pENTRY или клон pDEST в векторы с совместимой устойчивостью к антибиотикам.

Shuttle Vectors & Promotors | Vigene Biosciences

Наши векторы-шаттлы и промоторы можно приобрести индивидуально, в сочетании с нашей совместимой коллекцией ORF человека или использовать для пользовательских проектов клонирования.

Посмотреть все векторы и промоутеры Shuttle>

Создайте свой собственный вектор выражения

Наш челночный вектор аденовируса и целевые векторы можно приобрести по отдельности или в сочетании с нашей совместимой коллекцией ORF человека.Если вы хотите передать ORF в любую из перечисленных ниже магистралей, просто предоставьте следующую информацию при запросе предложения:

  1. Каталожный номер или RefSeq ORF
  2. Каталожный номер или название желаемой векторной магистрали
  3. Желаемая настройка / мутагенез (необязательно)
  4. Упаковка в вирусные частицы (по желанию)

Вектор шаттла аденовируса и векторы назначения

Векторы назначения лентивирусов

Промоутеры AAV и векторы назначения

ФЛАГ ФЛАГ ФЛАГ ФЛАГ ФЛАГ ФЛАГ ФЛАГ ФЛАГ ФЛАГ ФЛАГ ФЛАГ ФЛАГ ФЛАГ ФЛАГ ФЛАГ ФЛАГ ФЛАГ ФЛАГ ФЛАГ ФЛАГ ФЛАГ ФЛАГ ФЛАГ ФЛАГ ФЛАГ
Вектор AAV Промоутер Репортер / Бирка Выбор
pAV-FH CMV , Его усилитель
pAV-ALB ALB , Его усилитель
pAV-aMHC AMHC , Его усилитель
pAV-c-Fos c-Fos , Его усилитель
pAV-CAG CAG , Его усилитель
pAV-CaMKIIa КАМКИЯ , Его усилитель
pAV-CK0.4 CK0.4 , Его усилитель
pAV-CK1.3 CK1.3 , Его усилитель
pAV-cTnT сТнТ , Его усилитель
pAV-EF1a EF1a , Его усилитель
pAV-EFFS EFFS , Его усилитель
pAV-GFAP GFAP , Его усилитель
pAV-GFAP104 GFAP104 , Его усилитель
pAV-MBP МБП , Его усилитель
pAV-MCK MCK , Его усилитель
pAV-MeCP2 MeCP2 , Его усилитель
pAV-NSE NSE , Его усилитель
pAV-PDX1 PDX1 , Его усилитель
ПАВ-ПГК PGK , Его усилитель
pAV-Rpe65 Rpe65 , Его усилитель
pAV-SST нержавеющая сталь , Его усилитель
pAV-Syn Syn , Его усилитель
pAV-TBG TBG , Его усилитель
pAV-UBC UBC , Его усилитель
pAV-3xEnhancer MCK 3-кратный усилитель MCK , Его усилитель

Нужен индивидуальный продукт?

Мы также предоставляем услуги клонирования, чтобы вы могли полностью настроить свой заказ. Если вы хотите запросить индивидуальный заказ, свяжитесь с нами и сообщите подробности своего проекта или посетите нашу страницу молекулярного клонирования для получения дополнительной информации.

Вирусная упаковка

Свяжитесь с нами, если вы хотите, чтобы ваш вектор был упакован в вирусные частицы для эффективной доставки генов в различные типы делящихся и неделящихся клеток. Мы предлагаем услуги вирусной упаковки, начиная от мелкомасштабной упаковки для in vitro, и заканчивая крупномасштабной упаковкой для исследований на животных, вплоть до производства GMP для использования в клинических применениях.Посетите наши страницы упаковки AAV, аденовируса или лентивируса для получения дополнительной информации.

Руководство по доставке вирусов

Наше руководство по доставке вирусов поможет вам выбрать, какой вирус лучше всего подойдет для ваших конкретных приложений.

Подробнее>

Протокол трансфекции плазмид

Этот протокол предоставляет предлагаемые рекомендации по трансфекции плазмиды in vitro .

Подробнее>

FAQ

Как ORF перемещается в другой вектор?

ORF, клонированная в челночный вектор аденовируса pENTER, может быть перенесена в другие векторы-получатели Vigene посредством простого переваривания и лигирования рестрикционным ферментом «вырезать и вставить».Комбинация двух пар рестрикционных ферментов, AsiSI / MluI (96%), AsiSI / RsrII (99%), покрывает 99,5% всех ORF кДНК человека. Все гены человека могут быть покрыты несколькими дополнительными комбинациями рестрикционных ферментов, такими как AsiSI / NotI, AscI / RsrII.

Существуют ли какие-либо ограничения, до которых можно перемещать ORF?

Если вы хотите генерировать вирусные частицы, вы не должны превышать емкость упаковки вируса: 7,5 кб для аденовируса, 6 кб для лентивируса и 4,7 кб для AAV.Обратите внимание, что емкость упаковки относится к общему размеру вставки между ITR или LTR (включительно), включая промоутер, ORF, репортер, теги и т. Д.

Какая гарантия Vigene?

Мы гарантируем, что наш челночный вектор аденовируса, все наши целевые векторы и наши клоны кДНК человека будут содержать последовательности, перечисленные на соответствующих страницах описания продуктов. Обратите внимание, что мы не можем гарантировать сверхэкспрессию белка, потому что это будет зависеть от условий вашего эксперимента.

Векторные изображения

Gateway® Nova pDEST ™ | VWR

УСЛОВИЯ VWR INTERNATIONAL LTD

Настоящие положения и условия распространяются на все продажи продуктов и услуг VWR International Ltd (VWR) в Ирландии и Северной Ирландии, а также на любую информацию и советы, независимо от того, взимается ли плата за них или нет. Никакие изменения в этих условиях не будут применяться, если VWR не согласовал их в письменной форме. Заказы принимаются только при условии, что никакие условия покупки не применяются.

Цены / тарифы

VWR имеет право в любое время изменить цены, указанные в каталогах и прайс-листах, и выставить счет по ценам, действующим на дату получения заказа.

Котировки

«Цена по заявке» (POA) и все другие предложения будут действительны в течение 30 дней с даты предложения, если VWR не уведомит об ином.

Все цены в каталогах и котировках не включают налог на добавленную стоимость и любые другие налоги и сборы. При необходимости они будут оплачиваться отдельно.

VWR оставляет за собой право применять фрахт для всех поставок. Заявленные нами цены действительны для товаров, которые доставляются на первый этаж, без распаковки и установки. Любые дополнительные услуги по транспортировке и погрузке-разгрузке, связанные с установкой, оплачиваются отдельно.

Минимальная плата за заказ в размере 30 евро / 30 фунтов стерлингов может применяться к заказам менее 100 евро / 100 фунтов стерлингов.

Общедоступные цены доступны на веб-сайте VWR. Чтобы ознакомиться с применимыми ценами для конкретных клиентов, каждому клиенту предлагается войти в систему через свой персональный профиль или связаться с VWR, чтобы получить конкретное ценовое предложение.

Условия оплаты

Если иное не согласовано в письменной форме, полная оплата должна быть произведена в течение 30 дней с даты выставления счета. VWR имеет право взимать проценты на все просроченные суммы по ставке пять процентов в год сверх базовой кредитной ставки Банка Ирландии, рассчитанной на дату фактического платежа.

Клиентов, которые превысили свои кредитные лимиты или которые находятся в неудовлетворительной ситуации в отношении своей кредитоспособности, попросят заранее заплатить за дополнительные продукты до тех пор, пока счет не будет оплачен.

VWR оставляет за собой право потребовать рассрочку до исполнения заказа, если это будет сочтено необходимым.

Поставленные продукты остаются собственностью VWR до тех пор, пока они не будут оплачены.

VWR имеет право доставлять заказ в рассрочку, и клиент должен оплатить счет за каждый взнос в течение 30 дней с даты выставления счета.

В случае просрочки платежа VWR может приостановить выполнение любого невыполненного заказа без ущерба для любого другого курса действий и может потребовать штрафы за просрочку платежа по ставке ЕЦБ, действующей на 1 января или 1 июля + 10 баллов из-за день, следующий за датой платежа, плюс фиксированная компенсация затрат на восстановление.

Продукты и использование

Поставляемая нами продукция предназначена для использования в соответствии с документацией и спецификациями производителя под исключительную ответственность пользователя.

Технические характеристики и цифры, содержащиеся в наших каталогах, предоставлены только для ознакомления и не носят договорного характера. VWR оставляет за собой право изменять свои статьи без предварительного уведомления в соответствии с улучшениями, которые могут потребоваться в связи с развитием применяемых технологий.

VWR не контролирует и не сообщает об изменениях в спецификациях продукта. Для определенных продуктов и при определенных условиях между сторонами может быть подписано соглашение о контроле за изменениями.
Продукты, поставляемые VWR, не могут использоваться в качестве активных фармацевтических ингредиентов (API) в медицине или ветеринарии, потому что как дистрибьютор VWR не выполняет требования, изложенные в руководящих принципах для лекарственных препаратов GMP для человека и ветеринарии.

Клиенты, использующие продукцию VWR в фармацевтической, косметической, пищевой, пестицидной или других регулируемых сферах, должны проводить собственные внутренние проверки и контроль, чтобы гарантировать, что товары имеют надлежащее качество / класс и соответствуют местным законам и правилам. (е.грамм. Европейская фармакопея) и т. Д. Пожалуйста, свяжитесь с VWR, если у вас есть какие-либо вопросы относительно вашего предполагаемого использования и подходит ли продукт, который вы хотите приобрести, для этой цели. Ни при каких обстоятельствах VWR не несет ответственности, если заказчик использует продукт, не соответствующий предполагаемому применению.

Заказчик несет ответственность за соблюдение всех применимых норм в области здравоохранения, безопасности и других норм и за принятие соответствующих мер в отношении хранения, обращения, продажи и использования продуктов.

Заказы

Заказы являются окончательными, только если они подтверждены VWR в письменной форме. Если клиент отменяет заказ, VWR может выставить счет за отмену.Определенные заказы (товары, не входящие в каталог) не подлежат отмене.

VWR рекомендует использовать номера и обозначения из наших каталогов или нашего предложения. В случае неточного обозначения, если VWR должен сам сделать выбор, VWR не несет никакой ответственности, и расходы на возврат в случае несоответствия несет покупатель.

Доставка - Отгрузка продукции

VWR выбирает способ доставки, который подходит для своего клиента.

Продукты, перечисленные в ADR (международные правила перевозки опасных товаров) и отмеченные в каталогах VWR отличительными знаками, отправляются только при определенных условиях.

За товары, требующие специальной перевозки или специальной упаковки, а также за тяжелые и громоздкие товары, а также за экспресс-доставку, покупателю будет выставлен счет за дополнительную плату. Заказчик несет ответственность за правильность размеров помещений (лестница, дверь, комната и т. Д.).) для получения заказанного материала.

Продажа алкоголя подлежит очень строгому регулированию, которое покупатель должен соблюдать. Офис налоговой инспекции проверяет продажу алкоголя. С этой целью перед любой доставкой покупатель должен предоставить VWR копию разрешения на покупку алкоголя, переданного налоговым инспектором.

Дата поставки, указанная в документах VWR (предложение, контракт, подтверждение получения заказа и т. Д.), Является ориентировочной.В случае превышения сроков доставки штрафы за просрочку поставки или ущерб не предъявляются. Поставка осуществляется только в том случае, если у клиента в настоящее время хорошая репутация в отношении своих обязательств перед VWR.

Претензии и возврат поврежденных или непригодных товаров

Любые претензии по поводу недостачи должны быть предъявлены в течение 7 рабочих дней с момента доставки.

Любые претензии в отношении не заказанных товаров или недоставки должны быть предъявлены в течение 7 рабочих дней с момента получения счета.

Никакие товары не могут быть возвращены VWR без разрешения VWR.

Разрешение на возврат товаров, поврежденных во время доставки, необходимо запросить в течение 3 рабочих дней с момента доставки. VWR имеет право отремонтировать и вернуть поврежденные изделия.

Разрешение на возврат продуктов, которые не соответствуют текущим опубликованным спецификациям производителей, необходимо запросить в письменной форме в течение 28 дней с момента доставки. VWR будет помогать клиентам за счет клиентов в получении любой гарантии производителя, соответствующей гарантии, предоставленной VWR.

Разрешение на возврат продуктов, кроме продуктов, поврежденных во время доставки, доставленных по ошибке или не соответствующих спецификациям, должно быть запрошено в течение 28 дней с момента доставки. Кредит (за вычетом платы за обработку в размере 20% от стоимости всех возвращенных продуктов, при условии минимальной платы 30 евро / 30 фунтов стерлингов) будет предоставлен для тех продуктов, разрешенных к возврату, которые не используются и находятся в состоянии повторной продажи (включая оригинальные упаковка), кроме указанных в категориях:

  • открытая химия или диагностика
  • охлажденные или прочие скоропортящиеся продукты
  • единиц с истекшим сроком хранения или срок годности слишком короткий для перепродажи
  • любой товар, который был доставлен напрямую сторонним поставщиком
  • товары, снятые с производства
  • единиц товара не были куплены в VWR.

Разрешение будет осуществляться при условии, что продукты будут возвращены вместе с необходимыми документами (с указанием номера возврата, сертификата обеззараживания, если применимо) в распределительный центр VWR в Дублине по предварительной договоренности.
Непрофильные продукты каталога VWR и продукты, изготовленные по индивидуальному заказу, которые заказаны от имени клиента и / или были доставлены от нашего имени сторонним поставщиком, не будут приняты обратно в распределительный центр VWR.

Гарантия

Новые материалы и оборудование, продаваемые VWR, покрываются, если не указано иное, от любых производственных дефектов на период от 12 до 24 месяцев с:

- техническая приемка установленного оборудования;
- поставка неустановленного оборудования.

Гарантия

VWR применяется исключительно в случае дефектов, вызванных дефектом конструкции или скрытым дефектом, влияющим на поставленные товары и делающим их непригодными для использования.

Ремонт оборудования строго ограничен в мастерских VWR или заказчиком. Если ремонт невозможен, он ограничивается заменой несоответствующего или дефектного товара. По явному соглашению, гарантия VWR полностью исключает любые убытки, в частности затраты на оплату труда, потерю заработка, нарушение работы и т. Д.На запасные части распространяется гарантия через 3 месяца после установки, если такая установка была произведена лицом, сертифицированным VWR.

Для химических продуктов предоставленная гарантия распространяется только при условии, что упаковки хранятся в надлежащих условиях консервации.

VWR настоящим отказывается от всех других гарантий в отношении предмета, будь то законодательные, письменные, устные, явные или подразумеваемые, включая, помимо прочего, любые гарантии товарной пригодности, пригодности или пригодности для определенной цели.
В случае возникновения спора иск о возмещении убытков должен быть предъявлен в течение одного года после доставки.

Техническое обслуживание после гарантии

По истечении гарантийного срока или в торговой точке VWR может предложить техническое обслуживание, и в этом случае VWR предложит клиенту контракт на техническое обслуживание, адаптированный к его потребностям.

Право собственности и риск

Риск, связанный с продуктами, поставляемыми VWR, переходит к покупателю по завершении поставки.

Право собственности на продукты не переходит к покупателю до тех пор, пока VWR не получит платеж в полном объеме, а также любые другие товары, поставленные VWR клиенту, в отношении которых наступил срок платежа; в этом случае право собственности на продукты переходит в момент выплата всех таких сумм.

До тех пор, пока право собственности на продукцию не перейдет к покупателю, покупатель должен:

  • хранить продукты отдельно от всех других продуктов, принадлежащих покупателю, чтобы их можно было легко идентифицировать как собственность VWR;
  • не удалять, не портить и не скрывать никаких опознавательных знаков или упаковок на продуктах или относящихся к ним;
  • поддерживает продукты в удовлетворительном состоянии и застраховывает их от всех рисков по их полной цене от имени VWR с даты поставки;
  • предоставляет VWR такую ​​информацию, касающуюся продукции, которую VWR может время от времени запрашивать.

Ответственность VWR за любые убытки или ущерб, понесенные клиентом и возникшие из-за дефектов продуктов или иным образом, ограничивается фактурной ценой продуктов, в отношении или в отношении которых заявлена ​​потеря или повреждение. Любая ответственность, принятая VWR в соответствии с настоящими положениями и условиями, заменяет любые гарантии или условия, подразумеваемые законом в отношении качества или пригодности продукции для какой-либо конкретной цели, и за исключением случаев, предусмотренных настоящими условиями, VWR не несет никакой ответственности. , будь то по контракту, правонарушению, нарушению установленных законом обязательств или иным образом в отношении дефектов поставленной продукции или в связи с любыми травмами (кроме смерти или телесных повреждений, вызванных халатностью VWR, как это определено в Законе о недобросовестных условиях контрактов 1977 года), ущерб или убытки в результате такие дефекты или из любой информации, услуг или советов, предоставленных VWR или его сотрудниками, подрядчиками или агентами.Ни при каких обстоятельствах VWR не несет ответственности за любые косвенные убытки, вызванные форс-мажорными обстоятельствами или нет. Заказчик освобождает VWR от любых претензий со стороны своих сотрудников, подрядчиков или агентов.

Заказчик должен гарантировать, что использование любых продуктов, поставляемых VWR, не нарушает права интеллектуальной собственности третьих лиц.

Форс-мажор

Пожары, наводнения, поломки машин, беспорядки, войны, нехватка материалов и любые другие инциденты, которые препятствуют или сокращают производство и услуги, считаются форс-мажорными обстоятельствами и освобождают VWR от обязательства поставки.

Права интеллектуальной собственности

Все права интеллектуальной собственности на продукты и услуги, возникающие в связи с ними, принадлежат VWR.

Заказчик признает, что в отношении любых прав на интеллектуальную собственность третьих лиц использование Заказчиком любых таких прав интеллектуальной собственности зависит от получения VWR письменной лицензии от соответствующего лицензиара на таких условиях, которые дают VWR право лицензировать такие права на Клиент.

Все материалы поставщика являются исключительной собственностью VWR.

Конфиденциальность

Заказчик должен хранить в строгой тайне все технические или коммерческие ноу-хау, спецификации, изобретения, процессы или инициативы, которые носят конфиденциальный характер и были раскрыты VWR, его сотрудниками, агентами или субподрядчиками, а также любую другую конфиденциальную информацию, касающуюся Бизнес VWR, его продукты и услуги, которые может получить заказчик. Заказчик должен раскрывать такую ​​конфиденциальную информацию только тем из своих сотрудников, агентов и субподрядчиков, которым она необходима для выполнения своих обязательств в соответствии с настоящими условиями и положениями, и должен гарантировать, что такие сотрудники, агенты и субподрядчики соблюдают свои обязательства. изложены в этом пункте, как если бы они были стороной этих условий.

Защита данных

VWR International защищает личные данные Клиента. Клиент имеет право на доступ, изменение, исправление и удаление личных данных, которые он / она сообщает VWR. Заказчик может воспользоваться этим правом, отправив письменный запрос в VWR.

Обращение с отходами / обработка

В целях борьбы с загрязнением и обеспечения соблюдения применимого законодательства VWR перерабатывает отходы мебельного оборудования, электрического и электронного оборудования, внося финансовый вклад в экологические организации.

Экспорт

Для продажи на экспорт наши цены указаны.

Настоящие Общие положения и условия продажи применяются к продажам в Ирландии. Если Заказчик желает экспортировать продукцию, он обязуется обратиться в экспортный отдел VWR. Любой экспорт продукции VWR должен осуществляться в соответствии с применимыми нормативными актами (включая экспортный контроль и соблюдение антикоррупционных законов) и под его собственную ответственность. Продукты, которые мы продаем, упакованы для отправки в Ирландию.В случае экспорта и под его ответственность Заказчик несет ответственность за обеспечение того, чтобы выполняемая им переупаковка соответствовала правилам.

При продаже на экспорт цены указаны на условиях франко-завод. Требуется минимум заказа. Ниже этой суммы клиенту будет выставлен счет по фиксированной ставке комиссии за обработку.

Антикоррупция

Клиент заявляет, что он знаком и понимает положения Закона США о борьбе с коррупцией за рубежом от 1977 г. («US FCPA») и что он будет соблюдать FCPA США и все другие применимые законы и нормативные акты по борьбе со взяточничеством или коррупцией. любой другой страны или юрисдикции, которые применимы к деловой деятельности сторон.

Здоровье и безопасность

Заказчик несет ответственность за соблюдение всех применимых норм в области здравоохранения, безопасности и других норм и за принятие соответствующих мер в отношении хранения, обращения, продажи и использования продуктов.

Ввиду опасностей, связанных с определенными химическими веществами и аппаратурой, заказчик должен убедиться, что приобретенные продукты находятся в безопасном состоянии и что существует безопасная система работы с учетом всей доступной информации. Ни один из продаваемых продуктов не предназначен для употребления в пищу, если иное не указано четко.

В связи с широким спектром использования химикатов и аппаратов, заказчик будет нести единоличную ответственность за определение пригодности и спецификации продуктов, услуг, информации и рекомендаций для его целей. VWR имеет право без предварительного уведомления поставлять продукты, характеристики, источники и размеры упаковки которых отличаются от опубликованных или заказанных.

Применимый закон

Настоящие положения и условия, а также любые споры или претензии (включая внедоговорные споры или претензии), возникающие из или в связи с ним, его предметом или образованием, регулируются и толкуются в соответствии с законодательством Ирландии.

Юрисдикция

Каждая сторона безоговорочно соглашается с тем, что суды Ирландии обладают исключительной юрисдикцией для урегулирования любых споров или претензий (включая внедоговорные споры или претензии), возникающих из или в связи с контрактом, его предметом или заключением.

Протоколы

- Лаборатория Унтергассера

Протоколы

Препарат ДНК - из бактерий

ДНК-Минипреп. - Быстрое кипячение
Мой любимый протокол для подготовки.ДНК от кишечной палочки, если у вас более 12 образцы его быстрее, чем коммерческий комплект.

DNA-Miniprep - Щелочной лизис
Мой любимый протокол для подготовки. ДНК из Agrobacterium, также отлично подходит для кишечной палочки.

DNA-Miniprep - Щелочной лизис для BAC
Мой любимый протокол для подготовки. BACs. В него внесены незначительные изменения в предыдущий протокол.

DNA-Miniprep - Быстрый и грязный щелочной лизис
Протокол очень быстрого щелочного лизиса.Это популярно, потому что вы просто заливаете растворители.

ДНК-Максипреп - Щелочной лизис
Мой любимый протокол для максипрепов. На это нужно время, но вы получаете огромное количество ДНК.

Препарат ДНК

DNA Miniprep с использованием CTAB
Лучший протокол для получения большого количества ДНК из растительного материала.

Препарат РНК

Тризол в сочетании с Колонками
Лучший протокол для получения большого количества РНК, который также является чистым.

RNA Miniprep с использованием горячего фенола
Опасный протокол для извлечения РНК из всех видов тканей.

RNA Miniprep с использованием CTAB
Лучший протокол для получения большого количества РНК из растительного материала.

RNA Miniprep с использованием 2-бутоксиэтанола
Лучший протокол для получения РНК из материала, богатого фенолами, сахарами или окислителями.

РНК Midiprep с использованием 2-бутоксиэтанола
Лучший протокол для получения РНК из материала, богатого фенолами, сахарами или окислителями.

Общие методы клонирования

Перевязка
Как сделать успешную перевязку. Это базовый протокол.

Отдельные РНК и ДНК
Мой любимый протокол получения чистой ДНК или РНК - или того и другого! Это просто работает.

Синтез кДНК с верхним индексом II
Мой любимый протокол синтеза кДНК. Немного берет, но работает отлично.

Создание искусственного фрагмента ДНК (димера)
Как сделать фрагмент ДНК с выбранной вами последовательностью.Полезно для создания нескольких сайтов клонирования.

Клонирование с использованием технологии шлюза (на основе системы Invitrogen)

TOPO-Reaction
Как провести успешную реакцию TOPO с вектором pENTR-D / Topo от invitrogen.

Шлюз BP-Reaction II
Как сделать клон pENTR из продукта ПЦР и клона pDONR.

Классический LR-Reaction II
Как сделать окончательный клон из одного клона pENTR и одного клона pDEST.

Множественная реакция шлюза II без Mastermix
Как сделать окончательный клон из трех клонов pENTR и одного клона pDEST.

Множественная реакция шлюза II с использованием Mastermix
Как сделать окончательный клон из трех клонов pENTR и одного клона pDEST.

Компетентные ячейки

Запасы стартового глицерина
Как приготовить стартовый запас глицерина, чтобы ускорить производство компетентных клеток.

Подготовка химически компетентных клеток
Как сделать хорошие химически компетентные клетки.

Трансформация химически компетентных клеток
Как трансформировать химически компетентные клетки.

Подготовка электрокомпетентных клеток
Как сделать хорошие электрокомпетентные клетки.

Трансформация электро-компетентных клеток
Как трансформировать электрокомпетентные клетки.

Аднеовирусные векторы

Клонирование аденовирусных векторов
Некоторые моменты, которые следует учитывать, если вы начинаете клонировать аденовирусный вектор.

Производство аденовирусных векторов
Как производить аденовирусные векторы, исходя из плазмиды.

Титрование аденовирусных векторов
Как титровать аденовирусные векторы, чтобы определить их концентрацию.

Получение аденовирусных векторов для применения на подопытных животных
Хороший метод получения аденовирусных векторов для подопытных животных.

Клонирование с использованием технологии шлюза первого поколения

Старые протоколы шлюза, использующие первую версию ферментов, были буферными и фермент был предоставлен отдельно. Из-за более низкой стабильности я бы не рекомендовал использовать эти протоколы.

Шлюз BP-Reaction
Как сделать клон pENTR из продукта ПЦР и клона pDONR.

Classic LR-Reaction
Как сделать окончательный клон из одного клона pENTR и одного клона pDEST.

Множественный шлюз
Как сделать окончательный клон из трех клонов pENTR и одного клона pDEST.

Шлюз ® , TOPO ® , pENTR TM , pDONR TM , pDEST TM BP-клоназа TM и LR-клоназа TM являются охраняемыми товарными знаками Invitrogen.

[PDF] Система экспрессии бакуловирусов с технологией шлюза

1 Руководство по эксплуатации Система экспрессии бакуловирусов с векторами назначения, адаптированными к шлюзу для клонирования ...

Руководство по эксплуатации Система экспрессии бакуловирусов

с Gateway® Technology Gateway®-адаптированными целевыми векторами для клонирования и высокоуровневой экспрессии рекомбинантных белков в каталогах бакуловирусов №№ 11827-011, 11806-015, 11804-010, 11807-013 Версия E 22 ноября 2004 г. 25-0516 На этот продукт распространяется лицензия с этикеткой ограниченного использования (см. Уведомление покупателя).Используя этот продукт, вы принимаете условия Лицензии на ограниченное использование.

ii

Содержание

Содержание ..................................... .................................................. .................. ................................ ...... iii Состав и хранение ....................................... .................................................. .......................................... v Дополнительные принадлежности ..................................................... .................................................. .................................... vii

Введение .......... .................................................. .................................................. .... 1 Обзор ............................................ .................................................. .................................................. ............... 1 Система экспрессии бакуловирусов Bac-to-Bac® .......................................................... .......................................... 3 Обзор эксперимента ..... .................................................. .................................................. ............................. 5

Методы ................. .................................................. .................................................. ... 7 Культивирование клеток насекомых ........................................... ........................................................................................... .... 7 Создание клона записи ......................................... .................................................. ...................................... 8 Создание клона выражения ....... .................................................. .................................................. ................. 9 Проведение реакции рекомбинации LR ........................... .................................................. .................... 13 Transforming Library Efficiency® DH5α ™ клеток ...................................... .................................................. .... 15 Анализ трансформантов ........................................... ................................ .................. .................................... 16 Экспрессия вашего белка с помощью экспрессии бакуловируса Bac-to-Bac® Система .................................... 18 Тестирование экспрессии ......... .................................................. ....................................................... ..................... 19 Очистка рекомбинантного белка ........................ .................................................. ....................................... 21

Приложение ....... .................................................. .................................................. .......... 23 Карта pDEST ™ 8 .................................. .................................................. ............................................................ 23 Карта pDEST ™ 10 ....................... .................................................. .................................................. ................... 24 Карта pDEST ™ 20 ......................... .................................................. .................................................. ................. 25 Особенности pDEST ™ 8, pDEST ™ 10 и pDEST ™ 20 .................. .................................................. .................... 26 Карта pENTR ™ -gus ....................................................... .................................................. ................................ 27 Техническое обслуживание ............... .................................................. .................................................. ............................. 28 Уведомление покупателя .................. .................................................. .................................................. ................ 30 Политика распространения клонов Gateway® .......................................................... .................................................. ... 32 Квалификация продукции ........................................... . .................................................. .......................................... 33 Список литературы ...... .................................................. .................................................. ................................................. 34

iii

iv

Состав комплекта и типы хранения комплектов

Это руководство поставляется со следующими продуктами: Комплект

Каталожный номер.®

Система экспрессии бакуловирусов с технологией шлюза

11827-011

®

11804-010

®

11806-015

000

000

000

pDEST 8 Vector Gateway pDEST 10 Vector Gateway pDEST 20 Vector

Компоненты набора

Каждый продукт содержит следующие компоненты. Подробное описание содержимого каждого компонента см. На следующей странице.Каталожный номер

Компонент

11827-011 11804-010 11806-015 11807-013 pDEST 8 Vector

pDEST ™ 10 Vector

pDEST ™ 20 Vector

Gateway® LR Clonase ™ II Enzyme Mix

®

Эффективность библиотеки DH5α Компетентная E. coli

Транспортировка / хранение

Система экспрессии бакуловирусов с технологией Gateway® поставляется, как описано ниже.После получения храните каждую коробку, как указано ниже. Коробка 1 2 3

Компонент

Транспортировка

pDEST Vectors ®

Шлюз LR Clonase II Enzyme Mix ®

Эффективность библиотеки DH5α Химически компетентный

Набор для хранения

E. coli

температура

-20 ° C

Сухой лед

-20 ° C

Сухой лед

-80 ° C

Примечание: отдельные векторы Gateway® pDEST ™ (каталожные номера.11804-010, 11806-015, 11807-013) отправляются при комнатной температуре. После получения хранить при -20 ° C.

продолжение на следующей странице

v

Комплект поставки и хранение, продолжение Векторы назначения

Следующие векторы назначения (блок 1) поставляются с системой экспрессии бакуловирусов с технологией Gateway®. Храните векторы при -20 ° C. Примечание: Каталожные номера. 11804-010, 11806-015, 11807-013 содержат только 6 мкг соответствующего лиофилизированного вектора pDEST ™.

Реагент

Количество

Лиофилизированный в буфере ТЕ, pH 8.0

6 мкг

Лиофилизированный в буфере ТЕ, pH 8,0

6 мкг

Лиофилизированный в буфере ТЕ, pH 8,0

6 мкг

pDEST 8 Vector

pDEST 10 Vector 9 Смесь ферментов LR Clonase ™ II

Состав

Следующие реагенты поставляются со смесью ферментов Gateway® LR Clonase ™ II (вставка 2). Храните Box 2 при -20 ° C до 6 месяцев. Для длительного хранения хранить при -80 ° C. Реагент

Состав

Количество

Смесь ферментов LR Clonase ™ II

Запатентованная

40 мкл

Протеиназа K

2 мг / мл в:

40 мкл

-HCl 10 мМ Tris 7.5 20 мМ CaCl2 50% глицерин ™

pENTR -gus Positive Control

DH5α ™ Competent E. coli

50 нг / мкл в буфере TE, pH 8,0

20 мкл

The Library Efficiency® DH5α ™ Competent E. coli (вставка 3) включает следующие предметы. Эффективность трансформации ≥ 1 x 108 КОЕ / мкг ДНК. Храните Box 3 при -80 ° C. Реагент

Состав

S.O.C. Среда

2% триптон

(можно хранить при комнатной температуре или + 4 ° C)

0.5% дрожжевой экстракт

Количество 2 x 6 мл

10 мМ NaCl 2,5 мМ KCl 10 мМ MgCl2 10 мМ MgSO4 20 мМ глюкозы

Library Efficiency® Химически компетентный DH5α ™

-

5 x 200 мкл

93

Контрольная ДНК

10 пг / мкл в 5 мМ Трис-HCl, 0,5 мМ ЭДТА, pH 8,0

50 мкл

Генотип DH5α ™ F-recA1 endA1 hsdR17 (rk-, mk +) supE44 λ- thi-1 gyrA96 relA1

vi

Дополнительные продукты Введение

Продукты, перечисленные в этом разделе, предназначены для использования с системой экспрессии бакуловирусов с технологией Gateway®.Для получения дополнительной информации посетите наш веб-сайт www.invitrogen.com или позвоните в службу технической поддержки (см. Стр. 28).

Дополнительные продукты

Следующие продукты доступны отдельно от Invitrogen. Продукт

Количество

Каталожный номер

Эффективность библиотеки DH5α Химически компетентные клетки

5 x 0,2 мл

18263-012

Смесь ферментов LR Clonase ™ II

20 реакций

11791-020

100 реакций

11791-1002

10362-010

MAX КПД Dh20Bac Компетентный E.coli

5 x 100 мкл

10361-012

Express Five® SFM

1000 мл

10486-025

Sf-900 II SFM (1X) жидкость

500 мл

10902-096

®

Cellfectin Reagent ®

Замороженные клетки High Five Замороженные клетки Sf9 Замороженные клетки Sf21

6

3 x 10 клеток / мл

B825-01

7

1 мл, 10 клеток / мл 1 мл, 10 клеток / мл

B821-01

6 очисток

K850-01

ProBond Nickel-Chelating Resin

50 мл

R801-01

Колонки для очистки (полипропиленовые колонки 10 мл)

50 колонок

R640-50

Система очистки Ni-NTA

6 очисток

K950-01

1,0002 12575

-015

1 0,000 единиц

12575-023

Система очистки ProBond

AcTEV Protease

vii

viii

Введение Обзор Введение

Система экспрессии бакуловирусов с технологией Gateway® позволяет вам выразить интересующий вас ген линии клеток с использованием системы экспрессии Bac-to-Bac® Baculovirus.Для получения дополнительной информации о системе экспрессии бакуловируса Bac-to-Bac® см. Стр. 3. В наборе используется технология Gateway® для создания клона экспрессии путем рекомбинации исходного клона, содержащего интересующий ген, с выбранным вектором назначения (pDEST ™). . Дополнительную информацию о технологии Gateway® см. На следующей странице. В зависимости от выбранного вектора векторы pDEST ™ позволяют получать нативные или меченные N-концом рекомбинантные белки (см. Таблицу ниже). Вектор

Характеристики векторов назначения

Fusion Peptide

Fusion Tag

pDEST ™ 8

---

---

pDEST ™ 10

N-terminal

6xHis

™ 200002

N-концевой

Глутатион-S-трансфераза (GST) (Smith et al., 1986)

pDEST ™ 8, pDEST ™ 10 и pDEST ™ 20 обладают следующими характеристиками: •

Промотор гена полиэдрина из вируса мультиъядерного полиэдроза Autographa californica (AcMNPV) для высокого уровня экспрессии интересующего гена ( Possee and Howard, 1987)

Элементы Mini-Tn7 для сайт-специфической транспозиции в бакмидную ДНК, размноженную в E. coli (Craig, 1989; Luckow et al., 1993)

N-концевое слияние теги для обнаружения и очистки рекомбинантных слитых белков (выбор тега зависит от конкретного вектора; см. выше)

Два сайта рекомбинации, attR1 и attR2, для рекомбинационного клонирования интересующего гена из начального клона

Ген устойчивости к хлорамфениколу, расположенный между двумя сайтами attR для контрселекции

Ген ccdB, расположенный между двумя сайтами attR для отрицательной селекции

Полиа SV40 сигнал денилирования для эффективной терминации транскрипции и полиаденилирования мРНК

Ген устойчивости к ампициллину для отбора трансформантов в E.coli

Ген устойчивости к гентамицину для отбора трансформантов, содержащих рекомбинантную бакмидную ДНК

Ориджин pUC для высококопийной репликации и поддержания плазмиды в E. coli

Для получения дополнительной информации и карт этих векторов, см. страницы 23-26. продолжение на следующей странице

1

Обзор, продолжение Технология Gateway®

Технология Gateway® - это универсальный метод клонирования, который использует преимущества сайт-специфичных рекомбинационных свойств бактериофага лямбда (Landy, 1989) для обеспечения быстрого и качественного эффективный способ перенести интересующий ген в несколько систем экспрессии.Чтобы выразить интересующий ген с помощью технологии Gateway®: 1.

Клонируйте интересующий ген в выбранный вектор входа Gateway® для создания входного клона.

2.

Выполните реакцию рекомбинации LR между исходным клоном и вектором-получателем Gateway® (например, pDEST ™ 8, pDEST ™ 10, pDEST ™ 20).

3.

Transform Library Efficiency® DH5α E. coli и отбор клона экспрессии.

4.

Используйте свой экспрессирующий клон в системе экспрессии бакуловируса Bac-to-Bac® для создания рекомбинантного бакуловируса, который экспрессирует ваш рекомбинантный белок.

Для получения более подробной информации о технологии Gateway®, обратитесь к руководству по технологии Gateway® с Clonase ™ II. Это руководство поставляется с системой экспрессии бакуловирусов с технологией Gateway®, а также доступно для загрузки с нашего веб-сайта (www.invitrogen.com) или обратившись в службу технической поддержки (см. Стр. 28).

Реакция рекомбинации LR

2

Вы проведете реакцию рекомбинации LR между входным клоном и выбранным целевым вектором для создания экспрессионного клона.Реакция рекомбинации LR опосредуется смесью ферментов LR Clonase ™ II, смесью белков бактериофага λ интегразы (Int) и эксцизионазы (Xis), а также белка фактора интеграции E. coli (IHF). Для получения дополнительной информации о реакции рекомбинации LR см. Руководство по технологии Gateway® с Clonase ™ II.

Система экспрессии бакуловирусов Bac-to-Bac® Введение

Система экспрессии бакуловирусов Bac-to-Bac® - это быстрый и эффективный метод создания рекомбинантных бакуловирусов.Этот метод основан на сайт-специфической транспозиции экспрессионной кассеты в бакуловирусный челночный вектор (бакмиду), размножаемый в E. coli (Ciccarone et al., 1997; Luckow et al., 1993). Для получения дополнительных сведений об этой системе см. Руководство по системе экспрессии бакуловирусов Bac-to-Bac® и руководство по системам векторной экспрессии бакуловирусов. Эти руководства можно загрузить с нашего веб-сайта www.invitrogen.com или обратившись в службу технической поддержки (см. Стр. 28).

Преимущества использования сайт-специфической транспозиции

Использование сайт-специфической транспозиции для вставки чужеродных генов в бакмиду, размноженную в E.coli имеет следующие преимущества перед созданием рекомбинантных бакуловирусов в клетках насекомых с использованием гомологичной рекомбинации:

Baculovirus Shuttle Vector

Устраняет необходимость в многократных раундах очистки бляшек, поскольку ДНК рекомбинантного вируса, выделенная из выбранных колоний, не смешивается с родительский нерекомбинантный вирус

Требуется менее 2 недель для идентификации и очистки рекомбинантного вируса по сравнению с 4-6 неделями, необходимыми для создания рекомбинантного бакуловируса с использованием гомологичной рекомбинации

Позволяет быстро и одновременно изолировать несколько рекомбинантных вирусов и подходит для экспрессии вариантов белков для исследований структуры / функций

В системе экспрессии бакуловирусов Bac-to-Bac® используется бакуловирусный челночный вектор (бакмида), bMON14272 (136 т.п.н.).Бакмида содержит репликон mini-F с низким числом копий, маркер устойчивости к канамицину и сегмент ДНК, кодирующий пептид LacZα из вектора клонирования на основе pUC. Короткий сегмент, содержащий сайт прикрепления бактериального транспозона Tn7 (mini-attTn7), вставлен в N-конец гена lacZα бакмиды. Эта вставка не нарушает рамку считывания пептида LacZα. Бакмида размножается в E. coli Dh20Bac ™ в виде большой плазмиды, которая придает устойчивость к канамицину и может дополнять делецию lacZ, присутствующую на хромосоме, с образованием колоний синего цвета (Lac +) в присутствии хромогенного субстрата, такого как Bluo-gal или X-gal и индуктор IPTG.Рекомбинантные бакмиды (составные бакмиды) получают путем транспонирования элемента mini-Tn7 из донорской плазмиды (векторы pDEST ™) на сайт связывания mini-attTn7 на бакмиде. Функции транспозиции Tn7 обеспечиваются вспомогательной плазмидой (см. Ниже). См. Схему на следующей странице для схематического представления системы экспрессии бакуловируса Bacto-Bac®.

Вспомогательная плазмида

Вспомогательная плазмида pMON7124 (13,2 т.п.н.) обеспечивает функцию транспозиции Tn7 в транс (Barry, 1988).Вспомогательная плазмида присутствует в Dh20Bac ™ и придает устойчивость к тетрациклину и кодирует транспозазу. продолжение на следующей странице

3

Система экспрессии бакуловирусов Bac-to-Bac®, продолжение Векторы pDEST ™

Каждый вектор pDEST ™ имеет mini-Tn7, содержащий кассету экспрессии. Каждая кассета экспрессии состоит из гена устойчивости к гентамицину, промотора полиэдрина из AcMNPV для экспрессии белков в клетках насекомых, кассеты клонирования Gateway® (attR1, ген устойчивости к хлорамфениколу, ген ccdB и attR2) и вставленный сигнал поли (A) SV40. между левым и правым плечом Tn7.Важные особенности векторов pDEST ™ описаны на страницах 1 и 26. Интересующий ген клонируется в кассету клонирования Gateway® векторов pDEST ™ с использованием вектора входа (см. Страницу 8). Транспозиция mini-Tn7 из вектора pDEST ™ в сайт присоединения mini-attTn7 на бакмиде нарушает экспрессию гена lacZα, что приводит к образованию белых колоний рекомбинантной бакмиды на фоне синих колоний, содержащих неизмененную родительскую бакмиду. Рекомбинантная бакмидная ДНК быстро выделяется из небольших культур белых колоний и затем используется для трансфекции клеток насекомых.Исходные вирусы (> 106 БОЕ / мл) собирают из трансфицированных клеток и используют для заражения свежих клеток насекомых с целью экспрессии, очистки и анализа белка (см. Диаграмму ниже).

На рисунке ниже показано образование рекомбинантного бакуловируса и экспрессия интересующего вас гена с использованием системы экспрессии бакуловируса Bac-to-Bac®. Иностранный ген

Entry Clone X pDEST ™

(содержащий интересующий вас ген)

Клонирование Gateway®

Tn7L

Expression Clone

Transformation Expression clone

mini-attTn7

P PH Tn

P PH Tn Helper mid

Bac

Выбор транспозиционного антибиотика

lacZ

Схема системы экспрессии Bac-to-Bac®

Foreign Gene

pPolh

Expression Clone

Competent Dh20Bac ™ E.coli

E. coli (LacZ -), содержащие рекомбинантную бакмиду

Мини-препарат высокомолекулярной ДНК

или

Определить титр вируса с помощью анализа бляшек

Частицы рекомбинантного бакуловируса Трансфицировать клетки насекомых

с помощью Cellfect

Клетки насекомых

Экспрессия рекомбинантного гена или вирусная амплификация

4

Рекомбинантная бакмидная ДНК

Обзор эксперимента Схема эксперимента

На рисунке ниже описаны шаги, необходимые для клонирования и экспрессии интересующего гена с использованием pDEST ™ 8, pDEST ™ 10, или pDEST ™ 20.Вектор pDEST ™ + входной клон

Экспрессионный клон

Gateway® Трансформируется в клетки MAX Efficiency® Dh20Bac ™ (содержащие бакмиду и хелпер) Колонии E. coli с рекомбинантной бактериальной реакцией (необязательно) Проверенные колонии E. coli с рекомбинантной бактерией Изолят рекомбинантная бакмидная ДНК Рекомбинантная Бакмидная ДНК Трансфицировать клетки насекомых с помощью реагента Cellfectin® Исходный рекомбинантный бакуловирус P1 (> 106 БОЕ / мл) Заразить клетки насекомых для амплификации исходного материала рекомбинантного бакуловируса P2 (> 107 БОЕ / мл) Титровать и инфицировать клетки насекомых Экспрессия белка

продолжение на следующей странице

5

Обзор эксперимента, продолжение Поставляемые материалы Вам потребуются следующие реагенты и предметы: Пользователь • Исходный клон, содержащий интересующий ген (см. Стр. 8) •

Клеточные линии насекомых (см. Стр. 7)

Среда для клеток насекомых

Реагент Cellfectin®

Соответствующие планшеты и колбы для тканевых культур

90 002 •

Стерильные микроцентрифужные пробирки (1.5 мл)

MAX Efficiency® Dh20Bac ™ Химически компетентная E. coli (информацию для заказа см. На странице vii)

Если вы заказали отдельные векторы Gateway® pDEST ™, вам потребуется:

6

Смесь ферментов LR Clonase ™ II (см. Стр. Vii)

Library Efficiency® DH5α ™ Химически компетентные клетки или соответствующие компетентные клетки (см. Стр. Vii).

Методы культивирования клеток насекомых Введение

Перед тем, как приступить к экспериментам по клонированию, убедитесь, что у вас растут культуры клеток Sf9, Sf21 или High Five ™ и имеются замороженные основные исходные материалы.

Клетки для трансфекции

Для успешной трансфекции вам потребуются клетки лог-фазы с жизнеспособностью> 95%. Обратитесь к руководству Bac-to-Bac® Baculovirus Expression System, чтобы определить, сколько клеток вам понадобится для трансфекции.

Руководство по линиям клеток насекомых

Для получения дополнительной информации о культуре клеток насекомых см. Руководство по линиям клеток насекомых и Руководство по системам векторов экспрессии бакуловирусов и методам культивирования клеток насекомых. Эти руководства содержат информацию о: •

Размораживание замороженных клеток

Поддержание и пассирование клеток

Замораживание клеток

Использование бессывороточной среды

Растущие клетки в суспензии •

Масштабирование клеточных культур

Эти руководства доступны для загрузки с нашего веб-сайта www.invitrogen.com или вы можете запросить руководства в Технической службе (см. стр. 28).

7

Создание начального клона Введение

Чтобы рекомбинировать интересующий ген в pDEST ™ 8, pDEST ™ 10 или pDEST ™ 20, вам понадобится входной клон, содержащий интересующий ген. Многие входные векторы доступны от Invitrogen для облегчения создания входных клонов (см. Таблицу ниже). Для получения дополнительной информации о каждом переносчике посетите наш веб-сайт (www.invitrogen.com) или обратитесь в службу технической поддержки (см. Стр. 28).Vector ®

pENTR / D-TOPO

Кат. K2400-20

®

pENTR / SD / D-TOPO

K2420-20

11813-011

11816-014

11817-012

-010

11819-018

pENTR 1A pENTR 2B pENTR 3C pENTR 4 pENTR 11

После того, как вы выбрали вектор входа, обратитесь к руководству по конкретному вектору входа, который вы используете, для получения инструкций по построению записи клон.Все руководства по входным векторам можно загрузить с нашего веб-сайта или связавшись с технической службой.

Рекомендации по клонированию

Важно иметь правильно спроектированный входной клон до рекомбинации с вектором назначения. См. Таблицу ниже и область рекомбинации на страницах 10–12. Если вы хотите… ..

8

Тогда….

рекомбинируйте ваш входной клон с pDEST ™ 8

ваша вставка должна содержать стартовый кодон ATG для правильной инициации трансляции и стоп-кодон.

включает тег 6xHis (pDEST ™ 10)

Входной клон должен быть сконструирован таким образом, чтобы гарантировать, что интересующий ген находится в рамке с тегом ATG и 6xHis после рекомбинации и должен содержать стоп-кодон.

включает тег слияния GST (pDEST ™ 20)

Входной клон должен быть разработан таким образом, чтобы гарантировать, что интересующий ген находится в рамке с тегом ATG и GST после рекомбинации и должен содержать стоп-кодон.

Создание экспрессионного клона Введение

После того, как вы сгенерировали исходный клон, вы выполните реакцию рекомбинации LR для переноса интересующего гена в вектор pDEST ™ для создания вашего экспрессионного клона.Чтобы гарантировать получение наилучших возможных результатов, мы рекомендуем вам прочитать этот раздел и следующий раздел, озаглавленный «Выполнение реакции рекомбинации LR», страницы 13–14, прежде чем начать.

Схема эксперимента

Для создания клона экспрессии вам необходимо:

Важно

1.

Провести реакцию рекомбинации LR с использованием клона входа, содержащего attL, и вектора pDEST ™, содержащего attR. Примечание. И клон входа, и вектор назначения должны быть суперспиральными (см. Важное примечание ниже).

2.

Превратите реакционную смесь в подходящего хозяина E. coli (см. Стр. 15).

3.

Отбор клонов для экспрессии (см. Страницы 10–12 для иллюстраций области рекомбинации экспрессионных клонов в pDEST ™ 8, pDEST ™ 10 или pDEST ™ 20).

Векторы pDEST ™ 8, pDEST ™ 10 и pDEST ™ 20 поставляются в виде суперспиральных плазмид. Хотя Invitrogen ранее рекомендовал использовать линеаризованный вектор-адресат для более эффективной рекомбинации, дальнейшие испытания показали, что линеаризация этих векторов НЕ требуется для получения оптимальных результатов для любого последующего приложения.

Ресуспендирование векторов

Каждый вектор pDEST ™ поставляется в виде 6 мкг плазмиды, лиофилизированной в ТЕ, pH 8,0. Для использования ресуспендируйте плазмиду pDEST ™ в 40 мкл стерильной воды до конечной концентрации 150 нг / мкл.

Размножение векторов

Если вы хотите размножить и поддерживать векторы pDEST ™ 8, pDEST ™ 10 или pDEST ™ 20 до рекомбинации, мы рекомендуем использовать химически компетентную E. coli One Shot® ccdB Survival T1R (каталожный номер. C7510-03) от Invitrogen для трансформации.Штамм ccdB Survival T1R E. coli устойчив к эффектам CcdB и может поддерживать размножение плазмид, содержащих ген ccdB. Для поддержания целостности вектора отбирайте трансформанты в средах, содержащих 50-100 мкг / мл ампициллина и 15-30 мкг / мл хлорамфеникола. Примечание. Не используйте обычные штаммы клонирования E. coli, включая TOP10 или DH5α, для размножения и поддержания, поскольку эти штаммы чувствительны к эффектам CcdB.

продолжение на следующей странице

9

Создание экспрессионного клона, продолжение Область рекомбинации pDEST ™ 8

Область рекомбинации экспрессионного клона, полученного из начального клона pDEST ™ 8x, показана ниже.Полную последовательность pDEST ™ 8 можно загрузить с нашего веб-сайта www.invitrogen.com или из службы технической поддержки (см. Стр. 28). Карта и описание характеристик pDEST ™ 8 см. На страницах 23 и 26. Характеристики области рекомбинации:

60

Заштрихованные области соответствуют последовательностям ДНК, перенесенным из исходного клона в pDEST ™ 8 путем рекомбинации. Незаштрихованные области получены из pDEST ™ 8.

Нуклеотиды, фланкирующие заштрихованную область, соответствуют основаниям 167 и 1991, соответственно, pDEST ™ 8.транскрипции начало

ATAAATAAGT ATTTTACTGT TTTCGTAACA GTTTTGTAAT AAAAAAACCT ATAAATATTC CGGATTATTC TATTTATTCA TAAAATGACA AAAGCATTGT CAAAACATTA TTTTTTTGGA TATTTATAAG GCCTAATAAG 167

PPH 130 ATACCGTCCC ACCATCGGGC GCGGATCATC ACAAGTTTGT ACAAAAAAGC AGGCTNN ------------ NACCCAGCTT ГЕНА TATGGCAGGG TGGTAGCCCG CGCCTAGTAG TGTTCAAACA TGTTTTTTCG TCCGANN ------------ NTGGGTCGAA attB1

1991

TCTTGTACAA AGTGGTGATA GCTTGTCGAG AAGTACTAGA GGATCATAAT CAGCCATACC ACATTTGTAG AGGTTTTACT AGAACATGTT TCACCACTAT CGAACAGCTC TTCATGATCT CCTAGTATTA GTCGGTATGG TGTAAACATC TCCAAAATGA attB2

продолжение на следующей странице

10

Создание списка Клон экспрессии, продолжение Область рекомбинации pDEST ™ 10

Область рекомбинации экспрессионного клона, полученного из клона pDEST ™ 10 x начального уровня, показана ниже.Полную последовательность pDEST ™ 10 можно загрузить с нашего веб-сайта www.invitrogen.com или из службы технической поддержки (см. Стр. 28). Карту и описание характеристик pDEST ™ 10 см. На страницах 24 и 26. Характеристики области рекомбинации:

155

Заштрихованные области соответствуют последовательностям ДНК, перенесенным из исходного клона в pDEST ™ 10 путем рекомбинации. Незаштрихованные области получены из pDEST ™ 10.

Нуклеотиды, фланкирующие заштрихованную область, соответствуют основаниям 344 и 2168, соответственно, pDEST ™ 10.транскрипция начинают

AATAAGTATT TTACTGTTTT CGTAACAGTT TTGTAATAAA AAAACCTATA AATATTCCGG ATTATTCATA CCGTCCCACC TTATTCATAA AATGACAAAA GCATTGTCAA AACATTATTT TTTTGGATAT TTATAAGGCC TAATAAGTAT GGCAGGGTGG

PPH

6х Его тег

Met Ser Tyr Tyr Его His His Его Его Его Asp Tyr Asp Ile Pro Thr Thr 235 ATCGGGCGCG GATCTCGGTC CGAAACC ATG TCG TAC TAC CAT CAC CAT CAC CAT CAC GAT TAC GAT ATC CCA ACG ACC TAGCCCGCGC CTAGAGCCAG GCTTTGG TAC AGC ATG ATG GTA GTG GTA GTG GTA GTG CTA ATG CTA TAG GGT TGC TGG 9000 Сайт распознавания 9000 GTu2 Phe Gln Gly Ile Thr Ser Leu Tyr Lys Lys Ala Gly 313 GAA AAC CTG TAT TTT CAG GGC ATC ACA AGT TTG TAC AAA AAA GCA GGC TNN -------------- NACCCAGCTT GENE CTT TTG GAC ATA AAA GTC CCG TAG TGT TCA AAC ATG TTT TTT CGT CCG ANN -------------- NTGGGTCGAA TEV-сайт расщепления

2168

attB1

TCTTGTACAA AGTGGTGATT CCATGGATTC GGAATTCAGACACACTACGACCACCACGACCA GTACCTAGG CCTTAAGTTT CCGGATGCAG CTGCTCGAGT attB2

продолжение на следующей странице

11

Создание экспрессионного клона, продолжение Рекомбинационная область pDEST ™ 20

Ниже показана область рекомбинации экспрессионного клона, полученного из входного клона pDEST ™ 20x.Полную последовательность pDEST ™ 20 можно загрузить с нашего веб-сайта www.invitrogen.com или из службы технической поддержки (см. Стр. 28). Карта и описание функций pDEST ™ 20 см. На страницах 25–26. Характеристики области рекомбинации: •

Заштрихованные области соответствуют последовательностям ДНК, перенесенным из исходного клона в pDEST ™ 20 путем рекомбинации. Незаштрихованные области получены из pDEST ™ 20.

Нуклеотиды, фланкирующие заштрихованную область, соответствуют основаниям 849 и 2532, соответственно, pDEST ™ 20.

Указан ген глутатион-S-трансферазы (GST).

65

начало транскрипции

AAATAAGTATTT TACTGTTTTC GTAACAGTTT TGTAATAAAA AAACCTATAA ATATTCCGGA TTATTCATAC

P

137

PH Met Ser Pro IleGAC GALGAC GALGAC LGCGLGLGTGLGTGLGTGLGLGLGTYCGLGLGTYCGLGTYCGLGLGLY TGG AAA ATT AAG GGC CTT GTG CAA

206

Pro Thr Arg Leu Leu Leu Glu Tyr Leu Glu Glu Lys Tyr Glu Glu His Leu Tyr Glu Arg Asp Glu CCC ACT CGA CTT CTT TTG GAA TAT CTT GAA GAA AA Glu CAT TTG TAT GAG CGC GAT GAA

272

Gly Asp Lys Trp Arg Asn Lys Lys Phe Glu Leu Gly Leu Glu Phe Pro Asn Leu Pro Tyr Tyr Ile GGT GAT AAA TGG CGA ATAC AAA AAG TTT GAA TTG GG GG AAT CTT CCT TAT TAT ATT

338

Asp Gly Asp Val Lys Leu Thr Gln Ser Met Ala Ile Ile Arg Tyr Ile Ala Asp Lys His Asn Met GAT GGT GAT GTT AAA TTA ACA CAG TCT ATG GCC ATC ATA GCT TGT GAC AAG CAC AAC ATG

404

Leu Gly Gly Cys Pro Lys Glu Arg Ala Glu Ile Ser Met Leu Glu Gly Ala Val Leu Asp Ile Arg TTG GGT GGT TGT CCA AAA GAG CGT GCA GAG ATT TCA ATG CTT GAA GGA GCG GTT TTG GAT ATT AGA

470

9000 Val2 Tyr Ile Ala Tyr Ser Lys Asp Phe Glu Thr Leu Lys Val Asp Phe Leu Ser Lys TAC GGT GTT TCG AGA ATT GCA TAT AGT AAA GAC TTT GAA ACT CTC AAA GTT GAT TTT CTT AGC AAG

536

Leu Pro Glu Met Leu Met Phe Glu Asp Arg Leu Cys His Lys Thr Tyr Leu Asn Gly Asp His CTA CCT GAA ATG CTG AAA ATG TTC GAA GAT CGT TTA TGT CAT AAA ACA TAT TTA AAT GGT GAT CAT

602

Val Thr His Pro Asp P Leu Tyr Asp Ala Leu Asp Val Val Leu Tyr Met Asp Pro Met Cys GTA ACC CAT CCT GAC TTC ATG TTG TAT GAC GCT CTT GAT GTT GTT TTA TAC ATG GAC CCA ATG TGC

668

CTG GAT GCG TTC CCA AAA TAT TGT TTT AAA AAA CGT ATT GAA GCT ATC CCA CAA ATT GAT AAG

734

Tyr Leu Lys Ser Lys Tyr Ile Ala Trp Pro Leu Gln Gly Trp Gln Ala Thr Ph e Gly Gly Gly TAC TTG AAA TCC AGC AAG TAT ATA GCA TGG CCT TTG CAG GGC TGG CAA GCC ACG TTT GGT GGT GGC 849

S-трансфераза глутатиона

Leu Asp Ala Phe Pro Lys Leu Val Cys Ala Ile Pro Gln Ile Asp Lys

800

Asp His Pro Lys Ser Asp Leu Val Pro Arg His Asn Gln Thr Ser Leu Tyr Lys Lys Ala Gly GAC CAT CCT CCA AAA TCG GAT CTG GTT CCG CGT CAT AAT CAA ACA AGT TTG TAC AAA AAA GCA GGC CTA GAC CAA GGC GCA GTA TTA GTT TGT TCA AAC ATG TTT TTT CGT CCG 2532 attB1 TNN --- --- --- NACCCAGCTT TCTTGTACAA AGTGGTTTGA TAGCTTNGTCG AGAAGTACATA GENGATCATA --- --- - NTGGGTCGAA AGAACATGTT TCACCAAACT ATCGAACAGC TCTTCATGAT CTCCTAGTAT attB2

12

Выполнение реакции рекомбинации LR Введение

После того, как вы создали клон записи, содержащий интересующий ген, и соответствующий клон рекомбинации LR готовы к реакции вектор pDEST ™, и для преобразования реакционную смесь в Library Efficiency® DH5α ™ для отбора клона экспрессии.Важно, чтобы все необходимое было настроено и готово к использованию, чтобы обеспечить наилучшие результаты. Мы предлагаем вам прочитать этот раздел и раздел под названием Transforming Library Efficiency® DH5α ™ Cells, стр. 15, перед тем, как начать. Мы также рекомендуем вам включить в свой эксперимент положительный контроль (см. Ниже) и отрицательный контроль (без LR Clonase ™ II).

Положительный контроль

Плазмида pENTR ™ -gus включена в систему экспрессии бакуловирусов с технологией Gateway® для использования в качестве положительного контроля для рекомбинации и экспрессии LR.Использование входного клона pENTR ™ -gus в реакции рекомбинации LR с любым вектором pDEST ™ позволит вам сгенерировать клон экспрессии, содержащий ген, кодирующий β-глюкуронидазу (gus).

Ферментная смесь LR Clonase ™ II

Ферментная смесь LR Clonase ™ II поставляется с набором (только каталожный номер 11827-011) или доступна отдельно от Invitrogen для катализа реакции рекомбинации LR. Смесь ферментов LR Clonase ™ II сочетает в себе запатентованный состав фермента и реакционный буфер 5X LR Clonase ™, ранее поставлявшийся в виде отдельных компонентов в ферментной смеси LR Clonase ™, в оптимизированный однопробирочный формат для упрощения настройки реакции рекомбинации LR.Используйте протокол, представленный на стр. 14, для проведения реакции рекомбинации LR с использованием ферментной смеси LR Clonase ™ II. Примечание. При желании вы можете выполнить реакцию рекомбинации LR, используя смесь ферментов LR Clonase ™. Чтобы использовать смесь ферментов LR Clonase ™, следуйте протоколу, прилагаемому к продукту. Не используйте протокол для смеси ферментов LR Clonase ™ II, приведенный в этом руководстве, поскольку условия реакции различаются.

Необходимые материалы

Перед началом работы убедитесь, что у вас есть следующие предметы: •

Начальный клон, содержащий интересующий ген (50–150 нг / мкл в TE, pH 8.0)

вектор pDEST ™ (150 нг / мкл в TE, pH 8,0)

pENTR ™ -gus положительный контроль (при желании, поставляется со смесью ферментов LR Clonase ™ II, коробка 2; 50 нг / мкл в TE, pH 8,0)

Смесь ферментов LR Clonase ™ II (коробка 2, хранить при -20 ° C непосредственно перед использованием)

TE Buffer, pH 8,0 (10 мМ Tris- HCl, pH 8,0, 1 мМ ЭДТА)

Раствор протеиназы К (поставляется со смесью ферментов LR Clonase ™ II; разморозить и держать на льду до использования)

Водяная баня с температурой 37 ° C

1.Микроцентрифужные пробирки на 5 мл (продолжение на следующей странице)

13

Выполнение реакции рекомбинации LR, продолжение Реакция рекомбинации LR

Следуйте этой процедуре, чтобы выполнить реакцию рекомбинации LR между исходным клоном и вектором назначения. Если вы хотите включить отрицательный контроль, настройте отдельную реакцию, но не используйте смесь ферментов LR Clonase ™ II. 1.

Добавьте следующие реагенты в микроцентрифужные пробирки на 1,5 мл при комнатной температуре и перемешайте. Компонент

Образец

Положительный контроль

Начальный клон (50-150 нг / реакция)

1-7 мкл

-

Целевой вектор (150 нг / мкл)

1 мкл

1 мкл

pENTR -gus (50 нг / мкл)

-

2 мкл

1X TE Buffer, pH 8.0

до 8 мкл

5 мкл

2.

Удалите смесь ферментов LR Clonase ™ II с -20 ° C и разморозьте на льду (2 минуты).

3.

Перемешайте фермент LR Clonase ™ II на вортексе дважды (по 2 секунды каждый раз).

4.

К каждому образцу добавьте 2 мкл ферментной смеси LR Clonase ™ II. Хорошо перемешайте пипеткой вверх и вниз. Напоминание: немедленно доведите смесь ферментов LR Clonase ™ II до -20 ° C.

5.

Инкубируйте реакции при 25 ° C в течение 1 часа.Примечание: для большинства приложений 1 час дает достаточное количество колоний для анализа. В зависимости от ваших потребностей продолжительность реакции рекомбинации может быть увеличена до 18 часов. Для больших плазмид (≥ 10 т.п.н.) более длительная инкубация даст больше колоний.

6.

Добавьте 1 мкл раствора протеиназы К в каждую реакцию. Инкубируйте 10 минут при 37 ° C.

7.

Переходите к преобразованию клеток Library Efficiency® DH5α ™, следующая страница. Примечание. При желании вы можете хранить LR-реакцию при -20 ° C до 1 недели перед трансформацией.

14

Transforming Library Efficiency® DH5α ™ Клетки Введение

После того, как вы выполнили реакцию рекомбинации LR, вы трансформируете компетентную E. coli. Library Efficiency® DH5α ™ Химически компетентные E. coli (вставка 3) включены в систему экспрессии бакуловирусов для облегчения трансформации.

Хозяин E. coli

Если вы заказали отдельные векторы Gateway® pDEST ™, вам потребуются компетентные E. coli. Мы рекомендуем вам размножать векторы, содержащие вставки в E.coli с дефицитом recA и endA, такие как TOP10 (каталожный номер C404003) или DH5α ™ -T1R (каталожный номер 12297-016). Избегайте использования штамма E. coli, содержащего F 'эписому. Эпизома F 'содержит ген ccdA и предотвращает отрицательный отбор клона с ccdB.

Материалы, предоставленные пользователем

Перед началом работы вам потребуются следующие предметы: •

LB планшетов, содержащих 100 мкг / мл ампициллина (по две для каждой трансформации; нагревание при 37 ° C в течение 30 минут)

42 Водяная баня, ° C

Инкубатор со встряхиванием, 37 ° C

Library Efficiency® DH5α ™ Химически компетентный E.coli (см. стр. vii) или соответствующие компетентные клетки (см. выше)

S.O.C. Среда

Компетентные клетки

Library Efficiency® DH5α ™ поставляются в 5 пробирках, каждая из которых содержит 0,2 мл компетентных клеток. Каждая пробирка содержит достаточно компетентных клеток для проведения 4 трансформаций с использованием 50 мкл клеток на трансформацию. После того, как вы разморозили пробирку с компетентными клетками, выбросьте все неиспользованные клетки. Не замораживайте клетки повторно, так как повторное замораживание / оттаивание приведет к потере эффективности трансформации.

Протокол трансформации

1.

Для каждой трансформации поместите аликвоты по 50 мкл химически компетентных клеток Library Efficiency® DH5α ™ в стерильную микроцентрифужную пробирку.

2.

Добавьте 1 мкл реакции рекомбинации LR (из шага 7, предыдущая страница) в пробирку, содержащую 50 мкл компетентных клеток Library Efficiency® DH5α ™, и осторожно перемешайте. Не смешивайте пипеткой вверх и вниз.

3.

Инкубируйте на льду в течение 30 минут.

4.

Тепловой разряд батареи в течение 30 секунд при 42 ° C без встряхивания.

5.

Немедленно перенесите пробирки на лед.

6.

Добавьте 450 мкл S.O.C. комнатной температуры. Середина.

7.

Плотно закройте пробирку и встряхните пробирку в горизонтальном направлении (200 об / мин) при 37 ° C в течение 1 часа.

8.

Нанесите 20 мкл и 100 мкл каждой трансформации на предварительно нагретый селективный планшет и инкубируйте в течение ночи при 37 ° C. Обычно мы помещаем на чашки 2 разных объема, чтобы убедиться, что хотя бы в одной чашке есть хорошо расположенные колонии.

Эффективная реакция рекомбинации LR должна давать сотни колоний (> 5000 колоний, если вся реакция LR трансформирована и засеяна).

15

Анализ трансформантов Анализ положительных результатов 1. Выберите 5 колоний (из шага 8, предыдущая страница) и культивируйте их в течение ночи в среде LB или SOB, содержащей 100 мкг / мл ампициллина. Клоны

Анализ трансформантов с помощью ПЦР

2.

Выделите плазмидную ДНК с помощью выбранного вами метода. Мы рекомендуем использовать S.Набор N.A.P. ™ MiniPrep (№ по каталогу K1900-01) или набор для очистки мини-плазмиды PureLink ™ HQ (№ по каталогу K2100-01), доступные от Invitrogen.

3.

Проанализируйте плазмиды рестрикционным анализом, чтобы подтвердить наличие вставки.

Вы также можете анализировать положительные трансформанты с помощью ПЦР. Для праймеров ПЦР используйте праймер, который гибридизуется с вектором, и праймер, который гибридизуется с вашей вставкой. Вам нужно будет определить условия усиления. Если вы впервые используете эту технику, возможно, вы захотите выполнить анализ ограничений параллельно.Артефакты могут быть получены из-за неправильной заливки или загрязнения шаблона. Приведенный ниже протокол предоставлен для вашего удобства. Подойдут и другие протоколы. Необходимые материалы: PCR SuperMix High Fidelity (Invitrogen, Каталожный номер 10790-020). Соответствующие праймеры для прямой и обратной ПЦР (20 мкМ каждый). Процедура: 1.

Для каждого образца, аликвотируйте 48 мкл PCR SuperMix High Fidelity в 0,5 мл микроцентрифужная пробирка. Добавьте по 1 мкл каждого праймера для прямой и обратной ПЦР.

2.

Выберите 5 колоний и ресуспендируйте их по отдельности в 50 мкл праймеров, содержащих PCR SuperMix (не забудьте сделать пластырь, чтобы сохранить колонии для дальнейшего анализа).

3.

Инкубируйте реакцию в течение 10 минут при 94 ° C, чтобы лизировать клетки и инактивировать нуклеазы.

4.

Усиление от 20 до 30 циклов.

5.

Для окончательного продления инкубируйте при 72 ° C в течение 10 минут. Хранить при + 4 ° C.

6.

Визуализируйте электрофорезом в агарозном геле.

Подтверждение экспрессии клона

Ген ccdB мутирует с очень низкой частотой, что приводит к очень низкому количеству ложноположительных результатов. Истинные клоны экспрессии будут устойчивы к ампициллину и чувствительны к хлорамфениколу.Трансформанты, содержащие плазмиду с мутантным геном ccdB, будут устойчивы как к ампициллину, так и к хлорамфениколу. Чтобы проверить свой предполагаемый клон экспрессии, проверьте рост на чашках LB, содержащих 30 мкг / мл хлорамфеникола. Истинный клон экспрессии не будет расти в присутствии хлорамфеникола.

Секвенирование

Чтобы убедиться, что интересующий ген находится в рамке с соответствующими тегами, вы можете захотеть секвенировать свою экспрессионную конструкцию. продолжение на следующей странице

16

Анализ трансформантов, продолжение Долгосрочное хранение

После подтверждения того, что у вас есть правильный клон экспрессии, подготовьте запас глицерина для длительного хранения.Мы также рекомендуем хранить запас плазмидной ДНК при -20 ° C. Чтобы приготовить глицериновую основу: 1.

Вырастите штамм E. coli, содержащий плазмиду, в течение ночи в селективной среде.

2.

Соедините 0,85 мл ночной культуры с 0,15 мл стерильного глицерина.

3.

Перемешайте и перенесите в криопробирку с этикетками.

4.

Заморозьте пробирку в жидком азоте или бане сухой лед / этанол и храните при -80 ° C.

17

Экспрессия вашего белка с помощью системы экспрессии бакуловируса Bac-to-Bac® Введение

После получения клона экспрессии вы готовы преобразовать его в химически компетентный E.coli и экспрессируйте свой белок в желаемой клеточной линии насекомых с помощью системы экспрессии Bac-to-Bac® Baculovirus Expression.

Подготовка плазмидной ДНК

Приготовьте плазмидную ДНК из выбранного экспрессионного клона для трансформации. Мы рекомендуем выделять плазмидную ДНК с помощью набора S.N.A.P. ™ MiniPrep (каталожный номер K1900-01), набора для очистки мини-плазмиды PureLink ™ HQ (каталожный номер K210001) или центрифугирования в градиенте CsCl.

Поставляемые материалы Перед запуском вам понадобятся следующие предметы: Пользователь • Линия клеток насекомых (см. Стр. 7)

Bac-to-Bac® Экспрессия бакуловируса

Соответствующие среды для культивирования клеток

Cellfectin ® Реагент (информацию для заказа см. На стр. Vii)

MAX Efficiency® Dh20Bac ™ Химически компетентный E.coli (информацию для заказа см. на стр. vii)

Подробные сведения о протоколах для выполнения действий, описанных ниже, см. в руководстве Bac-to-Bac® Baculovirus Expression System. Для получения дополнительной информации о системе экспрессии бакуловирусов Bac-to-Bac® и методах культивирования клеток насекомых, обратитесь к Руководству по системам векторов экспрессии бакуловирусов и методам культивирования клеток насекомых. Эти руководства доступны на нашем веб-сайте www.invitrogen.com или в службе технической поддержки (см. Стр. 28). Вам нужно будет выполнить следующие шаги, чтобы выразить интересующий белок из экспрессируемого клона с использованием системы экспрессии Bac-to-Bac® Baculovirus Expression System.

18

1.

Трансформируют плазмидную ДНК из экспрессирующего клона в химически компетентную E. coli MAX Efficiency® Dh20Bac ™.

2.

Выделить рекомбинантную бакмидную ДНК. Проверьте транспозицию на бакмиду с помощью ПЦР-анализа.

3.

Трансфекция желаемой линии клеток насекомых рекомбинантной бакмидной ДНК с использованием реагента Cellfectin®.

4.

Соберите рекомбинантный бакуловирус. Не забудьте хранить запасы вирусов при температуре + 4 ° C, в защищенном от света месте.Для длительного хранения хранить при -80 ° C.

5.

Увеличьте запасы вирусов.

6.

Титруйте вирусный запас и заразите клетки насекомых рекомбинантными бакуловирусными частицами, используя оптимальную MOI.

7.

Собирают клетки или среду через 24, 48, 72 и 96 часов после заражения и анализируют экспрессию (см. Следующую страницу).

Тестирование экспрессии Введение

В этом разделе представлены инструкции по тестированию экспрессии вашего белка и белка, экспрессированного из вектора положительного контроля, pENTR ™ gus.

Электрофорез в полиакриламидном геле

Чтобы облегчить отделение экспрессированного белка с помощью электрофореза в полиакриламидном геле, Invitrogen предлагает широкий спектр предварительно отлитых полиакриламидных гелей NuPAGE® и Novex® Tris-Glycine. Кроме того, Invitrogen также предлагает большой выбор стандартов белков молекулярной массы и наборов для окрашивания. Для получения дополнительной информации о подходящих гелях, стандартах и ​​красителях для визуализации вашего рекомбинантного белка посетите наш веб-сайт (www.invitrogen.com) или позвоните в службу технической поддержки (см. стр. 28).

Вестерн-анализ

Чтобы определить экспрессию вашего белка с помощью вестерн-блоттинга, вы можете использовать антитело к интересующему вас белку. Наборы WesternBreeze® Chromogenic Kits и WesternBreeze® Chemiluminescent Kits доступны от Invitrogen для облегчения обнаружения антител колориметрическими или хемилюминесцентными методами. Для получения дополнительной информации посетите наш веб-сайт (www.invitrogen.com) или позвоните в службу технической поддержки (см. Стр. 28).

Анализ экспрессии рекомбинантными вирусами

Анализ экспрессии рекомбинантного вируса проводят в 24-луночных планшетах, используя исходный вирус, собранный через 72 часа после заражения.

Анализ β-глюкуронидазы

1.

Посев 6 x 105 клеток насекомых на лунку в 24-луночном планшете. Позвольте клеткам прикрепиться не менее 30 минут.

2.

Промойте клетки один раз свежей средой и замените 300 мкл свежей среды.

3.

Добавьте 200 мкл вирусного исходного раствора в каждую лунку.Включите элементы управления, которые содержат неинфицированные клетки, инфицированные клетки дикого типа.

4.

Инкубируйте планшет при 27 ° C в течение 48 часов.

5.

Удалите вирусный супернатант и сохраните для анализа.

6.

Промойте клетки SFM и лизируйте клетки 400 мкл буфера для образцов 1X SDS-PAGE.

7.

Кипятите образцы в течение 3 минут. Загрузите 20 мкл образца в соответствующий полиакриламидный гель и проведите электрофорез.

Анализ активности β-глюкуронидазы (gus) из вектора положительного контроля pENTR ™ -gus описан в руководстве Bac-to-Bac® Baculovirus Expression System для проверки реакции рекомбинации и экспрессии.продолжение на следующей странице

19

Тестирование экспрессии, продолжение Экспрессия вашего белка с помощью N-концевой метки увеличит размер вашего рекомбинантного белка. В таблице ниже указано увеличение молекулярной массы вашего рекомбинантного слитого белка, которое следует ожидать от метки в каждом векторе pDEST ™. Обязательно учтите любые дополнительные аминокислоты между тегом слияния и началом вашего белка. Вектор

Ожидаемое увеличение размера (кДа)

N-терминал

4.3

N-терминал

27,8

pDEST 10 pDEST 20

20

Fusion Tag

Очистка рекомбинантного белка Введение

Наличие N-терминала 6xHis 10 в теге pDEST ™ 10 позволяет очищать рекомбинантный гибридный белок с использованием никель-хелатирующей смолы, такой как ProBond ™ или NiNTA, в то время как присутствие N-концевой GST-метки в pDEST ™ 20 позволяет очищать рекомбинантный гибридный белок с использованием глутатион-агарозы.

Очистка 6xHisTagged рекомбинантных белков

Смола ProBond ™ и Ni-NTA доступны отдельно от Invitrogen (информацию для заказа см. На стр. Vii). Подходят и другие металлохелатирующие смолы. •

Чтобы очистить ваш гибридный белок с помощью ProBond ™ или Ni-NTA, обратитесь к соответствующим руководствам по системе очистки ProBond ™ или системе очистки Ni-NTA. Оба руководства можно загрузить с нашего веб-сайта (www.invitrogen.com) или обратившись в службу технической поддержки (см. Стр. 28).

Чтобы очистить ваш гибридный белок с помощью другой хелатирующей металл смолы, обратитесь к инструкциям производителя.

Очистка 6xHis-меченых белков из среды Для очистки 6xHis-меченых рекомбинантных белков из культуральной среды мы рекомендуем стадию диализа или ионообменной хроматографии перед аффинной хроматографией на металлхелатирующих смолах. Диализ позволяет: •

Удаление компонентов среды, которые отделяют Ni + 2 от металлхелатных смол

Ионообменная хроматография позволяет: •

Удаление компонентов среды, которые удаляют Ni + 2 из металлхелатных смол

Концентрация образца для облегчения манипуляций на последующих этапах очистки

Условия успешной ионообменной хроматографии будут различаться в зависимости от белка.Для получения дополнительной информации см. Current Protocols in Protein Science (Coligan et al., 1998), Current Protocols in Molecular Biology, Unit 10 (Ausubel et al., 1994) или Guide to Protein Purification (Deutscher, 1990).

Многие белки клеток насекомых от природы богаты гистидинами, а некоторые содержат участки по шесть гистидинов. При использовании металлохелатирующей смолы для очистки 6xHistagged белков эти богатые гистидином белки могут очищаться совместно с интересующим вас белком. Загрязнение может быть значительным, если ваш белок экспрессируется на низком уровне.Мы рекомендуем вам добавить 5 мМ имидазола в связывающий буфер перед добавлением белковой смеси в колонку. Добавление имидазола может помочь снизить фоновое загрязнение, предотвращая связывание белков с низкой специфичностью со смолой, хелатирующей металл. продолжение на следующей странице

21

Очистка рекомбинантного белка, продолжение Очистка с использованием глутатион-агарозы

Если вы экспрессируете свой рекомбинантный белок в виде слияния с тегом GST в pDEST ™ 20, вы можете аффинно очистить свой белок с помощью глутатион-агарозы.Обратитесь к инструкциям производителя, чтобы очистить ваш белок.

Использование протеазы AcTEV ™

Протеаза AcTEV ™ - это сайт-специфическая протеаза, распознающая семь аминокислотных последовательностей; Glu-As-Le-Tyr-Ph-Gln-Gly. Сайт расщепления находится между Gln и Gly (Dougherty et al., 1989). Рекомбинантная протеаза AcTEV ™ доступна от Invitrogen (см. Стр. Vii). Используйте протеазу AcTEV ™, чтобы отщепить метку 6x His из гибридного белка, созданного с использованием pDEST ™ 10, после очистки рекомбинантного белка на никельхелатной смоле.Рекомбинантная протеаза AcTEV ™ разработана с 6-кратным His-тегом для облегчения удаления фермента из образца белка после переваривания. Примечание. После расщепления TEV на N-конце вашего белка останется не менее 10 аминокислот (см. Диаграмму на стр. 11).

Для получения подробных протоколов см. Руководство по AcTEV ™ Protease, доступное на нашем веб-сайте www.invitrogen.com, или обратившись в службу технической поддержки (см. Стр. 28).

22

Приложение Карта pDEST ™ 8 На приведенном ниже рисунке обобщены характеристики вектора pDEST ™ 8 (6526 п.н.).Более подробное описание каждой функции см. На стр. 26. Полную последовательность действий pDEST ™ 8 можно получить на нашем веб-сайте (www.invitrogen.com) или в службе технической поддержки (см. Стр. 28). Этот вектор не был полностью секвенирован. Он был составлен на основе опубликованных данных о последовательностях и фактических данных о последовательностях. Если вы подозреваете ошибку, обратитесь в службу технической поддержки (см. Стр. 28).

cin my at en

PPH

SV

ori

40

pUC

pDEST ™ 8 6526 bp m

A Характеристики pDESTTM8 6526 нуклеотидов

9000 R

9000 R 9000 R

ccdB attR2

Tn 7

pDEST ™ 8 Map

pi

c il

li n

f1

Tn7

L

AcMNPV 16084 Промоутер полиэдрина: основания 43–152 Ген устойчивости к хлорамфениколу: основания 534-1193, ген ccdB: основания 1535-1840 сайт рекомбинации attR2: основания 1881-2005 Сигнал позднего полиаденилирования SV40: основания 2093-2271 Левое плечо Tn7: основания 2300-2484 Межгенная область f1: основания 2648-3103 промотор bla : основания 3136-3240 ORF устойчивости к ампициллину (bla): основания 3235-4095 происхождение pUC: основания 4470-4750 Tn7 правая рука: основания 5157-5381 ORF устойчивости к гентамицину: основания 5448-5981 (C) Прокариотический промотор: основания 6170-6197 ( C) (C) = Дополнительная нить

23

Карта pDEST ™ 10 Карта pDEST ™ 10

На приведенном ниже рисунке показаны характеристики вектора pDEST ™ 10 (6708 п.н.).Более подробное объяснение каждой функции см. На стр. 26. Полную последовательность выполнения pDEST ™ 10 можно получить на нашем веб-сайте (www.invitrogen.com) или в службе технической поддержки (см. Стр. 28). Этот вектор не был полностью секвенирован. Он был составлен на основе опубликованных данных о последовательностях и фактических данных о последовательностях. Если вы подозреваете ошибку, обратитесь в службу технической поддержки (см. Стр. 28).

en

n yci m ta

ccdB attR2

PPH

SV

ori

m

A

Характеристики pDESTTM10 6708 нуклеотидов

pi

pi промотор: основания 115-244 6xHis-тег: основания 274-291 Сайт расщепления TEV: основания 313-333 Сайт рекомбинации attR1: основания 337-461 Ген устойчивости к хлорамфениколу: основания 711-1370 Ген ccdB: основания 1712-2017 Сайт рекомбинации attR2: основания 2058 -2182 SV40 сигнал позднего полиаденилирования: основания 2304-2540 Tn7 левая рука: основания 2563-2757 Межгенная область F1: основания 2922-3377 промотор bla: основания 3410-3514 Устойчивость к ампициллину ORF (bla): основания 3509-4369 происхождение pUC: основания 4510 -5164 Tn7 правая рука: основания 5432-5655 Устойчивость к гентамицину ORF: основания 5722-6255 (C) Прокариотический промотор: основания 6444-6471 (C) (C) = комплементарная цепь

24

pA

pUC

pDEST ™ 10 6708 п.н.

40

тн 7

R

G

6xHis TEV attR1 CmR

f1

Tn7

L

Карта pDEST ™ 20 На рисунке ниже обобщены характеристики вектора pDEST ™ 20 (7066 бит / с).Более подробное описание каждой функции см. На следующей странице. Полная последовательность pDEST ™ 20 доступна на нашем веб-сайте (www.invitrogen.com) или в службе технической поддержки (см. Стр. 28). Этот вектор не был полностью секвенирован. Он был составлен на основе опубликованных данных о последовательностях и фактических данных о последовательностях. Если вы подозреваете ошибку, обратитесь в службу технической поддержки (см. Стр. 28).

en

n yc im ta

PPH

m

A

TM

SV

ori

Особенности нуклеотидов pDEST 7066

20

9000 bUC3

pA

R

G

GST attR1 CmR ccdB attR2

Tn 7

pDEST ™ 20 Map

pi

c il

li n

9000

f1N

polyhed

f1 промотор: основания 46-153 GST ORF: основания 161-832 сайт рекомбинации attR1: основания 842-966 Ген устойчивости к хлорамфениколу: основания 1075-1734 Ген ccdB: основания 2076-2381 Сайт рекомбинации attR2: основания 2422-2546 Сигнал позднего полиаденилирования SV40: основания 2636-2814 Левое плечо Tn7: основания 2846-3027 f1 Межгенная область: основания 3191-3646 Промотор bla: основания 3679-3783 Устойчивость к ампициллину ORF (bla): основания 3778-4638 Происхождение pUC: основания 5013-5293 Правая рука Tn7: основания 5701 -5924 Гентамицин резист ORF: основания 5991-6524 (C) Прокариотический промотор: основания 6713-6740 (C) (C) = комплементарная цепь

25

Характеристики pDEST ™ 8, pDEST ™ 10 и pDEST ™ 20 Характеристики

Особенности pDEST ™ 8 (6526 п.н.), pDEST ™ 10 (6708 п.о.) и pDEST ™ 20 (7066 п.н.) описаны ниже.Все функции прошли функциональное тестирование. Характеристики

Функция

Промотор полиэдрина

Обеспечивает эффективную высокоуровневую экспрессию вашего рекомбинантного белка (Possee and Howard, 1987).

Элемент Mini-Tn7 (Tn7R и Tn7L)

Позволяет сайт-специфичную транспозицию интересующего вас гена в бакмиду, размножающуюся в E. coli (Craig, 1989; Luckow et al., 1993).

N-концевая метка 6xHis (только в pDEST 10)

Позволяет очистить ваш рекомбинантный белок на металл-хелатирующих смолах, таких как ProBond ™.

Тег N-концевой глутатион-S-трансферазы (GST)

Позволяет проводить аффинную очистку рекомбинантного слитого белка с использованием глутатион-агарозы.

(только в pDEST ™ 20) Сайт расщепления TEV ™

(только в pDEST 10)

26

Позволяет удалить N-концевую полигистидиновую метку из рекомбинантного белка с помощью протеазы AcTEV ™ (Carrington and Dougherty , 1988).

сайтов attR1 и attR2

ДНК-рекомбинационные последовательности, полученные из бактериофага λ, которые позволяют рекомбинационное клонирование интересующего гена из входного клона Gateway® (Landy, 1989).

Ген устойчивости к хлорамфениколу

Позволяет встречный отбор экспрессирующего клона.

ген ccdB

Разрешает отрицательный отбор.

Последовательность полиаденилирования SV40

Эффективное терминация транскрипции и полиаденилирование мРНК.

pUC origin

Обеспечивает репликацию и поддержание высокого уровня копий в E. coli.

Промотор bla

Обеспечивает экспрессию гена устойчивости к ампициллину.

Ген устойчивости к ампициллину (bla)

Позволяет отобрать трансформанты у E.coli.

Ген устойчивости к гентамицину

Позволяет отобрать трансформанты, содержащие рекомбинантную бакмидную ДНК.

Карта pENTR ™ -gus Описание

pENTR ™ -gus представляет собой входной клон размером 3841 п.н., содержащий ген Arabidopsis thaliana для β-глюкуронидазы (gus) (Kertbundit et al., 1991). Ген gus амплифицировали с использованием праймеров для ПЦР. содержащие сайты рекомбинации attB. Амплифицированный продукт ПЦР затем использовали в реакции рекомбинации BP с pDONR ™ 201 для создания исходного клона.Для получения дополнительной информации о реакции рекомбинации БП см. Руководство по технологии Gateway® с Clonase ™ II.

Карта управляющего вектора

На рисунке ниже обобщены характеристики вектора pENTR ™ -gus. Полную последовательность и сайты расщепления рестрикционными ферментами для pENTR ™ -gus можно получить на нашем веб-сайте (www.invitrogen.com) или обратившись в службу технической поддержки (см. Стр. 28).

s gu

Kanam ycin

attL1

pENTR-gus 3841 bp pU C

attL 2

Комментарии для pENTR-gusTM 3841 нуклеотид

TM

или 9000-198000 оснований комплементарная цепь) ген gus: основания 228-2039 attL2: основания 2041-2140 происхождение pUC: основания 2200-2873 (C) Ген устойчивости к канамицину: основания 2990-3805 (C) C = комплементарная цепь

27

Техническая служба по всему миру Интернет

Посетите веб-ресурс Invitrogen с помощью веб-браузера.На сайте вы можете: • получить информацию о наших горячих новинках и специальных предложениях •

Просмотреть и загрузить векторные карты и последовательности

Загрузить руководства в формате Adobe® Acrobat® (PDF)

Изучите наш каталог с полноцветной графикой

Получите ссылки на продукты Invitrogen

Запросите каталог и литературу по продукту

После подключения к Интернету запустите веб-браузер (Internet Explorer 5.0 или новее или Netscape 4.0 или новее), затем введите следующий адрес (или URL): http://www.invitrogen.com ... и программа подключится напрямую. Щелкните подчеркнутый текст или выделенную графику для изучения. Не забудьте поставить закладку на нашем сайте для удобства пользования!

Свяжитесь с нами

Для получения дополнительной информации или технической помощи звоните, пишите, факс или электронную почту. Дополнительные международные офисы перечислены на нашей веб-странице (www.invitrogen.com).

Штаб-квартира компании:

Штаб-квартира в Японии:

Штаб-квартира в Европе:

Invitrogen Corporation 1600 Faraday Avenue Carlsbad, CA

USA

Invitrogen Japan K.K. Nihonbashi Hama-Cho Park Bldg. 4F 2-35-4, Hama-Cho, Nihonbashi

Invitrogen Ltd Inchinnan Business Park 3 Fountain Drive Paisley PA4 9RF, UK

Тел .: 1 760 603 7200

Тел .: 81 3 3663 7972

Тел: +44 ( 0) 141 814 6100

Телефон (бесплатный): 1 800 955 6288

Факс: 81 3 3663 8242

Технический факс: +44 (0) 141 814 6117

Факс: 1 760 602 6500

E- почта: [электронная почта защищена]

Электронная почта: [электронная почта защищена]

Электронная почта: [электронная почта защищена]

Запросы паспортов безопасности материалов

Чтобы запросить паспорта безопасности материалов, посетите наш веб-сайт по адресу www.invitrogen.com. На главной странице перейдите в «Технические ресурсы», выберите «MSDS» и следуйте инструкциям на странице. продолжение на следующей странице

28

Техническое обслуживание, продолжение Ограниченная гарантия

Invitrogen стремится предоставлять своим клиентам товары и услуги высокого качества. Наша цель - сделать так, чтобы каждый покупатель был на 100% доволен нашей продукцией и нашим обслуживанием. Если у вас возникнут какие-либо вопросы или опасения по поводу продукта или услуги Invitrogen, свяжитесь с нашими представителями службы технической поддержки.Invitrogen гарантирует, что все его продукты будут работать в соответствии со спецификациями, указанными в сертификате анализа. Компания бесплатно заменит любой продукт, не соответствующий этим спецификациям. Настоящая гарантия ограничивает ответственность Invitrogen Corporation только стоимостью продукта. Гарантия не предоставляется на продукты, срок годности которых истек. Гарантия не распространяется, если все компоненты продукта не хранятся в соответствии с инструкциями. Invitrogen оставляет за собой право выбирать методы, используемые для анализа продукта, если Invitrogen не соглашается на указанный метод в письменной форме до принятия заказа.Invitrogen прилагает все усилия для обеспечения точности своих публикаций, но понимает, что случайные типографские или другие ошибки неизбежны. Поэтому Invitrogen не дает никаких гарантий относительно содержания каких-либо публикаций или документации. Если вы обнаружите ошибку в какой-либо из наших публикаций, сообщите об этом нашим представителям службы технической поддержки. Invitrogen не несет ответственности за какие-либо особые, случайные, косвенные или косвенные убытки или ущерб.Вышеуказанная ограниченная гарантия является единственной и исключительной. Никаких других гарантий, явных или подразумеваемых, включая какие-либо гарантии товарной пригодности или пригодности для определенной цели, не предоставляется.

29

Уведомление покупателя Введение

Использование Baculovirus Expression System с технологией Gateway® покрывается лицензиями, подробно описанными ниже.

Лицензия с этикеткой на ограниченное использование № 19: Продукты для клонирования Gateway®

Этот продукт и его использование регулируются одним или несколькими U.S. Патенты №№ 5,888,732, 6,143,557, 6,171,861, 6,270,969 и 6,277,608 и / или другие находящиеся на рассмотрении заявки на патенты США и других стран, принадлежащие Invitrogen Corporation. Покупка этого продукта дает покупателю непередаваемое право использовать приобретенное количество продукта и его компонентов в исследованиях, проводимых покупателем (независимо от того, является ли покупатель академическим или коммерческим субъектом). Покупка этого продукта не означает лицензию на какой-либо метод в вышеуказанных патентах или патентных заявках, а также на использование этого продукта с любыми сайтами рекомбинации, кроме тех, которые были приобретены у Invitrogen Corporation или ее авторизованного дистрибьютора.Право на использование методов, заявленных в вышеупомянутых патентах или патентных заявках с этим продуктом, только в исследовательских целях может быть получено только путем использования ClonaseTM, приобретенного у Invitrogen Corporation или ее официальных дистрибьюторов. Покупатель не может изменять последовательность (и) рекомбинации, содержащуюся в этом продукте, для каких-либо целей. Покупатель не может продавать или иным образом передавать (а) этот продукт, (б) его компоненты или (в) материалы, изготовленные с использованием этого продукта или его компонентов, третьей стороне или иным образом использовать этот продукт или его компоненты или материалы, изготовленные использование этого продукта или его компонентов в коммерческих целях.Покупатель может передать информацию или материалы, полученные с помощью этого продукта, научному сотруднику, при условии, что такая передача не предназначена для какой-либо коммерческой цели, и что такой сотрудник соглашается в письменной форме (а) не передавать такие материалы какой-либо третьей стороне, и (б) использовать такие переданные материалы и / или информацию исключительно в исследовательских целях, а не в коммерческих целях. Несмотря на вышесказанное, любой покупатель, работающий в академическом или государственном учреждении, может передавать материалы, изготовленные с помощью этого продукта, третьей стороне, имеющей лицензию Invitrogen в соответствии с указанными выше патентами на распространение таких материалов.Передача таких материалов и / или информации сотрудникам не дает прав на использование каких-либо методов, заявленных в вышеупомянутых патентах или патентных заявках. Коммерческие цели означают любую деятельность стороны, подлежащую рассмотрению, и могут включать, помимо прочего: (1) использование продукта или его компонентов в производстве; (2) использование продукта или его компонентов для предоставления услуги, информации или данных; (3) использование продукта или его компонентов в терапевтических, диагностических или профилактических целях; или (4) перепродажа продукта или его компонентов, независимо от того, перепродаются ли такой продукт или его компоненты для использования в исследованиях.Invitrogen Corporation не будет предъявлять претензии покупателю о нарушении вышеуказанных патентов на основании производства, использования или продажи терапевтического, клинического диагностического, вакцины или профилактического продукта, разработанного покупателем в ходе исследования, в котором этот продукт или его компоненты использовались. при условии, что ни один из (i) этого продукта, (ii) любого из его компонентов или (iii) пункта формулы вышеупомянутых патентов, не использовался при производстве такого продукта. Invitrogen Corporation не будет выдвигать иск против покупателя о нарушении вышеуказанных патентов, основанных на использовании этого продукта для производства белка для продажи, при условии, что при производстве такого протеина не использовался способ, заявленный в вышеуказанных патентах.Если покупатель не желает принимать ограничения этого заявления об ограниченном использовании, Invitrogen готов принять возврат продукта с полным возмещением средств. Для получения информации о приобретении лицензии на использование этого продукта для целей, отличных от разрешенных выше, обратитесь в отдел лицензирования, Invitrogen Corporation, 1600 Faraday Avenue, Carlsbad, California

. Телефон (760) 603-7200.

Для получения дополнительной информации о политике Invitrogen в отношении использования и распространения клонов Gateway® Clone®® Политика распространения клонов шлюза см. Раздел «Политика распространения клонов шлюза», стр. 32.

продолжение на следующей странице

30

Уведомление покупателя, продолжение Лицензия с этикеткой ограниченного использования № 21: Bac-to-Bac® и Bac-to-Bac® HT

Этот продукт является предметом патента США № 5,348,886 . Этот продукт продается по патентной лицензии от Monsanto только для исследовательских целей, лицензия на коммерческое использование не включена. Запросы на получение лицензий на коммерческое производство или использование следует направлять директору Monsanto Corporate Research по адресу: 800 N. Lindbergh, St.Луис, Миссури, 63167.

Лицензия на этикетку с ограниченным использованием № 22: Векторы и клоны, кодирующие гистидин-гексамер

Этот продукт лицензирован в соответствии с патентами США № 5 284 933 и 5 310 663 и иностранными эквивалентами от Hoffmann-LaRoche, Inc., Натли, Нью-Джерси и / или Hoffmann-LaRoche Ltd., Базель, Швейцария, и предоставляется только для использования в исследовательских целях. Информацию о лицензиях на коммерческое использование можно получить в QIAGEN GmbH, Max-Volmer-Str. 4, D-40724 Hilden, Германия.

Лицензия с этикеткой на ограниченное использование №23: GUS Control Vector

Вектор положительного контроля GUS в этих продуктах заявлен в патентах и ​​патентных заявках (см. Патент США №5,599,670 и патент Великобритании №2,197,653), лицензированных для Invitrogen компанией Cambia Biosystems, L.L.C. («CBL»). Использование гена GUS ограничено для использования в качестве положительного контроля. Для любого другого использования может потребоваться лицензия CBL.

Лицензия на ограниченное использование лейбла № 69: бакуловирусные векторы и реагенты

Эта система экспрессии рекомбинантного бакуловируса является предметом одного или нескольких патентов США 4,745,051; 4879236; 5,155,037; и 5 278 050 и соответствующие иностранные приложения, лицензированные Invitrogen Corporation и проданные только для исследовательских целей.Использование этого продукта или системы для экспрессии генных продуктов для разработки, производства или продажи коммерческих продуктов требует лицензии в соответствии с правами Texas A&M University System. Пожалуйста, обращайтесь: Менеджер по лицензированию технологий, сельское хозяйство и науки о жизни, Управление лицензирования технологий, Университетская система Техаса A&M, 310 Wisenbaker, College Station, TX 77843-3369. Телефон: (409) 847-8682. Факс: (409) 845-1402. Вы не можете передавать Систему или содержащиеся в ней векторы или штаммы хозяев другим лицам.Вы не можете передавать модифицированные, измененные или исходные материалы из Системы третьим лицам без письменного уведомления и письменного согласия Invitrogen. Вы не можете переуступать, сублицензировать, сдавать в аренду, сдавать в аренду или иным образом передавать какие-либо права или обязанности, изложенные в настоящем документе, за исключением случаев, когда это прямо разрешено Invitrogen.

Лицензия с этикеткой на ограниченное использование № 125: GST

Этот продукт является предметом патента WIPO WO8809372 и его зарубежных эквивалентов, предназначенных для использования в научных исследованиях и ни для каких других целей.Лицензии на коммерческое использование вышеупомянутых патентов должны быть согласованы непосредственно с Amrad Corporation, 576 Swan Street, Richmond, Victoria Australia 3121, Телефон: 61 3 9208 4000.

31

Введение в политику распространения клонов Gateway®

Предоставленная информация Этот раздел предназначен для разъяснения политики Invitrogen в отношении использования и распространения клонированных фрагментов нуклеиновых кислот, включая открытые рамки считывания, созданные с использованием коммерчески доступной технологии Gateway® от Invitrogen.

Входные клоны Gateway®

Invitrogen понимает, что входные клоны Gateway®, содержащие сайты attL1 и attL2, могут создаваться академическими и государственными исследователями с целью научных исследований. Invitrogen соглашается с тем, что такие клоны могут распространяться для научных исследований некоммерческими и некоммерческими организациями без выплаты роялти в пользу Invitrogen.

Клоны экспрессии Gateway®

Invitrogen также понимает, что клоны экспрессии Gateway®, содержащие сайты attB1 и attB2, могут быть созданы академическими и государственными исследователями для целей научных исследований.Invitrogen соглашается с тем, что такие клоны могут распространяться для научных исследований академическими и правительственными организациями без выплаты гонорара Invitrogen. Другие организации, кроме академических и правительственных, также могут распространять такие клоны экспрессии Gateway® за номинальную плату (10 долларов за клон), подлежащую выплате Invitrogen.

Дополнительные положения и условия

Мы просим таких дистрибьюторов входных и экспрессионных клонов Gateway® указать, что такие клоны могут использоваться только в исследовательских целях, что такие клоны включают технологию Gateway® и что покупка Gateway® Clonase ™ от Invitrogen требуется для проведения реакции рекомбинационного клонирования Gateway®.Это должно позволить исследователям легко идентифицировать клоны, содержащие Gateway®, и облегчить им использование этой мощной технологии в своих исследованиях. Для использования технологии Invitrogen’s Gateway®, включая клоны Gateway®, в целях, отличных от научных исследований, может потребоваться лицензия, и вопросы, касающиеся такого коммерческого использования, следует направлять в отдел лицензирования Invitrogen по телефону 760-603-7200.

32

Квалификация продукта Введение

В этом разделе описаны критерии, используемые для квалификации компонентов системы экспрессии бакуловирусов с технологией Gateway®.

Векторы

Структура каждого вектора подтверждается расщеплением рестриктазами. Кроме того, функциональность целевого вектора оценивается в анализе рекомбинации с использованием ферментной смеси Gateway® LR Clonase ™ II. Ген ccdB анализируют путем трансформации с использованием подходящего штамма E. coli.

Ферментная смесь LR Clonase ™ II

Gateway® Смесь ферментов LR Clonase ™ II функционально тестируется в реакции рекомбинации в течение 1 часа с последующим анализом трансформации.

Химически компетентная E. coli

1.

Library Efficiency® Компетентные клетки DH5α ™ тестируют на эффективность трансформации с использованием контрольной плазмиды, включенной в набор. Трансформированные культуры высевают на чашки LB, содержащие 100 мкг / мл ампициллина, и рассчитывают эффективность трансформации. Тестовые преобразования выполняются в двух экземплярах. Эффективность трансформации должна быть> 1 x 108 КОЕ / мкг плазмидной ДНК.

2.

Для проверки отсутствия фаговой контаминации, 0.5-1 мл компетентных клеток добавляют к верхнему агару LB и выливают на чашки LB. После инкубации в течение ночи бляшки обнаруживаться не должны.

3.

Нетрансформированные клетки высевают на планшеты LB, содержащие 100 мкг / мл ампициллина, 25 мкг / мл стрептомицина, 50 мкг / мл канамицина или 15 мкг / мл хлорамфеникола для проверки отсутствия устойчивых к антибиотикам контаминаций.

33

Ссылки Ausubel, F. M., Brent, R., Kingston, R. E., Moore, D. D., Seidman, J. G., Smith, J. A., и Struhl, K. (1994). Текущие протоколы в молекулярной биологии (Нью-Йорк: Greene Publishing Associates и WileyInterscience). Барри, Г. Ф. (1988). Система челнока широкого диапазона хозяев для вставки генов в хромосомы грамотрицательных бактерий. Ген 71, 75-84. Кэррингтон, Дж. К., и Догерти, У. Г. (1988). Кассета сайта вирусного расщепления: идентификация аминокислотных последовательностей, необходимых для процессинга полипротеина вируса травления табака. Proc. Natl. Акад. Sci. USA 10, 3391-3395. Чиккароне, В.К., Полайес, Д.и Луцков В.А. (1997). Получение рекомбинантной ДНК бакуловируса в E. coli с использованием вектора-челнока бакуловируса, том 13, U. Reischt, ed. (Тотова, Нью-Джерси: Humana Press Inc.). Колиган, Дж. Э., Данн, Б. М., Плоег, Х. Л., Спайчер, Д. В., и Вингфилд, П. Т. (1998). Текущие протоколы в науке о белке, В. Б. Чанда, изд. (Нью-Йорк: John Wiley and Sons, Inc.). Крейг, Н. Л. (1989). Транспозон Tn7, Д. Э. Берг и Х. Х. Хоу, ред. (Вашингтон, округ Колумбия: Американское общество микробиологии). Дойчер, М. П. (1990) Руководство по очистке белков.В «Методы в энзимологии», Vol. 182. (Дж. Н. Абельсон и М. И. Саймон, ред.) Academic Press, Сан-Диего, Калифорния. Догерти, У. Г., Паркс, Т. Д., Кэри, С. М., Базан, Дж. Ф., и Флеттерик, Р. Дж. (1989). Характеристика каталитических остатков 49-кДа протеиназы вируса травления табака. Virology 172, 302-310. Кертбандит С., Греве Х. Д., Дебок Ф., Монтегю М. В. и Херналстинс Дж. П. (1991). Случайные слияния генов β-глюкуронидазы in vivo у Arabidopsis thaliana. Proc. Natl. Акад. Sci. USA 88, 5212-5216.Лэнди, А. (1989). Динамические, структурные и регуляторные аспекты лямбда-сайт-специфической рекомбинации. Аня. Rev. Biochem. 58, 913-949. Луков В.А., Ли С.С., Барри Г.Ф. и Олинс П.О. (1993). Эффективное создание инфекционных рекомбинантных бакуловирусов путем сайт-специфической транспозон-опосредованной вставки чужеродных генов в геном бакуловируса, размножающегося в Escherichia coli. J. Virol. 67, 4566-4579. Посси, Р. Д., и Ховард, С. С. (1987). Анализ промотора гена полиэдрина вируса ядерного полиэдроза Autographa californica.Nucleic Acids Res. 15, 10233-10248. Смит, Д. Б., Дэверн, К. М., Борд, П. Г., Тиу, В. У., Гарсия, Э. Г., и Митчелл, Г. Ф. (1986). Антиген г-на 26000 Schistosoma japonicum, распознаваемый устойчивыми мышами WEHI 129 / J, представляет собой паразитарную глутатионстрансферазу. Proc. Natl. Акад. Sci. США 83, 8703-8707. © 2002-2004 Invitrogen Corporation. Все права защищены.

Только для исследовательских целей. Не предназначен для использования в лечебных или диагностических целях на животных или людях.

34

Штаб-квартира в США: Invitrogen Corporation 1600 Faraday Avenue Carlsbad, California

Телефон: 1 760 603 7200 Телефон (бесплатный): 1 800 955 6288 Факс: 1 760 603 7229 Электронная почта: [электронная почта защищена] Штаб-квартира в Европе: Invitrogen Ltd 3 Fountain Drive Inchinnan Business Park Paisley PA4 9RF, UK Тел. (Бесплатные заказы по телефону): 0800 269210 Тел. (Общие запросы): 0800 5345 5345 Факс: +44 (0) 141 814 6287 Электронная почта: [электронная почта защищена] Международные офисы: Аргентина 5411 4556 0844 Австралия 1800 331627 Австрия 0800 20 1087 Бельгия 0800 14894 Бразилия 0800 11 0575 Канада 800 263 6236 Китай 10 6849 2578 Дания 80 30 17 40 Франция 0800 23 20 79 Германия 0800 0830902 Гонконг 2407 8450 Индия 11577 3282 Италия 02 98 22 201 Япония 03 3663 7974 Нидерланды 0800 099 3310 Новая Зеландия 0800 600 200 Норвегия 00800 5456 5456 Испания и Португалия 900 181461 Швеция 020 26 34 52 Швейцария 0800 848 800 Тайвань 2 2651 6156 Великобритания 0800 838 380 Для других стран см. наш сайт

ww ш.invitrogen.com

Split-HaloTag® Imaging Assay для 3D-микроскопии in vivo и субдифракционного анализа белок-белковых взаимодействий

% PDF-1.5 % 1 0 obj > / Метаданные 285 0 R / Страницы 2 0 R / StructTreeRoot 3 0 R / Тип / Каталог >> эндобдж 285 0 объект > поток application / pdf

  • David
  • Анализ изображений Split-HaloTag® для 3D-микроскопии in vivo и субдифракционного анализа белок-белковых взаимодействий
  • 2020-06-30T13: 20: 23 + 02: 00Microsoft® Word 20162021-04-07T12: 25: 42-07: 002021-04-07T12: 25: 42-07: 00Microsoft® Word 2016uuid: f742d388-1dd1-11b2- 0a00-3509271d5700uuid: f742d38b-1dd1-11b2-0a00-bf0000000000 конечный поток эндобдж 2 0 obj > эндобдж 3 0 obj > эндобдж 100 0 объект > эндобдж 101 0 объект > эндобдж 103 0 объект [128 0 R 129 0 R 129 0 R 129 0 R 129 0 R 129 0 R 129 0 R 129 0 R 129 0 R 129 0 R 129 0 R 129 0 R 129 0 R 130 0 R 131 0 R 132 0 R 133 0 R 134 0 R 135 0 R 136 0 R 137 0 R 138 0 R 139 0 R 140 0 R 141 0 R 142 0 R 143 0 R 144 0 R 145 0 R] эндобдж 104 0 объект [146 0 R 147 0 R 148 0 R 149 0 R 150 0 R] эндобдж 105 0 объект [151 0 R 152 0 R 153 0 R 154 0 R] эндобдж 106 0 объект [155 0 R 156 0 R 157 0 R] эндобдж 107 0 объект [158 0 R 159 0 R 160 0 R 161 0 R 162 0 R] эндобдж 108 0 объект [163 0 R 164 0 R 165 0 R 166 0 R 167 0 R 168 0 R] эндобдж 109 0 объект [169 0 R 170 0 R 171 0 R 172 0 R 173 0 R] эндобдж 110 0 объект [174 0 R 175 0 176 0 R] эндобдж 111 0 объект [177 0 R 178 0 R 179 0 R 180 0 R 181 0 R] эндобдж 112 0 объект [182 0 R 183 0 R 184 0 R] эндобдж 113 0 объект [185 0 R 187 0 R 188 0 R 189 0 R 190 0 186 0 R] эндобдж 114 0 объект [191 0 R 192 0 R 193 0 R 194 0 R 195 0 R] эндобдж 115 0 объект [196 0 R 197 0 R 198 0 R 200 0 R 201 0 R 202 0 R 203 0 R 204 0 R 199 0 R] эндобдж 116 0 объект [205 0 R 206 0 R] эндобдж 117 0 объект [207 0 R 209 0 R 210 0 R 211 0 R 212 0 R 208 0 R] эндобдж 118 0 объект [213 0 R 214 0 R 215 0 R] эндобдж 119 0 объект [216 0 R] эндобдж 120 0 объект [217 0 R 219 0 R 222 0 R 223 0 R 224 0 R 218 0 R 221 0 R 220 0 R] эндобдж 121 0 объект [225 0 R 226 0 R 227 0 R 228 0 R 229 0 R 230 0 R 231 0 R 232 0 R 233 0 R 234 0 R 235 0 R] эндобдж 122 0 объект [236 0 R 237 0 R 238 0 R 239 0 R 240 0 R 241 0 R 242 0 R 243 0 R 244 0 R 244 0 R 244 0 R 244 0 R 244 0 R 245 0 R 245 0 R 245 0 R 245 0 R 245 0 R 245 0 R 245 0 R 245 0 R 245 0 R 245 0 R 246 0 R 246 0 R 246 0 R 246 0 R 246 0 R 246 0 R 246 0 R 246 0 R 246 0 R 246 0 R 246 0 R 246 0 R 246 0 R] эндобдж 123 0 объект [247 0 R 248 0 R 248 0 R 248 0 R 249 0 R 249 0 R 249 0 R 249 0 R 250 0 R 251 0 R 252 0 R 253 0 R 254 0 R 254 0 R 254 0 R 254 0 R 254 0 R 255 0 R 255 0 R 255 0 R 255 0 R 255 0 R 255 0 R 255 0 R 255 0 R 255 0 R 256 0 R 256 0 R 256 0 R 256 0 R 256 0 R 256 0 R 256 0 R ] эндобдж 124 0 объект [257 0 R 258 ​​0 R 259 0 R 259 0 R 259 0 R 259 0 R 259 0 R 260 0 R 260 0 R 260 0 R 260 0 R 260 0 R 260 0 R 260 0 R 260 0 R 261 0 R 262 0 263 р.

    Добавить комментарий

    Ваш адрес email не будет опубликован. Обязательные поля помечены *