Персидская ромашка робинзон: как выращивают из семян в грунте

Содержание

как выращивают из семян в грунте

Персидская ромашка, которую также именуют пиретрумом, нередко можно увидеть у каждого второго садовника в его оранжерее. Это не просто красивый, но и полезный цветок, относящийся к многолетним видам. Существуют разные сорта и цвета этого растения. Ромашка пиретрум распространен в Евразии, Сибири, Алтае и Северной Америке.

В статье представлены ответы на следующие вопросы:

  • Какие бывают сорта и виды персидской ромашки;
  • Как ухаживать и выращивать пиретрум;
  • Какие существуют способы размножения этого растения;
  • Какие заболевания и вредители могут быть у пиретрума и как от них избавиться.

Полезность персидской ромашки

У всех растений есть свои свойства. У персидской ромашки имеется три основных качества:

  • Кладезь эфирного масла, которое сегодня входит в состав многих косметических средств;
  • Если пиретрум высушить, а потом измельчить, то получится порошок, которым можно бороться против вредных насекомых (клещей, блох и т.  д.).

Виды и сорта

Ромашка, которую может вырастить любой, бывают двух групп. К первой группе — многолетники — относятся следующие виды:

  • Розовый;
  • Цинерариелистный;
  • Красивый;
  • Щитковый.

Во вторую группу однолетних пиретрумов входит только сорт девичий.

Розовая персидская ромашка

Розовый пиретрум имеет еще два названия: Перистая хризантема или Ярко-красная пижма. Такое растение является красивым среди персидских ромашек.

Это высокий цветок с прямым стеблем, а также с рассеченными листами. Хоть сортов розовой ромашки много, но они еще не получили широкого распространения. Садоводы покупают семена только в больших по масштабу иностранных оранжереях. Сорта классифицируются по следующим критериям:

  • Высота: низкие или средние;
  • Окраска: все оттенки красного цвета и даже белый;
  • Строение: простые или махровые.

Больше всего из розовой ромашки известны следующие виды:

  • Персидская ромашка Робинзон — растение, достигающее 50 сантиметров высотой и имеющее красный или иногда розовый цвет;

  • Бренда — цветок небольшой высоты, ярко-красного окраса с желтой сердцевиной;
  • Джеймс Кэлвей — ромашка, характеризующаяся огромным количеством малиновых лепестков;
  • Эйлин Мэй Робинсон — пиретрум нежно-розового или кремового цвета;
  • Ванесса — ярко-розовая ромашка, имеющая махровую середину.

Цинерариелистная ромашка

Также называют такой пиретрум цинерариелистный, а в народе он зовется проще — далматская ромашка. Этот пиретрум больше остальных похож на ромашку, потому что в центре он желтого цвета, а по краям — белого.

Цинерариелистный пиретрум выращивают только в южных регионах или на Дальнем Востоке, потому что там наиболее благоприятные условия для его обитания — низкая морозостойкость, как у кандыка.

Красивая ромашка

Это многолетнее растение, максимальная высота которого может достигать 30 сантиметров. Оно имеет тонкие игольчатые листы, а цветок — подобие маленькой ромашки. Такой пиретрум растет только в горах, потому что там каменистая почва, благоприятная для его цветения.

Щитковый пиретрум

Щитковая персидская ромашка бывает высотой 45 сантиметров. Внешне она выглядит так: на побегах растут светло-желтые цветки. Ромашка произрастает на лугах в горах, как и красивый пиретрум.

Пиретрум девичий

Помимо своего основного названия — Пиретрум девичий — растение имеет еще два:

  1. Пижма девичья;
  2. Хризантема девичья.

Растение достаточно высокое — достигает 50 сантиметров. Такая ромашка имеет разветвленный стебель и «пушистые» (перистые) листья, которые бывают как светло-зеленого, так и желтого цвета. Цветок напоминает обыкновенную ромашку. Цветение проходит с июля по август.

Девичья персидская ромашка имеет свои сорта:

  • Пиретрум девичий Золотой шар — холодостойкое растение, достигающее 25 сантиметров. Цветок выглядит как желтая корзинка. Он махровый и шаровидный. Из таких цветов может получиться отличная «пушистая» клумба. Букет стоит достаточно долго. Прекрасно смотрится в сочетании с гелиотропом, бархатцев или сальвией;
  • Пиретрум девичий Снежный шар вырастает до 30 см. Растет кустом с большим числом белых махровых цветов, внешне схожих с подушечками. Для роста такой ромашке требуется солнечное место. Такой пиретрум распространен на территории Северной Африки, Ближнего Востока и юге Европы;
  • Пиретрум девичий Ауреум растет кустами с небольшими цветами, похожими на обычные ромашки со светло-лимонного лепестками. Период цветения — с июня по август;
  • Вырастает до 15 сантиметров. Это густомахровое растение с цветками снежного или бледно-желтого окраса. Цветки похожи на подушечки. Цветение проходит с июня по август. Обычно выращиваются группами.

  • Пиретрум девичий Пленум — невысокие махровые цветки белого окраса со светло-желтой серединой;
  • Пиретрум девичий Карлос — это белые цветы с приятным запахом. Такая ромашка неприхотливое растением, которое положительно относится к холоду. Своей высотой достигает 15 сантиметров. Цветы — махровые, похожи на подушечки.

Уход и выращивание пиретрума

Персидская ромашка — это растение, которое является самым несложным в выращивании. Но, как и любые цветы, пиретрум имеет все же несколько затруднений.

Почва

Самое благоприятное место, на котором растет пиретрум — открытые луга, которые хорошо освещаются солнечным светом. Если Вы собираетесь выращивать персидскую ромашку в саду, то сделайте это на солнечной стороне, но ни в коем случае не в тени.

Самой оптимальной почвой для выращивания является рыхлая земля, обладающая нейтральной кислотностью. Не подходит плотная и увлажненная земля. Если у Вас все же такая земля, то перемешайте ее с песком.

Удобрение

Пиретрум не любит, когда его заливают водой. Если погода дождливая и холодная, то лучше не поливать растение вообще. Оно обладает засухоустойчивостью. Если долго держатся жаркие дни, то один или два раза в неделю достаточно для полива персидской ромашки. Больше она не требует.

Удобрения пиретруму не нужны — он отлично растет и без них. Если без этого не обойтись, по усмотрению садовода, то можно раз на протяжении одного сезона, когда закладываются бутоны, то для цветов, содержащих много фосфора и калия, вносятся необходимые удобрения для цветущих растений.

Обрезка

Обрезать пиретрум желательно, если хотите продлить цветение или сохранить вид куста, либо не допустить самоцвета. Также необходимо срезать высокие цветы от 40 сантиметров, потому что они полегают от ветряных порывов. Для сохранения устаревших цветков поделите растение на новые деленки.

Зимовка

Как только появятся первые заморозки, примерно середина осени, растение готовится к зимовке. Для этого срежьте зеленую часть цветка, а корни посыпьте торфом (можно и сухой листвой). Многие сорта пиретрума зимуют без специальных укрытий. В случае сильных морозов, необходимо позаботиться о защите персидской ромашки заранее.

Размножение ромашки

Пиретрум можно размножать несколькими вариантами:

  • Семена;
  • Деление;
  • Черенки.

Сложно размножать высокоценные сорта с помощью семенного способа, потому что окрас и махровая форма от первоисточника не передается последующим поколениям.

Семена

Семена высаживаются в начале весны как рассада. Но желательно это делать уже в конце весны, когда не будет ночных заморозков, в грунт. Семена сеют в торфо-песчаную землю вглубь на три мм.

Всходы наблюдаются уже на 2-3 неделе, если стоит благоприятная погода (18 градусов тепла). После этого, всходы требуется проредить, а потом посадить на постоянное место нахождения. Желательно высаживать на расстоянии 35 см.

Для ускорения прорастания цветов необходимо семена посеять еще в июне для рассады, а переместить их в грунт в середине августа. Так ромашка расцветет на следующий год.

Внимания требует выращивание пиретрума девичьего из семян, которое начинается в конце мая или начале июня, когда среднесуточная температура будет выше нуля. Семена слегка присыпаются землей, потому что так они быстрее всходят. Перед посевом почву желательно увлажнить и прикрыть пленкой, пока не появятся всходы. Если сначала собираетесь сделать рассаду из семян, то это делается в начале марта, а в конце мая высаживайте их в грунт.

Деление

Чтобы размножить или омолодить персидскую ромашку, нужно разделить куст на части. Чтобы это сделать, отберите здоровые и взрослые экземпляры и разрежьте их на 2-3 части, на каждой из которых имеется хотя бы один побег и небольшая часть корня. Дальше растение высаживается в разные лунки, которые должны быть политы, посыпается землей и снова поливается.

Черенки

Черенкование можно производить, используя и корни, и стебли. Черенки необходимо высаживаются в пластиковый стаканчик или бутылку с обрезанным горлышком. Как только появятся первые корни, цветок требуется пересадить в землю. Таким способом размножение пиретрума можно проводить с июня по август.

Заболевания

Пиретруму свойственны серая или коричневая гниль. Растение может заболеть из-за частых поливов, нахождения в тени или тяжелой почвы. Чтобы вырастить персидскую ромашку, Вам необходимо срезать зараженные части и обработать его системным фунгицидом.

Вредители

Как и у любого растения, у персидской ромашки имеются свои недоброжелатели. В их число входит тля и слизни, которые питаются листьями и побегами. Чтобы их уничтожить, надо использовать народные средства, которые будут безопасны для пчел, чтобы те и дальше продолжали опылять цветки.

Пиретрум или персидская ромашка — как уже говорилось, полезное и красивое растение. Его выращивание не требует особых усилий. Садоводы оказывают большое внимание многолетним сортам этого растения. Самое широкое распространение получил пиретрум девичий. Главным правилом разведения пиретрума является выращивание в саду, но никак не дома. Дома цветок может погибнуть из-за недостатка свежего воздуха и затемнения. Ромашка может украсить букет, а если собрать будет из нескольких сортов этого растения, особенно с махровыми цветками.


Поделиться новостью в соцсетях

 

Об авторе: Людмила Васильевна Носикова

Агроном государственного сельскохозяйственного предприятия «Гаровское» Хабаровского района Хабаровского края.

Загрузка…

Выращивание персидской ромашки Робинзон – способы размножения, выбор места в саду, особенности посадки и ухода

Персидская ромашка, которую также именуют пиретрумом, нередко можно увидеть у каждого второго садовника в его оранжерее. Это не просто красивый, но и полезный цветок, относящийся к многолетним видам. Существуют разные сорта и цвета этого растения. Пиретрум распространен в Евразии, Сибири, Алтае и Северной Америке.

В статье представлены ответы на следующие вопросы:

  • Какие бывают сорта и виды персидской ромашки;
  • Как ухаживать и выращивать пиретрум;
  • Какие существуют способы размножения этого растения;
  • Какие заболевания и вредители могут быть у пиретрума и как от них избавиться.

Виды и сорта

Ромашка, которую может вырастить любой, бывают двух групп. К первой группе — многолетники — относятся следующие виды:

Во вторую группу однолетних пиретрумов входит только пиретрум девичий.

Розовая персидская ромашка

Розовый пиретрум имеет еще два названия: Перистая хризантема или Ярко-красная пижма. Такое растение является красивым среди персидских ромашек.

Это высокий цветок с прямым стеблем, а также с рассеченными листами. Хоть сортов розовой ромашки много, но они еще не получили широкого распространения. Садоводы покупают семена только в больших по масштабу иностранных оранжереях. Сорта классифицируются по следующим критериям:

  • Высота: низкие или средние;
  • Окраска: все оттенки красного цвета и даже белый;
  • Строение: простые или махровые.

Больше всего из розовой ромашки известны следующие виды:

  • Персидская ромашка Робинзон — растение, достигающее 50 сантиметров высотой и имеющее красный или иногда розовый цвет;

  • Бренда — цветок небольшой высоты, ярко-красного окраса с желтой сердцевиной;
  • Джеймс Кэлвей — ромашка, характеризующаяся огромным количеством малиновых лепестков;
  • Эйлин Мэй Робинсон — пиретрум нежно-розового или кремового цвета;
  • Ванесса — ярко-розовая ромашка, имеющая махровую середину.

Цинерариелистная ромашка

Также называют такой пиретрум цинерариелистный, а в народе он зовется проще — далматская ромашка. Этот цветок больше остальных похож на ромашку, потому что в центре он желтого цвета, а по краям — белого.

Цинерариелистный пиретрум выращивают только в южных регионах или на Дальнем Востоке, потому что там наиболее благоприятные условия для его обитания — низкая морозостойкость, как у кандыка.

Красивая ромашка

Это многолетнее растение, максимальная высота которого может достигать 30 сантиметров. Оно имеет тонкие игольчатые листы, а цветок — подобие маленькой ромашки. Такой пиретрум растет только в горах, потому что там каменистая почва, благоприятная для его цветения.

Щитковый пиретрум

Щитковая персидская ромашка бывает высотой 45 сантиметров. Внешне она выглядит так: на побегах растут светло-желтые цветки. Ромашка произрастает на лугах в горах, как и красивый пиретрум.

Пиретрум девичий

Помимо своего основного названия — Пиретрум девичий — растение имеет еще два: Пижма девичья и Хризантема девичья. Растение достаточно высокое — достигает 50 сантиметров. Такая ромашка имеет разветвленный стебель и «пушистые» (перистые) листья, которые бывают как светло-зеленого, так и желтого цвета. Цветок напоминает обыкновенную ромашку. Цветение проходит с июля по август.

Девичья персидская ромашка имеет свои сорта:

  • Пиретрум девичий Золотой шар — холодостойкое растение, достигающее 25 сантиметров. Цветок выглядит как желтая корзинка. Он махровый и шаровидный. Из таких цветов может получиться отличная «пушистая» клумба. Букет стоит достаточно долго. Прекрасно смотрится в сочетании с гелиотропом, бархатцев или сальвией;
  • Пиретрум девичий Снежный шар вырастает до 30 см. Растет кустом с большим числом белых махровых цветов, внешне схожих с подушечками. Для роста такой ромашке требуется солнечное место. Такой пиретрум распространен на территории Северной Африки, Ближнего Востока и юге Европы;
  • Пиретрум девичий Ауреум растет кустами с небольшими цветами, похожими на обычные ромашки с лепестками светло-лимонного цвета. Период цветения — с июня по август;
  • Вырастает до 15 сантиметров. Это густомахровое растение с цветками снежного или бледно-желтого окраса. Цветки похожи на подушечки. Цветение проходит с июня по август. Обычно выращиваются группами.

  • Пиретрум девичий Пленум — невысокие махровые цветки белого окраса со светло-желтой серединой;
  • Пиретрум девичий Карлос — это цветы белого цвета с приятным запахом. Такая ромашка неприхотливое растением, которое положительно относится к холоду. Своей высотой достигает 15 сантиметров. Цветы — махровые, похожи на подушечки.

Правила выращивания и уход за персидской ромашкой в открытом грунте

Астровые

16.01.2018

3 тыс.

2 тыс.

6 мин.

Персидская ромашка еще называется пиретрумом. Это растение является садовым многолетником. В народе он известен как поповник и ромашка далматская. Такое сравнение связано со схожестью форм соцветия: сердцевина крупная желтая, а вокруг располагается множество лепестков.

Пиретрум занимает особое место в садоводстве благодаря своим декоративным свойствам. Существует множество окрасов: вишневый, лиловый, белый. Сами соцветия бывают как простыми, так и махровыми. Популярность культуры связана не только с красивым внешним видом, но и инсектицидными, акарицидными свойствами. Если посадить пиретрум возле других цветов, деревьев, то им не страшны различные насекомые-вредители. Пиретрум защищает и от клещей. Именно аромат персидской ромашки отпугивает паразитов. Кроме того, вырастить пиретрум совсем несложно, так как он неприхотлив.

  • 1. Описание и виды
  • 2. Посадка
  • 3. Правила ухода

Ромашка пиретрум относится к семейству Сложноцветных. Родиной является Северная Америка и Евразия. Это многолетник травянистого типа. Название связано с греческим словом «лихорадка», так как части растения содержат активное вещество партенолид, который обладает лечебным действием.

Существует более 100 видов ромашки пиретрум, но все они обладают определенными схожими характеристиками. Стебли обычно располагаются прямо, разветвляются. В высоту бывают по 30-70 см, хотя существуют и карликовые кусты до 10 см. Листья обычно яркие зеленые, по форме — перистые. Сосредотачиваются в нижней части растения.

Цветоносы высокие. На них располагаются корзинки-соцветия. Обычно они малиновые, розовые, красные, белые. Диаметр цветка по 6-9 см. Сердцевина по размерам больше, чем у садовых ромашек. Ее окрас – ярко-желтый. Период цветения долгий – с начала лета и до конца сентября. В дикой природе пиретрум размножается самосевом, но он не живет больше 6 лет, так что его обычно выращивают в садах как однолетник. Из семян быстро появляются крепкие ростки, так что легче выращивать каждый год новые растения, чем постоянно бороться за жизнь уже имеющихся.

Одним из самых популярных видов является пиретрум девичий. Родиной считается южная часть Европы. Куст разветвленный. В высоту до 60 см. Листья светло-зеленые с желтым отливом. Встречаются соцветия махровые и простые. Обычно они белого либо светло-желтого окраса. Благодаря декоративности чаще всего выращивают такие сорта:

  1. 1. Голд бол. Имеет тонкий стебель высотой не более 30 см. Соцветия шаровидные, в диаметре до 4 см. Обычно они яркого желтого окраса. Этот сорт используют для групповых посадок либо выращивают для букетов.
  2. 2. Дубль вайт. Соцветия махровые, небольшие. Напоминают белое облако.
  3. 3. Шнеебаль. Невысокий куст – до 23 см. Соцветия белые.

Следующая распространенная разновидность – пиретрум розовый. Именно его в народе называют персидской ромашкой. Отличается высокой декоративностью. На одном стебле появляется до 5 небольших соцветий. Лепестки розовые, разной степени интенсивности этого цвета. В высоту культура до 70 см. Отлично подходит для посадки в центре клумбы. Можно составить на участке смесь с другими разновидностями. Самыми известными сортами являются:

  1. 1. Робинсон. У этого гибридного сорта лепестки бледно-розовые, белые и ярко-красные.
  2. 2. Джеймс Келвер. Корзинки насыщенного красного оттенка.
  3. 3. Ванесса. Соцветия крупные, махровые. Обычно они разных оттенков розового.
  4. 4. Бренда. Цветение обильное, соцветия красного оттенка располагаются густо.

Из всех сортов пиретрума розового составляется смесь, которая называется «Гибридная».

Отдельное место занимает щитковый пиретрум. Этот вид является многолетником. Куст сильно похож на полевую ромашку. Стебли в высоту до 1,2 м. На одном кусте появляется множество мелких корзинок, которые собираются в соцветия-щитки.

Пиретрум крупнолистый многолетник, ареалом обитания является Кавказ. Соцветия мелкие, белесые. Они собираются в щитки. В конце цветения растение приобретает коричнево-красный оттенок.

Отдельная разновидность – пиретрум красивый. Стебли невысокие, растение неприметное. Корзинки одиночные, окрас – молочный. Популярным сортом является кавказская ромашка, у которой белые лепестки. Этот вид в дикой природе встречается в северной части Китая, Монголии и Сибири.

Выращивание из семян – основной способ разведения ромашки пиретрума. Предварительно на участке нужно удобрить грунт. Для растения больше подходит слабокислая почва. Чтобы уменьшить кислотность, рекомендуется использовать доломитовую муку и гашеную соду.

Ромашку пиретрум можно выращивать рассадным способом:

  1. 1. Подготовить емкости. Рекомендуется сначала выбирать крупные ящики для проращивания семян. Но потом все равно придется выбирать более мелкие горшки для рассаживания всходов.
  2. 2. Насыпать на дно контейнера мелкие камни для дренажа. Нельзя допускать застаивания воды.
  3. 3. Засыпать в емкости подготовленный грунт и полить.
  4. 4. Распределить семена по поверхности грунта и присыпать тонким слоем либо вообще не засыпать их землей, только немного вдавливая.
  5. 5. Опрыскать семена водой из пульверизатора.
  6. 6. Накрыть емкость пленкой и поставить в затемненное теплое помещение.

Обычно первые ростки появляются через 1,5-2 недели. Тогда укрытие нужно убрать и переставить емкости с цветами в хорошо освещенное место. Когда они окрепнут, их либо рассаживают в отдельные горшки, либо пересаживают на клумбы в саду. Последнее можно осуществлять, когда не будет риска повторного появления заморозков. Лучше всего посадку в открытый грунт осуществлять в конце мая. В одну лунку помещают по 2-3 растения.

Сажать ромашку пиретрум можно и сразу в открытый грунт. Это полагается делать в конце весны или в начале лета. Предварительно почву нужно удобрить. Семена пиретрума очень мелкие, так что когда появятся всходы, придется их прорежать. Когда появится по 4 настоящих листика, удаляют лишние растения, оставляя только по 2 штуки в одной точке роста. Между кустами нужно оставлять по 30-40 см расстояния.

Еще один способ выращивания ромашки пиретрума – это разделение кустарников. Лучше всего процедуру проводить весной. Необходимо выкопать аккуратно куст, не повреждая побеги, разделить его на 2-3 части (только руками, а не садовыми инструментами), а потом поместить в новые лунки. Их размеры должны соответствовать корней системе растений. После посадки обязательно полить новые кусты.

Уход в открытом грунте за ромашкой пиретрумом несложный, так как культура неприхотлива. Но требуется выполнять элементарные действия, чтобы сохранить декоративность и здоровье куста:

  1. 1. Полив. Он должен быть обильным и регулярным, особенно жарким летом. Некоторые сорта являются засухоустойчивыми, но нельзя допускать пересыхания нижней прослойки почвы. Рекомендуется поливать отстоянной водой комнатной температуры.
  2. 2. Прополка и рыхление грунта. Ее тоже требуется осуществлять регулярно – желательно после каждого полива. Устранять сорняки требуется не только для того, чтобы клумба выглядело красиво и аккуратно. Это важно для здоровья пиретрума, так как растение будет получать больше влаги и питательных компонентов. Прополка является профилактикой различных вредителей и болезней. Параллельно рекомендуется взрыхлять грунт, чтобы у корней был доступ к кислороду.
  3. 3. Подкормка. Первый раз ее нужно осуществлять еще в момент подготовки грунта на участке перед посадкой пиретрума. Подойдут обычные органические удобрения. Следующая подкормка осуществляется в апреле. Рекомендуется использовать аммиачную селитру. Понадобится по 20 г на каждый квадратный метр. В период образования бутонов требуется мочевина, но ее используют для подкормки только растений с блеклым окрасом.
  4. 4. Утепление. Перед зимовкой, если климат достаточно суровый, наземную часть кустарника нужно обрезать до наступления заморозков. Взрослые кусты хорошо переносят холод, а вот молодые экземпляры рекомендуется укрыть опавшими листьями.

Пиретруму требуется солнечный участок, так что перед посадкой полагается проследить, чтобы в этом месте его не затеняли соседние растения.

Если ромашка пиретрум произрастает на одном и том же месте не один год, то нужно каждые 5 лет осуществлять омоложение кустарника. С одной стороны нужно обрезать растение и досыпать в лунку плодородной почвы. Через 3 года необходимо выполнить то же самое, но только с другой.

Собирать семена можно после окончания цветения и формирования плодов-семянок. Нужно подождать, когда они подсохнут, и обрезать. Потом их полагается держать в затемненном и прохладном месте, чтобы они полностью просохли. После этого можно вылущить семена и просеивать их для отделения шелухи и мусора. Хранить только в бумажных пакетах.

naogorode.net

Уход и выращивание пиретрума

Персидская ромашка — это растение, которое является самым несложным в выращивании. Но, как и любые цветы, пиретрум имеет все же несколько затруднений.

Почва

Самое благоприятное место, на котором растет пиретрум — открытые луга, которые хорошо освещаются солнечным светом. Если Вы собираетесь выращивать персидскую ромашку в саду, то сделайте это на солнечной стороне, но ни в коем случае не в тени.

Самой оптимальной почвой для выращивания является рыхлая земля, обладающая нейтральной кислотностью. Не подходит плотная и увлажненная земля. Если у Вас все же такая земля, то перемешайте ее с песком.

Удобрение

Пиретрум не любит, когда его заливают водой. Если погода дождливая и холодная, то лучше не поливать растение вообще. Оно обладает засухоустойчивостью. Если долго держатся жаркие дни, то один или два раза в неделю достаточно для полива персидской ромашки. Больше она не требует.

Удобрения пиретруму не нужны — он отлично растет и без них. Если без этого не обойтись, по усмотрению садовода, то можно раз на протяжении одного сезона, когда закладываются бутоны, то для цветов, содержащих много фосфора и калия, вносятся необходимые удобрения для цветущих растений.

Обрезка

Обрезать пиретрум желательно, если хотите либо продлить цветение, либо сохранить вид куста, либо не допустить самоцвета. Также необходимо срезать высокие цветы от 40 сантиметров, потому что они полегают от ветряных порывов. Для сохранения устаревших цветков поделите растение на новые деленки.

Размножение ромашки

Пиретрум можно размножать несколькими вариантами:

Сложно размножать высокоценные сорта с помощью семенного способа, потому что окрас и махровая форма от первоисточника не передается последующим поколениям.

Семена

Семена высаживаются в начале весны как рассада. Но желательно это делать уже в конце весны, когда не будет ночных заморозков, в грунт. Семена сеют в торфо-песчаную землю вглубь на три мм.

Всходы наблюдаются уже на 2-3 неделе, если стоит благоприятная погода (18 градусов тепла). После этого, всходы требуется проредить, а потом посадить на постоянное место нахождения. Желательно высаживать на расстоянии 35 см.

Для ускорения прорастания цветов необходимо семена посеять еще в июне для рассады, а переместить их в грунт в середине августа. Так ромашка расцветет на следующий год.

Внимания требует выращивание пиретрума девичьего из семян, которое начинается в конце мая или начале июня, когда среднесуточная температура будет выше нуля. Семена слегка присыпаются землей, потому что так они быстрее всходят. Перед посевом почву желательно увлажнить и прикрыть пленкой, пока не появятся всходы. Если сначала собираетесь сделать рассаду из семян, то это делается в начале марта, а в конце мая высаживайте их в грунт.

Деление

Чтобы размножить или омолодить персидскую ромашку, нужно разделить куст на части. Чтобы это сделать, отберите здоровые и взрослые экземпляры и разрежьте их на 2-3 части, на каждой из которых имеется хотя бы один побег и небольшая часть корня. Дальше растение высаживается в разные лунки, которые должны быть политы, посыпается землей и снова поливается.

Черенки

Черенкование можно производить, используя и корни, и стебли. Черенки необходимо высаживаются в пластиковый стаканчик или бутылку с обрезанным горлышком. Как только появятся первые корни, цветок требуется пересадить в землю. Таким способом размножение пиретрума можно проводить с июня по август.

Заболевания

Пиретруму свойственны серая или коричневая гниль. Растение может заболеть из-за частых поливов, нахождения в тени или тяжелой почвы. Чтобы вырастить персидскую ромашку, Вам необходимо срезать зараженные части и обработать его системным фунгицидом.

Вредители

Как и у любого растения, у персидской ромашки имеются свои недоброжелатели. В их число входит тля и слизни, которые питаются листьями и побегами. Чтобы их уничтожить, надо использовать народные средства, которые будут безопасны для пчел, чтобы те и дальше продолжали опылять цветки.

Пиретрум или персидская ромашка — как уже говорилось, полезное и красивое растение. Его выращивание не требует особых усилий. Садоводы оказывают большое внимание многолетним сортам этого растения. Самое широкое распространение получил пиретрум девичий. Главным правилом разведения пиретрума является выращивание в саду, но никак не дома. Дома цветок может погибнуть из-за недостатка свежего воздуха и затемнения. Ромашка может украсить букет, а если собрать будет из нескольких сортов этого растения, особенно с махровыми цветками.

Персидская ромашка Робинзон – прекрасное и в то же время неприхотливое при выращивании украшение летнего сада, радующее крупными цветками розовых и красных оттенков на фоне ажурных листьев.

Вырастить многолетник под силу даже начинающему цветоводу, если учитывать некоторые тонкости этого увлекательного занятия.

Состав цветков и инсектицидная активность их компонентов

Цветки персидской ромашки содержат пиретрин — смолистую субстанцию, представляющую собой смесь сложных эфиров пиретролона и хризантемовых кислот. Эта смесь оказывает сильное отравляющее действие на различных членистоногих — насекомых, пауков, клещей, многоножек, мокриц — но при этом практически безвредна для человека и теплокровных животных, за счет чего ранее активно применялась для борьбы с тараканами, клопами, вшами, блохами и клещами.

Сегодня на основе натуральных пиретринов, добываемых из соцветий ромашки, производят синтетические пиретроиды, значительно более эффективные, чем их предшественники. За счет этого пиретрины и сама персидская ромашка утратили своё значение для народного хозяйства, хотя в некоторой мере и продолжают применяться в народной медицине для борьбы с педикулезом и чесоткой. Также иногда сторонники всего натурального используют порошок из перетертых соцветий персидской ромашки для выведения тараканов и клопов из дома, хотя практика показывает, что такая борьба редко бывает успешной и не позволяет вывести всех насекомых из помещения.

Интересно, что ромашка далматская чаще используется в качестве сырья для получения инсектицида, чем персидская или кавказская. Это связано с тем, что в составе её цветков содержится наибольшее количество инсектицидных компонентов. В то же время, эффективность компонентов персидской и кавказской ромашек несколько выше, поэтому в целом эти виды могут считаться равнозначными по своей инсектицидной активности.


Типичный препарат для уничтожения насекомых на грунте и в шерсти животных.

Также в состав цветков пиретрума входит противовоспалительный компонент партенолид, известный своей противовоспалительной активностью. За счет него из персидской ромашки и других растений рода Пиретрум изготавливают настои, применяемые в народной медицине в качестве наружного противовоспалительного, а также противоревматического средства.

Сорт персидской ромашки Робинзон

Многолетние растения цветоводы любят за неприхотливость: правильно посадив однажды, можно несколько лет уделять им минимум внимания, лишь любуясь все более пышным цветением. Почти все многолетники зимостойки, не нужно заботиться об укрытии от морозов.

Цветение ромашки (фото)

Персидская ромашка Робинзон обладает всеми достоинствами многолетников. В продаже предлагается смесь розовых и красных расцветок.

Это очень удобно: посаженные рядом кусты будут переливаться теплыми оттенками цветков с веселой желтой сердцевиной.

Цветки сорта Робинзон довольно крупные для описанной ромашки – достигают в диаметре 8-10 см. Они возвышаются над ажурными насыщено-зелеными листьями, их цветоносы могут достигать в высоту 80 см.

Хотя стебли прямые и крепкие, лучше аккуратно подвязывать кусты, чтобы избежать полегания цветов от порывов ветра или сильного дождя.

Цветение описанной ромашки наступает в начале июня и длится 40-45 дней. Но и после цветения кусты не теряют декоративности: перистые листья остаются зелеными до заморозков, добавляя свой оттенок в палитру осеннего сада.

Способы размножения

Сорт ромашки Робинзон, как и другие цветы этого вида, можно размножать тремя способами:

  • выращивание из семян;
  • деление кустов;
  • самосев.
  • выращивание из семян
  • рассадный способ

В марте – начале апреля семена ромашки высевают в подготовленные емкости с рыхлой плодородной почвой, предварительно увлажненной, стараясь выдерживать расстояния между семенами, слегка вдавливая их в грунт. Сверху необходимо присыпать тонким слоем земли и убрать в теплое темное место.

После появления всходов (через 7-10 дней) рассаду, чтобы она не вытягивалась и не желтела, переносят на свет, но не под прямые лучи солнца. Можно использовать подоконник. Когда таких условий нет, то рассаду надо притенять на несколько часов, когда солнце особенно ярко.

Ромашка может украсить любое пространство (фото)

Если естественного освещения недостаточно, необходимо создать искусственное: подвесить специальные лампы или сделать экраны из фольги.

Если семена посеяны густо, то рассаду пикируют в фазе трех полноценных листьев. Желательно перед посадкой в цветник закаливать рассаду, ежедневно вынося на несколько часов в прохладное помещение или на воздух.

В открытый грунт такую ромашку высаживают после окончания заморозков, когда почва достаточно прогреется, лучше всего в вечернее время – чтобы растение хорошо перенесло пересадку и быстрее прижилось.

Для нее выбирают солнечное место на участке, желательно с хорошо дренированной почвой — чтобы избежать загнивания корней из-за застоя воды. Расстояние между кустами должно быть не менее 35-40 см. Цветение при таком способе выращивания наступит только летом следующего года.

Выращивание пиретрума из семян в домашних условиях

Семена пиретрума фото

Размножают пиретрум семенами и вегетативным способом.

Лучше покупать семена в специализированном магазине. При размножении домашними семенами, собранными с гибридных форм, теряются сортовые признаки. Но при этом возможно получение разнообразных, новых оттенков. Это интересный эксперимент.

Посев пиретрума на рассаду проводите в начале марта.

  • Наполните ящички торфяно-песчаной смесью, семена смешайте с небольшим количеством песка и рассыпьте по поверхности грунта, опрыскайте из мелкодисперсного распылителя.
  • Накройте посевы стеклом, пленкой, проращивайте в светлом месте.
  • Парничок проветривайте, увлажняйте почву.
  • Семена взойдут через 7-10 дней. Укрытие снимите.

Пиретрум выращивание из семян фото рассады

  • С появлением 3-4 листочков рассадите по отдельным емкостям и доращивайте при температуре воздуха около 20 °C.
  • Постепенно приучайте к прямым солнечным лучам и ветру, вынося рассаду на улицу и увеличивая время пребывания.
  • В мае, при отсутствии ночных заморозков, пересаживайте рассаду в открытый грунт методом перевалки на расстоянии 40-50 см для пиретрума красного и розового, 20-30 для пиретрума девичьего.

Ромашка в ландшафтном дизайне

Персидскую ромашку Робинзон можно высаживать в разных уголках сада. Ее кусты прекрасно смотрятся в бордюрном оформлении, высаженные в рабатках или на переднем плане цветников на фоне высокорослых цветов.

Выращивание ромашки на клумбе (фото)

Идеальные соседи ярких ромашек Робинзон с их ажурными листьями — растения с крупными листьями: хосты, бузульники, папоротники, клопогоны, пионы, роджерсии, ирисы. Гармонично выглядят цветы около декоративных кустарников, например, барбарисов.

Можно посадить рядом ромашки других расцветок, создав пасторальный уголок. Интересны ромашки этого сорта в цветниках, выдержанных в розово-красной гамме: рядом с розами, астильбой, лилиями, восточным маком, лилейниками.

Красивое подножие для такой ромашки – стелющиеся почвопокровные растения, например, вербейник и вероника, которые не только образуют нежные коврики из мелких листьев, но и удерживают влагу, предотвращают рост сорняков, облегчая уход за цветами: исключаются мульчирование и рыхление почвы вокруг кустов, сокращается полив.

Сбор и применение продуктов из персидской ромашки в быту и народном хозяйстве

Сбор соцветий персидской ромашки проводят в июне-июле. Сроки сбора зависят от географии места произрастания растения и высоты его над уровнем моря. Чем севернее и чем выше в горах расположено место сбора, тем позже растение цветет.


Цветущие кусты персидской ромашки на клумбе.

При сборе обрывают или срезают цветочные корзинки, на которых краевые цветки уже расположились горизонтально и начали немного заворачиваться краями вниз. В это время только-только распускаются трубчатые цветки в середине, но семена ещё не завязываются. Количество инсектицидных компонентов в цветах в это время максимально.

После сбора цветочные корзинки сушат в хорошо проветриваемом помещении либо на улице, защитив их от попадания прямых солнечных лучей. Готовое к переработке сырье имеет влажность около 12% и состоит из корзинок с максимальной длиной остатка цветоноса в 2 см. Они имеют своеобразный горьковатый запах, а пыль от них, попадая в нос, вызывает чихание. Вкус таких корзинок также имеет горчинку и в целом неприятен.

Такие сушенные корзинки перемалывают в порошок, который без дальнейшей переработки используют для борьбы с членистоногими. Его рассыпают в помещениях в местах скопления насекомых, на его основе готовят настой, которых обрабатывают кожу при чесотке и педикулезе. Важно при этом быть очень осторожными, а в случае развития аллергии сразу же отменять применение средства.

Полезно также почитать: Нужно ли ромашку обрезать на зиму и когда это лучше сделать?

Порошок из персидской ромашки можно купить в специализированных магазинах инсектицидных препаратов и в некоторых аптеках. Имеются производители, выпускающие брендированные препараты на основе такого порошка — Пиретрум, Чистый Дом и другие. Различий между такими средствами и порошком, изготовленным самостоятельно, практически нет.


Порошок пиретрума в том виде, в котором он применяется для уничтожения тараканов и клопов.

Иногда из порошка изготавливают экстракт, который добавляют в комплексные инсектицидные препараты. Однако делают это нечасто, поскольку синтетические аналоги пиретринов более предпочтительны в качестве таких компонентов комплексных средств.

В домашних условиях могут применять как порошок, так и целые засушенные соцветия. Последние, однако, менее эффективны, поскольку даже при контакте с ними насекомые не пачкаются в инсектицидном средстве, а эффект оказывается слабо выраженным. Если же таракан или клоп пробегает по порошку, большое количество мелких частиц прилипает к его телу, а сами пиретрины затем оказывают контактное отравляющее действие.

применение и противопоказания, фото и описание


Персидская ромашка, которую также именуют пиретрумом, нередко можно увидеть у каждого второго садовника в его оранжерее. Это не просто красивый, но и полезный цветок, относящийся к многолетним видам. Существуют разные сорта и цвета этого растения. Пиретрум распространен в Евразии, Сибири, Алтае и Северной Америке.

В статье представлены ответы на следующие вопросы:

  • Какие бывают сорта и виды персидской ромашки;
  • Как ухаживать и выращивать пиретрум;
  • Какие существуют способы размножения этого растения;
  • Какие заболевания и вредители могут быть у пиретрума и как от них избавиться.

Сеянцы.

  • Семена ромашки сеют для рассады в марте.
  • В лотки для посева добавляется смесь торфа и песка, которую можно приобрести в магазине для садоводов.
  • В ячейку достаточно добавить 2 – 3 семени. Семена присыпаются сверху тонким слоем смеси торфа и песка.
  • После, необходимо накрыть ёмкости тонкой плёнкой и поставить недалеко от окна. Не рекомендуется ставить на подоконник, так как прямые лучи солнца могут навредить процессу прорастания.
  • Не допускайте пересыхания грунта. Поливайте из пульвелизатора, как только почва начинает подсыхать.

Рассада.

  • При нормальных условиях, через пару недель, начнут появляться первые ростки.
  • Как только это произошло, нужно снять плёнку с ячеек и поместить их ближе к окну, заранее позаботившись о предупреждении сквозняков.
  • Как только рассада достигнет высоты 5 см, нужно будет из двух или трех сеянцев в каждой ячейке оставить по одному, который самый развитый.
  • Для этого нужно аккуратно выщипывать ненужные всходы, чтобы не повредить тот, который необходимо оставить.

Дарите цветы самому себе

Разве не приятно самому себе преподносить добрые сюрпризы? Начинать день с улыбки, или перед работой поднимать себе настроение? И все это легко достичь, если установить добрые картинки на рабочий стол с ромашками.

Теплые, как солнышки, цветочки подарят позитивные эмоции. Будь то фото на рабочий стол или картинки на телефон

ромашки, но нас должны окружать только красивые и добрые вещи, и тогда жизнь наша станет намного прекраснее.

Качество картинок

Для всех, кто хочет скачать изображение у нас на ресурсе, есть хорошая новость. Все фото мы предлагаем только высокого качества, расширение которых соответствуют достойным стандартам (просто нажмите на понравившуюся картинку и кликните внизу на кнопочку «развернуть до полного размера»). Можете быть уверены, что картинки полностью будут соответствовать вашим ожиданиям.

Вы, или тот человек, которому вы хотите отправить изображения, получат букет ромашек на фото таким яркими и сочными, словно держит свежие цветы в руках. Мы готовы предложить вам именно такой высший пилотаж!

И еще одна приятный нюанс, этот букет для вас абсолютно бесплатный! Для всех наших посетителей действует вечная акция прекрасных и роскошных подарков. Заходите к нам на огонек, дарите радость себе и своим родным, будьте всегда в позитивном расположении духа. Это легко, если взять привычку быть нашим частым гостем!

*при копировании материала просим обязательно указывать активную ссылку на источник

Уход за ромашкой.

  • До тех пор, пока сеянцы не начнут расти их необходимо поливать довольно часто, однако, когда цветы пустят крепкие корни, тогда необходимость поливать их будет только в сухое время года.
  • В остальном, уход за ромашкой, практически стандартная процедура.
  • Нужно разрыхлять грунт для нормального потока кислорода.
  • Полоть растущий участок.
  • Подкармливать растение и готовить его к переходу на зимний период.
  • Один раз в год добавляются удобрения (торф, компост).
  • Примерно в середине весны можно высыпать селитру между рядами посаженного растения.
  • Если у почвы кислая реакция, то осенью нужно внести в нее гашеную известь.
  • За ромашкой необходимо ухаживать часто и регулярно, во избежание заболевания растения.

Виды и сорта

Ромашка, которую может вырастить любой, бывают двух групп. К первой группе — многолетники — относятся следующие виды:

  • Розовый;
  • Цинерариелистный;
  • Красивый;
  • Щитковый.

Во вторую группу однолетних пиретрумов входит только пиретрум девичий.

Розовая персидская ромашка

Розовый пиретрум имеет еще два названия: Перистая хризантема или Ярко-красная пижма. Такое растение является красивым среди персидских ромашек.

Это высокий цветок с прямым стеблем, а также с рассеченными листами. Хоть сортов розовой ромашки много, но они еще не получили широкого распространения. Садоводы покупают семена только в больших по масштабу иностранных оранжереях. Сорта классифицируются по следующим критериям:

  • Высота: низкие или средние;
  • Окраска: все оттенки красного цвета и даже белый;
  • Строение: простые или махровые.

Больше всего из розовой ромашки известны следующие виды:

  • Персидская ромашка Робинзон — растение, достигающее 50 сантиметров высотой и имеющее красный или иногда розовый цвет;

  • Бренда — цветок небольшой высоты, ярко-красного окраса с желтой сердцевиной;
  • Джеймс Кэлвей — ромашка, характеризующаяся огромным количеством малиновых лепестков;
  • Эйлин Мэй Робинсон — пиретрум нежно-розового или кремового цвета;
  • Ванесса — ярко-розовая ромашка, имеющая махровую середину.

Цинерариелистная ромашка

Также называют такой пиретрум цинерариелистный, а в народе он зовется проще — далматская ромашка. Этот цветок больше остальных похож на ромашку, потому что в центре он желтого цвета, а по краям — белого.

Цинерариелистный пиретрум выращивают только в южных регионах или на Дальнем Востоке, потому что там наиболее благоприятные условия для его обитания — низкая морозостойкость, как у кандыка.

Популярно: Синие тона цветов агапантуса для ландшафта или квартиры

Красивая ромашка

Это многолетнее растение, максимальная высота которого может достигать 30 сантиметров. Оно имеет тонкие игольчатые листы, а цветок — подобие маленькой ромашки. Такой пиретрум растет только в горах, потому что там каменистая почва, благоприятная для его цветения.

Щитковый пиретрум

Щитковая персидская ромашка бывает высотой 45 сантиметров. Внешне она выглядит так: на побегах растут светло-желтые цветки. Ромашка произрастает на лугах в горах, как и красивый пиретрум.

Пиретрум девичий

Помимо своего основного названия — Пиретрум девичий — растение имеет еще два: Пижма девичья и Хризантема девичья. Растение достаточно высокое — достигает 50 сантиметров. Такая ромашка имеет разветвленный стебель и «пушистые» (перистые) листья, которые бывают как светло-зеленого, так и желтого цвета. Цветок напоминает обыкновенную ромашку. Цветение проходит с июля по август.

Девичья персидская ромашка имеет свои сорта:

  • Пиретрум девичий Золотой шар — холодостойкое растение, достигающее 25 сантиметров. Цветок выглядит как желтая корзинка. Он махровый и шаровидный. Из таких цветов может получиться отличная «пушистая» клумба. Букет стоит достаточно долго. Прекрасно смотрится в сочетании с гелиотропом, бархатцев или сальвией;
  • Пиретрум девичий Снежный шар вырастает до 30 см. Растет кустом с большим числом белых махровых цветов, внешне схожих с подушечками. Для роста такой ромашке требуется солнечное место. Такой пиретрум распространен на территории Северной Африки, Ближнего Востока и юге Европы;
  • Пиретрум девичий Ауреум растет кустами с небольшими цветами, похожими на обычные ромашки с лепестками светло-лимонного цвета. Период цветения — с июня по август;
  • Вырастает до 15 сантиметров. Это густомахровое растение с цветками снежного или бледно-желтого окраса. Цветки похожи на подушечки. Цветение проходит с июня по август. Обычно выращиваются группами.

  • Пиретрум девичий Пленум — невысокие махровые цветки белого окраса со светло-желтой серединой;
  • Пиретрум девичий Карлос — это цветы белого цвета с приятным запахом. Такая ромашка неприхотливое растением, которое положительно относится к холоду. Своей высотой достигает 15 сантиметров. Цветы — махровые, похожи на подушечки.

посадка и уход в открытом грунте, выращивание Далматской, Робинсон, Кавказской ромашек

Пиретрум – «персидская ромашка», растение, известное многим цветоводам. Высадить его на садовом участке может даже начинающий любитель, оно неприхотливо и требует минимального ухода, а цветет долго и красиво. На сегодняшний день выведено около сотни сортов, среди которых можно встретить как скромные белые ромашки, так и эффектные красные цветы.

Описание

Каждый сорт пиретрума имеет свои отличительные особенности. Но есть и общие черты, присущие всему виду.

Большинство представителей семейства являются травянистыми многолетниками, которые густо заполняют клумбу или участок земли, образуя цветочные кусты. Высота стебля может быть достаточно высокой – от 30 сантиметров до одного метра. Стебель крепкий, прямостоящий, восходящий, ветвистый или опущенный, от светло-зеленого до темно-зеленого цвета. По основанию он усыпан листьями, которые у корня длинные и широкие, а ближе к соцветию – маленькие и узкие. На стебле листья располагаются в очередном порядке.

Форма листа сложная, перисторассеченная, то есть состоит из разного количества узких сегментов. Существует двоичное, троичное и множественное сечение.

Сами соцветия могут быть маленькими, как у полевой ромашки (3-5см в диаметре), и достаточно крупными (от 5 до 8см). Отдельно стоит выделить крупноцветковые сорта, где диаметр окружности, образованной листьями, может превышать 8 сантиметров.

Сердцевинки цветов выпуклые, плоские или с небольшим углублением по центру, плотные, имеют ярко-желтую, светло-желтую или желто-зеленую окраску.

Соцветия по пышности могут напоминать хризантемы, герберы и астры. Лепестки в форме язычков различны по цвету, от белых до насыщенно-красных. Кончик язычка округлый или острый, длина от нескольких миллиметров до нескольких сантиметров, в зависимости от сорта. Также сорт определяет время цветения пиретрумов – промежуток с конца весны до конца лета.

Сорта

Несмотря на огромное количество разновидностей ромашек, на территории СНГ распространены лишь 50 с небольшим видов, среди которых в условиях российского климата популярны около десятка. К ним относятся самые устойчивые к прохладе, осадкам и недостатку солнечного света.

Пиретрум обыкновенный

Это средиземноморский или кавказский дальний родственник всем знакомой полевой ромашки. По внешнему виду он очень похож на ромашку аптечную: бело-серебристые или молочно-белые лепестки, желтая сердцевинка, прямой стебель с перисто-рассеченными листьями. Но цветки гораздо крупнее. Высокие стебли до 60см образуют пышные кусты, которые украшают палисадники и клумбы, и подходят для срезки.

При правильном уходе после срезки, цветы могут простоять до нескольких недель. Для этого нужно раз в несколько дней менять воду и обновлять закупорившийся срез на стебле. Срез должен быть косым, чтобы не плотно прилегал к днищу и стенкам емкости с водой, и цветок мог «пить».

Пиретрум лучше «схватится» на земельном участке, если предварительно в начале весны высадить его в закрытый грунт.

При температуре от 15 до 24 градусов первые всходы появятся в течение двух недель, затем им нужно дать окрепнуть, а уже потом высаживать в открытый грунт.

В первый год растение не цветет. В открытом грунте оно лишь даст листву не выше 20-30 сантиметров. После зимовки, на второй год, появятся цветки, причем, на разных сортах в разное время. Пиретрум обыкновенный зацветет в мае-июне, а при хорошем подкорме может вторично порадовать цветовода в июле-августе.

Кусты пиретрума могут разрастаться достаточно пышно. Иногда стебли не выдерживают тяжести соцветий и клонятся к земле, поэтому бурно разросшуюся зелень лучше подвязывать.

Пиретрум девичий или ромашка девичья

Получил свое название за нежный, аккуратный внешний вид и лекарственные свойства в лечении женских заболеваний.

Это один из самых красивых и необычных сортов пиретрума. Кусты достаточно невысокие – до 50см, прямостоящие, с разветвлением в верхней части и густой листвой, усыпаны небольшими головками цветов. Соцветия пышные, окружены одним-двумя рядами коротких лепестков по краю пышной сердцевины, похожей на помпонную хризантему. Диаметр их совсем небольшой – 2-3 сантиметра.

Сердцевина не имеет привычного вида и цвета. Она напоминает срезанный пополам шарик из трубчатых лепестков, плотно прижатых друг к дуру.

За счет своего оригинального вида пиретрум девичий красиво смотрится в составе букетов с более крупными цветами, в пышных букетах с хризантемами и сам по себе. На клумбе в саду он будет радовать глаз в течение 4-5 недель в середине лета, а в вазе простоит до 3 недель.

Отличительная особенность девичьей ромашки – тонкий нежный аромат соцветий.

Пиретрум далматский или далматская ромашка

Также встречается название «пиретрум пепельнолистный». Это растение, которое часто путают с ромашкой обыкновенной из-за схожего внешнего вида.

В отличие от привычного облика «гадального» цветка, далматская ромашка имеет более яркую и крупную сердцевинку и укороченные листья в два ряда. Корзинка соцветия расположена на верхушке ребристых стеблей. Стебли и листья ярко-зеленые или серо-зеленые, как будто припыленные. Нижний край покрыт густым слоем пепельно-зеленых волосков; сами листья сегментированные, как у всех представителей семейства.

Далматская ромашка неприхотлива, её можно засеивать ранней весной сразу в удобренный грунт. В первые два года прорастают листва и стебли, затем многолетник начинает цвести.

Пиретрум далматский обладает специфичным запахом, который часто раздражает слизистую и вызывает чих.

Кавказская ромашка

Также известна как «пиретрум кавказский» и «ромашка розовая». На самом деле, это два разных вида, но идентичность их свойств и ботанических признаков делает их трудноотличимыми друг от друга.

Оба растения – многолетники с ветвистым корневищем, из которого произрастают немногочисленные прямые стебли. По всей длине стеблей расположены редкие, очередные, глубоко рассеченные листья. На верхушке располагаются крупные корзинки соцветий, состоящих из ярких язычковых лепестков и желтых трубчатых.

Окраска лепестков может быть переменчивой в разные годы. Растения цветут на 2-3 год с июня по июль.

Пиретрум бальзамический или калуфер

В народе больше известен как пижма. Выращивается не ради красоты, а из-за лекарственных свойств. По внешнему виду напоминает сердцевинки ромашек без лепестков. Кусты растения высокие, разветвленные, обильно усеянные листьями темно-зеленого цвета.

Робинсон

Пиретрумы этого сорта – гиганты. Их отличает большая высота – около 70-80см, ярко-алый цвет корзинки, прямой стебель с небольшим количеством листьев. Цветут большими яркими корзинками насыщенного цвета. Все это делает цветы «Робинсон Гигант Ред» схожими с герберой.

Крупные пиретрумы высаживают в цветники, на клумбы и рабатки, срезают для добавления в букеты. Полюбоваться этой красотой можно с середины июня до конца июля.

Пиретрум красивый

Растение высотой до 50см. Малочисленные прямостоящие стебли с небольшим количеством листьев увенчаны достаточно крупным ромашковидным цветком с желто-зеленой сердцевиной и одним рядом белых язычковых цветков. По форме бывают игольчатые или с небольшим линейным отгибом.

Цветовая гамма

Пиретрумы отличаются богатым спектром оттенков, в которые окрашены цветки.

На садовых участках и клумбах встречается белая, пепельнолистая, нежно-сиреневая, розовая, бордовая ромашка. Как у георгина, возможна смесь разных красок на одном цветке, и изменения пигмента с каждым новым цветением. Это не кардинальные перемены, белый цветок не распустится красным, но цвет может меняться от менее насыщенного к более насыщенному и наоборот.

Свойства

Помимо красивого внешнего вида, растение обладает рядом полезных свойств в разных областях.

В медицине

В первую очередь, растение ценится за лекарственные качества. При этом существуют не только рецепты народной медицины, но и медикаментозные препараты, производимые в лабораториях. Из разных частей этой ромашки получают:

  • Противовоспалительные и жаропонижающие препараты. По своему воздействию настойки и отвары из листьев похожи на действие аспирина». Их можно применять как внутрь при простудах и воспалительных процессах, чтобы сбить высокую температуру и обеззаразить организм, так и наружно. При наружном применении лекарство действует как антисептик на раны и повреждения кожного покрова.
  • Противомигренозные. Пиретрум – сильнейшее лекарство от мигрени. Его действие основано на наличии в мякоти листьев вещества, блокирующего причину болевого приступа – партенолида. Оно устраняет не симптоматику, а саму проблему, вызывающую мигрень. Партенолид приостанавливает выработку серотонина, избыток которого в клетках головного мозга является источником болевых приступов.

Сравнимо воздействие пиретрума разве что с дорогостоящими лекарствами, которые, в отличие от растения, имеют ряд побочных эффектов.

  • Болеутоляющие. Листва ромашковидного растения содержит вещества-ингибиторы, которые останавливают действие веществ, вызывающих болевые ощущения в организме. На этом же принципе основаны его антибактериальные свойства.
  • Противотромбозные. Лекарства на основе пиретрума способно бороться с такой распространенной среди женщин и мужчин проблемой, как образование тромбов в венах. Особенно оно показано тем, кто много времени проводит в положении сидя и пережимает сосуды. Принимать препараты можно при имеющихся проблемах и для профилактики, но только после консультации с врачом.
  • Противоревматические. Пиретрум часто встречается в составе кремов, мазей и препаратов для приема внутрь, благодаря обезболивающим качествам. Стоит он на порядок меньше разрекламированных средств, снимающих боль во время обострения, а решает проблему на более глубоком уровне.
  • Гипертонические. В сочетании с другими компонентами регулирует кровяное давление, предотвращая развитие гипертонии.
  • Антиаллергенные. Пиретрум ускоряет лечение различных высыпаний, дерматитов, псориаза и аллергических реакций. Эффективен в форме готовых таблеток и отваров из листьев растения.
  • Лекарства при женских заболеваниях. Недаром среди сортов ромашки встречается “пиретрум девичий”. Он эффективно снимает боли гладкомышечной мускулатуры, восстанавливает регулярный цикл, подходит для профилактики этих проблем.

В косметологии

Не обошлось без пиретрума в индустрии красоты. Этот натуральный ингредиент прекрасно работает в народных рецептах и в составе кремов для кожи лица. Он эффективно борется с такими проблемами как воспаления, покраснения, неровный тон кожи, ранние морщины.

Показано применение пиретрума обладательницам проблемной кожи и кожи, склонной к проявлению акне.

Также экстракт пиретрума успокаивает слишком чувствительную кожу и снимает раздражение. Это свойство делает его необходимым компонентом не только в составе женских уходовых средств, но и в составе мужских лосьонов после бритья.

Однако, стоит быть осторожным в применении препарата в качестве лекарства или косметики, так как он может вызывать аллергические реакции и раздражение в области рта.

В хозяйстве

Широкое распространение получил пиретрум в качестве натуральных инсектицидов. Его антипаразитические свойства объясняются наличием в составе вещества под названием пиретрин. Он ядовит для большинства вредителей, но безопасен для человека и животных. Наибольшая концентрация перитрина встречается в листьях далматской ромашки, розовой ромашки и персидской ромашки.

Препараты против насекомых изготавливаются из высушенных соцветий пиретрумов. Порошок нужно развести в воде и полить раствором землю на грядках с овощными культурами. Также растение будет защищать урожай от вредителей, если его просто высадить по периметру.

Посадка в открытом грунте и уход

Пиретрумы – многолетние растения. Они неприхотливы в уходе, прекрасно переживают зимние холода, зацветают несколько лет подряд. Но для того, чтобы растение радовало своей красотой, его нужно правильно посадить.

Для большинства сортов подходит предварительное выращивание саженцев из семян в закрытом грунте.

Делается это следующим образом.

  • Отбор семян. Этот этап важен, поскольку качественные семена дают хорошие всходы, а из некачественных может не прорасти вообще ничего.
  • Высадка семян в грунт. Для этого можно использовать деревянные ящики иди другие емкости, которые накрывают пленкой для создания парникового эффекта. Высаживаются семена в марте-апреле.
  • Уход за ростками. Когда проклюнутся первые росточки, их нужно держать в тепле, поливать, хранить в месте, доступном для солнечного света. В парниковых условиях при 15-24 градусах они окрепнут, и тогда можно высаживать в открытый грунт. Удобрять почву не обязательно, растение приживется и так.

Если нет времени и желания возиться с проращиванием семян в закрытом грунте – ничего страшного. Пиретрум можно высаживать сразу на клумбу. При таком способе размножения цветов, они сохранят свою всхожесть в течение 3-4 лет.

Высаживать семена в открытый грунт можно в марте-апреле, в легкую почву. Место не должно быть сырым и тенистым, иначе растение не будет густым и ярким, а вытянется в поисках солнечного света и поблекнет.

Сеять семена следует в неглубокие лунки на расстоянии 2-3 сантиметров. Когда сеянцы прорастут, их важно не пересушивать и не слишком часто поливать.

Опытные цветоводы советуют использовать одну маленькую хитрость, чтобы получить крепкие и хорошие семена – посеять их под зиму.

Для этого их нужно высеять в емкость с крышкой (подойдут пищевые контейнеры с тонкими стенками или коробки из-под тортов), прикопать в грядку и присыпать листьями. За зиму они окрепнут, а весной, в марте, их нужно выкопать и поставить на подоконник для проращивания.

Особенности ухода

Пиретрум – растение для тех, у кого мало времени на уход за садом. Достаточно высадить его на солнечном месте или в полутени, в почву, которая легко пропускает воду, и красивые цветочные кусты к середине лета обеспечены.

Прекрасный симбиоз образуют пиретрумы с овощными культурами. Если высадить их вдоль грядок, они обеспечат надежную защиту от вредителей: от блох, мошек, гусениц, клопов, тараканов и других паразитов.

Пиретрум любит расти свободно, поэтому рекомендуется соблюдать дистанцию в несколько сантиметров, высаживая саженцы или семена.

Подкорм

Во время прорастания семян и цветения растение не требует дополнительного питания. Все, что нужно, оно берет из почвы и воды. Но ближе к осени, когда закончилось цветение, сухие корзинки нужно срезать, а оставшуюся растительность подкормить комплексным удобрением.

Порошок из магазина легко заменит домашний рецепт. Хорошо справляется со своей задачей трехдневный настой из сорняков. Если полить им корни пиретрума, он окрепнет, станет здоровее, и может зацвести повторно. Однако не стоит этого делать, если сорт цветка редкий. Из-за повторного цветения оно не успеет подготовиться к зиме и погибнет в холода.

В подкормке нет необходимости, если растение изначально было высажено на плодородную почву, которая содержит достаточно питательных веществ и влаги.

Полив

В вопросе влажности важно найти баланс. Пиретрум одинаково не любит слишком сухую и болотистую почву. К тому же, в излишне влажной земле могут размножиться болезнетворные бактерии, которые испортят корневую систему растения. Цветок попросту сгниёт.

При недостаточном поливе в засуху пиретрум мельчает, плохо растет, теряет цвет. Цветки быстро опадают, поскольку растению не хватает воды на все части. После этого цветок «впадет в спячку» до следующей весны и не зацветает вторично, а редкие сорта и вовсе погибают.

Обрезка

После первых лет жизни пиретрумы начинают цвести очень рано – уже в мае. К середине лета, когда соцветия опадают, растение начинает тяготить обилие жухлой листвы и цветков. Это не только не эстетично, но и доставляет ему неудобства, поэтому кустики пиретрума нужно постричь.

Все сухие, сломавшиеся веточки, пожухлую листву и осыпавшиеся головки цветов нужно аккуратно обработать секатором, после чего удобрить корни раствором. Это спровоцирует растение на повторное цветение в конце лета.

Использование в ландшафтном дизайне

Красивые цветы – один из главных элементов ландшафтного дизайна. Без них сложно создать полноценную композицию, ведь зеленые растения являются лишь фоном, а цветы добавляют яркости и стиля. С помощью них можно связать воедино все живые составляющие сада, природные материалы, разные предметы обстановки.

Пиретрумы отвечают всем критериям отбора цветов для ландшафтного дизайна:

  • Многолетники. Это не обязательное условие при выборе цветов для садовой композиции, но имеет свои плюсы. В течение трех-четырех лет у нее будет основа, которую не нужно возделывать заново каждую весну, и можно по-новому обыгрывать из сезона в сезон.
  • Стойкость. Продолжительность цветения ромашковидных цветов можно назвать рекордной. В сравнении с пионами, которые опадают буквально за неделю, пиретрумы цветут больше месяца.
  • Выразительность. Богатая палитра оттенков, в которые окрашены лепестки соцветий, делает это растение ярким, заметным, «говорящим» элементом в дизайне садового участка. При этом его красота остается скромной и элегантной.
  • Неприхотливость. Пиретрум не из тех цветов, которые требуют ежедневного ухода. Достаточно поливать их и изредка срезать засохшие листья или стебли.
  • Защита от вредителей. Растение убережет своих соседей, не одаренных от природы веществами, отпугивающими вредителей;
  • Большое количество видов и сортов. Их настолько много, что дизайн ландшафта можно продумать с использованием только пиретрумов. При этом они зацветают и отцветают в разное время, и в течение лета яркие огоньки соцветий будут поочередно вспыхивать на разных участках сада.
  • Ещё один плюс разнообразия видов в том, что они отличаются по высоте и диаметру соцветий, что позволяет создавать разноуровневые композиции.
  • Сочетаемость сортов между собой и с другими цветами. Ромашковидные растения комплементарны друг другу и разным сортам цветов, будь то еще более скромные экземпляры, или благородные розы.

О том, как использовать пиретрум против насекомых в саду и дома, смотрите в видео.

“Растет для you.com”

Висячие сады древнего Вавилона

История садового дизайна
Влияние персидского ковра
Самые старые изображения садов, которые у нас есть, взяты из Египта. Они изображают сцены с растениями и животными, соединенными способами, доставляющими удовольствие, а также функциональностью. Одна такая картина, датированная 1400 годом до нашей эры, находится в Британском музее и изображает декоративный пруд с рыбой.Пруд представляет собой прямоугольник с каменной каймой. В пруду водятся рыбы, водоплавающие птицы, цветы и заросли камыша по краям. Вокруг пруда растут фруктовые деревья, а сбоку – слуга, держащий корзину с фруктами, гранатами или виноградом и кувшин с вином.

К III веку до нашей эры рыночные огороды, огороды, где выращивали фрукты и овощи на продажу, были обычным явлением в Средиземноморье и Востоке. Во многих городах была роща деревьев или парк приятного или религиозного характера (священная роща).Выращивание трав было особенно связано с храмами, которые требовали их использования для ритуалов и поклонения. Были ладан, мирра, васильки, маки, лотосы и ромашка. Ромашка была идентифицирована анализом пыльцы как главный компонент масла для бальзамирования, используемого для мумификации Рамзеса II, умершего в 1224 году до нашей эры.

Персидские ковры дают нам хорошее представление о том, какими были ранние сады, потому что это стилизованные изображения садов. Границы предполагают пограничные стены и дорожки.Дизайн интерьера обычно состоит из четырех четвертей равного размера, каждая из которых разделена на шесть квадратов. Они содержат поочередно клумбы с цветами в форме квадрата и круга, а также платаны, расположенные по внутренним углам четырех секций. Правители иногда приносили ковры в сад, чтобы положить их на землю или использовать как навес от солнца. Использование ковра таким образом представляет собой платформу с навесом или открытый павильон, который правитель возведет на пересечении водных путей.Всегда было четыре водных пути, небесные реки, и они образовывали крест. Когда мусульмане завоевали Персию, они с готовностью восприняли этот план сада из-за его близости с описаниями исламского рая, места, в котором обитали все прелести горящих пустынных регионов: фонтаны, тень и фрукты. Марко Поло описал настоящий персидский сад как рай, засаженный лучшими в мире фруктами, с четырьмя каналами: один течет вином, один – молоком, один – медом, а третий – водой.Эта концепция сада распространилась по территории, завоеванной мусульманами в 7 веке.

Греки и римляне Висячие сады Вавилона
Висячие сады Вавилона, одно из семи чудес света на территории современного Ирака, на самом деле представляли собой террасированный сад на крыше, построенный над массивным арочным каменным фундаментом и огромными складскими помещениями. крыши гидроизолированы. Грунт был заложен достаточно глубоко, чтобы расти деревья, а вода из глубоких колодцев подавалась с помощью гидравлической машины.Записи показывают, что тимьян, кориандр, шафран, анис, мак, мандрагора, фосмарин и конопля выращивались вместе с декоративными растениями.

Как исламские завоевания распространили концепцию персидского сада, так и завоевания Александра Македонского (356-323 гг. До н.э.) сделали то же самое во всем эллинистическом мире. В описаниях персидских и греческих садов мало подробностей. Теофраст (371–287 гг. До н.э.), отец ботаники и ученик Платона и Аристотеля, имел сад, который был местом для занятий его друзей и учеников.Он оставил им сад после своей смерти. Можно предположить, что этот сад был одним из тех, где изучались растения, и может быть первым из существующих ботанических садов.

Римляне развили истинное искусство европейского садоводства. У нас есть описания римской виллы в трудах Варрона (ок. 116–27), ученого и писателя, и Плиния (23–79), натуралиста и писателя. У обоих были обширные сады. В садах вилл были крытые аркады с окнами, расположенными так, чтобы открываться панорама, открытые площадки и закрытые сады во внутреннем дворе, предназначенные для сохранения тепла и защиты от ветра, сохраняя их приятными как летом, так и зимой.Эти сады были геометрически точными с колоннадами и скульптурами, топиариями и платанами, каналами и фонтанами. Они подняли грядки и выращивали много других трав.

Персидские реки стали гидроузлами в руках опытных римских инженеров. Плиний описывает их на тосканской вилле, где все питалось никогда не пересыхающими ручьями, питавшими множество фонтанов. Один фонтан возник в центре небольшого двора, затененного четырьмя платанами, как на персидском ковре.Другой внутренний фонтан с чашей, окруженной крошечными струями, издавал приятный журчащий звук.

Вилла Варро могла похвастаться вольером и роскошной обеденной зоной с вращающимся столом с едой и напитками с чередующимися носиками для теплой и холодной воды. Стриженые беседки и топиарии – искусство дрессировки и придания искусственной формы кустам и деревьям – впервые встречаются на тосканской вилле. Римляне были заядлыми коллекционерами греческих скульптур, которые появлялись в их садах и выстраивались вдоль дорожек.Некоторые из этих деталей были подтверждены останками, найденными в Геркулануме, Помпеях, Конинбриге, Португалия, и Фишборне в Сассексе, Англия.

Раннее садоводство в Америке
Джон Бартрам (1699-1777), фермер-квакер, начал свой сад в 1728 году. Хотя он и не дизайнер сада, он был первым человеком, который собрал большую коллекцию местных североамериканских растений. В его саду также было много видов, присланных ему из других колоний, Вест-Индии и ботаников со всего мира.В 1729 году он основал собственный питомник и поставлял растения Джорджу Вашингтону в Маунт-Вернон и Томасу Джефферсону в Монтичелло. В 1736 году Бартрам стал охотником за растениями и в течение следующих 30 лет совершил серию экспедиций для сбора новых видов флоры Северной Америки. Ему приписывают введение в культуру около 200 видов.

На своей ферме площадью 102 акра в Филадельфии Бартрам практиковал методы, которые помогли ему собрать в два раза больше урожая с акра, чем его соседи.Самое старое дерево Gingko biloba и дерево желтого дерева ( Cladrastis lutea ) все еще существуют в его садах, которые можно посетить сегодня, потому что они были превращены в парк в 1891 году и переданы в дар городу Филадельфии. Его сыновья первыми создали каталог питомников по почте в США

.

В 1936 году овощные, травяные и цветочные сады Джорджа Вашингтона были восстановлены с использованием дневников, которые он вел с 1748 по 1799 год. У него была страсть к фруктовым деревьям, и он обыскивал сельскую местность в поисках новых местных деревьев и кустарников для своего сада.Он был мастером садоводства, как и Джефферсон, и их труды, вместе взятые, предоставляют наиболее полную и лучшую информацию о послевоенном садоводстве на юге Соединенных Штатов.

Будучи посланником при дворе Людовика XIV, Томас Джефферсон имел возможность изучать французские сады, и в это время он также совершил поездку по английским садам, чтобы изучить садоводство и садоводство. Это, безусловно, способствовало совершенству дизайна Монтичелло. Одна из его главных особенностей – долгая прогулка по краю большой лужайки с насаждениями по обе стороны от местных цветущих растений и кустарников. Монтичелло прекрасно поддерживается как памятник его изобретательности и широким интересам.

Коттеджные сады и Гертруда Джекилл
Коттеджные сады, бордюрные сады и дикие сады имеют общую тему. Коттеджный сад сочетает в себе формальные очертания и ощущение замкнутости старомодного сада, где цветы аккуратно граничат с дорожками и стенами (также называемыми пограничными садами) с беззаботными дикими садами. Розы густые, вьющиеся растения растут, а крошечные цветы приютились под цветущими кустами, открывая пышную смесь растущих растений, полных скрытых сокровищ.Именно художники и писатели викторианской эпохи повлияли на то, как мы смотрим на дачный сад. Уильям Робинсон, писатель и садовник (1838-1935), в своей книге The English Flower Garden определяет очарование коттеджного сада как «отсутствие какого-либо претенциозного плана, который позволяет цветам рассказывать свою историю до глубины души». Фоном могут быть высокие кусты, частокол или деревянный забор. Альпинисты изгибаются над решетками и создают вертикальные линии. Робинсон выступал за лесное садоводство и отстаивал естественный подход к неформальному саду.Он любил скрывать формальную архитектуру под буйством смешанных местных и экзотических многолетних растений.

Этот стиль определенно отражен в дизайне Гертруды Джекилл (1842-1932). Именно Гертруда Джекилл, подруга и соратница Робинсон, примирила две точки зрения, и любое исследование садового дизайна будет неполным без ее вклада. Современница Робинсона, ей приписывают «изобретение» и популяризацию пограничного сада. Бордюрный сад – это узкое насаждение вдоль некоторого участка или границы сада: дорожки, стены, дороги или лужайки.Это может быть смесь растений или только один вид, от самых устойчивых кустарников до самых нежных из однолетников. Под ним подразумевается гобелен из разных растений вне зависимости от размещения. Ее схемы посадки были обильными, тщательно спланированными и контролируемыми для достижения желаемого эффекта. Как художник, она провела время с импрессионистами в Париже, и когда ее зрение начало ухудшаться, она посвятила свою жизнь садоводству, оттачивая свою живописную теорию цвета, чтобы создавать садовые картины с ее бордюрами.Это было новшеством, и в ее партнерстве с Лютьенс, архитектором, спроектировавшим ее дом в Мунстед-Вуд, был создан новый английский садовый стиль.

Бордюр – это отчасти садоводство, отчасти искусство, а хороший – шедевр и того, и другого. Это требует точного знания того, когда растения цветут, требований к выращиванию, сочетания цветовых гармоний и баланса форм. Чтобы достичь цели Джекилла, она сажала большие грядки, контролировала смешение цветов, работала с формальным планом насаждений, использовала смесь растений, в том числе многие любимые садовые коттеджи, и использовала лужайки, чтобы увести от зданий, чтобы объединить сады с другими. лесной массив.Любой орнамент в саду был функциональным – сиденья, стены, лестницы, урны и скульптуры. Одним из ее величайших талантов было признание ценности гармонии и важности контраста, чтобы не допустить его превращения в монотонность.


Экстракт ромашки для лечения рака человека

J Clin Diagn Res. 2016 июл; 10 (7): FC05 – FC08.

, 1 , 2 и 3

Марьям Хоссейнпур

1 Факультет естественных наук, кафедра генетики, Университет Шахрекорд, Шахрекорд, Иран.

Мохсен Мобини-Дехкорди

2 Факультет естественных наук, отделение генетики, Университет Шахрекорд, Шахрекорд, Иран.

Хоссейн Теймори

3 Доцент кафедры генетики и биотехнологии, Центр клеточных и молекулярных исследований, Университет медицинских наук Шахрекорд, Шахрекорд, Иран.

1 Факультет естественных наук, отделение генетики, Университет Шахрекорд, Шахрекорд, Иран.

2 Факультет естественных наук, отделение генетики, Университет Шахрекорд, Шахрекорд, Иран.

3 Доцент кафедры генетики и биотехнологии, Центр клеточных и молекулярных исследований, Университет медицинских наук Шахрекорд, Шахрекорд, Иран.

Автор, ответственный за переписку. ИМЯ, АДРЕС, ИДЕНТИФИКАТОР ЭЛЕКТРОННОЙ ПОЧТЫ АВТОРА-КОРРЕСПОНДА: Д-р Хоссейн Теймори, доктор медицинских наук, доцент кафедры медицинской генетики, Университет медицинских наук Шахрекорд, Рахматия, Шахрекорд, Иран. Эл. Почта: [email protected]

Поступила 2 декабря 2015 г .; Изменения запрошены 23 января 2016 г .; Принята в печать 29 февраля 2016 г.

Copyright © 2016 Журнал клинических и диагностических исследованийЭта статья цитируется в других статьях в PMC.

Abstract

Введение

Сверхэкспрессия гена скваленсинтазы вызывает индукцию роста опухоли и уменьшение апоптоза. Этот ген, который сохраняется у дрожжей Saccharomyces cerevisiae и человека, назван ( ERG9 ).

Цель

В данной работе мы изучили влияние экстракта Matricaria recutita на экспрессию гена ERG9 (скваленсинтаза) в S.cerevisiae , который использовали в качестве модели организма в терапии рака.

Материалы и методы

S. cerevisiae культивировали в среде YPD плюс 0,250, 1000 и 3000 мкг / мл экстракта Matricaria recutita , и мы оценили экспрессию гена ( ERG9 ) с помощью ОТ-ПЦР в реальном времени. метод через 24 часа.

Использованный статистический анализ

Было проведено не менее 3 независимых экспериментов. Данные были проанализированы с использованием однофакторного дисперсионного анализа и теста Даннета.Значение p менее 0,01 считалось значимым.

Результаты

Мы обнаружили, что 250, 1000 и 3000 мкг / мл экстракта Matricaria recutita могут значительно снизить экспрессию гена ERG9 (p <0,01). Интересно, что экспрессия этого гена полностью подавлялась в концентрациях 1000 и 3000 мкг / мл.

Заключение

Это исследование предсказало, что экстракт Matricaria recutita оказывает противораковое действие у людей, поскольку он может подавлять экспрессию аналогового ключевого гена при этом злокачественном заболевании.Необходимо провести дальнейшие исследования, чтобы изучить его молекулярный механизм действия на уровне клеток млекопитающих.

Ключевые слова: Водно-спиртовой экстракт, Matricaria recutita , Лекарственные растения

Введение

Matricaria chamomilla (синоним: M. recutita ), широко известное как ромашка или немецкая ромашка [1], является ценным растением. который принадлежит к семейству сложноцветных, которое использовалось в фитотерапии для лечения ран, экземы, подагры, неврологических расстройств, оспы и других заболеваний.Экстракт этого растения обладает антиоксидантными, противомикробными и мягкими вяжущими свойствами [2]. Исследования, проведенные на животных, показывают, что он обладает противовоспалительным [3], противоаллергическим, антигипергликемическим, противоязвенным, противозудным [4], антимутагенным и снижающим уровень холестерина действием [5]. Ромашка используется для лечения различных желудочно-кишечных расстройств, таких как расстройство желудка, метеоризм, укачивание, анорексия, тошнота, рвота, диарея и запор или их сочетание [6]. Заражение паразитарными червями, малярию, симптомы простуды и гриппа можно лечить эфирным маслом ромашки.Кроме того, экстракт ромашки немного подавляет рост нормальных клеток, но это приводит к значительному снижению жизнеспособности различных линий раковых клеток [7]. Кроме того, водно-спиртовой экстракт этого растения оказывает антипролиферативное действие на дрожжевые клетки [8]. Биологическая активность этого растения связана с различными классами биоактивных соединений, которые в нем присутствуют. Цветки ромашки содержат более 120 биологически активных соединений. Терпеноиды, α-бисаболол, его оксиды и азулены являются основными составляющими этого растения.Было обнаружено, что в нем присутствуют различные терапевтически и биологически активные агенты, включая сесквитерпены, флавоноиды, кумарины и полиацетилены [4]. В экстрактах цветков ромашки содержится много фенольных соединений, таких как флавоноиды, апигенин, патулетин, кверцетин, лютеолин [9]. Хотя предыдущие исследования продемонстрировали, что экстракт ромашки оказывает антипролиферативное действие на дрожжи и различные раковые клетки человека, исследования по изучению его молекулярного механизма на соответствующей эукариотической модели еще не проводились.В этом отношении лекарственные растения в основном используются в течение длительного периода времени [10,11], и они оказались относительно безопасным и надежным источником для приготовления новых лекарств [12,13]. Исследования лекарственных растений, особенно механизмов их действия, помогают улучшить их действие.

Здесь был изучен молекулярный механизм действия водно-спиртового экстракта ромашки, чтобы оценить потенциальную полезность этого лекарственного растения при лечении рака человека.

Материалы и методы

Это экспериментальное исследование было проведено в Центре клеточных и молекулярных исследований Университета медицинских наук Шахрекорд (Иран) в течение 12 месяцев с сентября 2013 года по сентябрь 2014 года.

Растительные материалы и водно-спиртовой экстракт препарат: Утверждено. Цветков M. chamomilla. были приобретены у Goldarou Co. (Исфахан, Иран) и высушены в тени при 37 ° C. Экстракцию проводили перколяционным методом при 15-20 ° C с использованием 50% этанола.Сто граммов измельченной ромашки замачивали в 1,2 л этанола, раствор переносили в перколятор на три дня, фильтровали и упаривали при 37 ° C [14]. Высушенный материал выдерживали при -20 ° C до использования. Водно-спиртовой экстракт растворяли в ДМСО (диметилсульфоксид) (Sigma) для приготовления исходных растворов [7]. Позже его добавляли в питательную среду для достижения желаемой концентрации.

Дрожжи и питательные среды: Дрожжи, использованные в этом исследовании, представляли собой клеток Saccharomyces cerevisiae (PTCC 5052), которые были приобретены из коллекции персидских типовых культур в Тегеране, Иран.Перед культивированием образец дрожжей хранили при 4 ° C. S. cerevisiae культивировали в стерильной специфической среде дрожжевого экстракта, пептона, декстрозы (YPD), содержащей 2% глюкозы, 2% пептона и 1% дрожжевого экстракта, и инкубировали при 30 ° C в течение 48 часов. После создания чистой дрожжевой суспензии в бульонной среде 5 × 10 7 клеток были перенесены в жидкую среду, не содержащую растительного экстракта [(ДМСО 1% в качестве контроля), 250 мкг / мл, 1000 мкг / мл и 3000 мкг / мл воды ромашки. спиртовой экстракт] и помещали в шейкер инкубатора при 35 ° C на 24 ч [8].Чтобы оценить скорость роста, мы определили оптическую плотность при 600 нм с помощью спектрофотометра (DU 800 Beckman Coulter, CA, USA).

Экстракция РНК и синтез кДНК: Общую РНК экстрагировали в соответствии с инструкциями по изготовлению набора реагента Biozol (Bioplus). Концентрацию РНК и чистоту каждого образца измеряли с помощью спектрофотометра Thermo Scientific NanoDrop2000. кДНК синтезировали с помощью набора для двухэтапного синтеза кДНК (Vivantis) на основе протокола производителя с использованием случайных гексамеров.

Дизайн праймера и полимеразная цепная реакция в реальном времени: Наборы праймеров были разработаны с помощью онлайн-программного обеспечения Primer 3 (http://www.broad.mit.edu/cgibin/primer/primer3). Были использованы следующие праймеры: TUB1 : прямой 5’CCAAGGGCTATTTACGTGGA3 ’, обратный 5’GGTGTAATGGCCTCTTGCAT3’ [15]; ERG9 : вперед 5’TGAAAGCATGGGTCTTTTCC3 ’, назад 5’CAACCCCAGTTGTTCGTTTT3’. Последовательность каждого праймера проверяли в транскриптоме S. cerevisiae , используя инструмент Basic Local Alignment Search Tool (BLAST), чтобы гарантировать обнаружение одного гена.Специфичность праймеров была подтверждена гель-электрофорезом и анализом кривой плавления, а также подтвержден размер ампликона. Количественную оценку экспрессии гена ERG9 определяли с помощью ОТ-ПЦР в реальном времени. Количественную ОТ-ПЦР выполняли с использованием Rotor-gene 6000 (Corbett), набора thermo Scientific Maxima SYBR Green / ROX Q PCR Mastermix (2X) и специфических праймеров для генов ERG9 и TUB1 в качестве внутреннего контроля.

Условия цикла ПЦР были следующими: 1 цикл при 95 ° C в течение 10 минут (как начальная денатурация), 40 циклов при 95 ° C в течение 20 секунд, 60 ° C в течение 20 секунд и 72 ° C в течение 20 секунд и заключительный этап наращивания 72 ° C 5 мин.Количественный анализ генов в разных группах проводили сравнительным методом Ct (2− ΔΔCt , ΔCt = Ct TUB1 -Ct ERG9 , ΔΔCt = ΔCt Образец -ΔCt ) [Контроль -ΔCt ] 16].

Статистический анализ

Было проведено не менее 3 независимых экспериментов. Данные были проанализированы с использованием однофакторного дисперсионного анализа с последующим тестом Даннета с использованием программного обеспечения SPSS, версия 18.0. Результаты были представлены как среднее значение ± стандартное отклонение (SD).Значение p менее 0,01 считалось значимым.

Результаты

Оптимизация реакции ОТ-ПЦР

Оптимизация для каждого набора праймеров проводилась как с помощью обычных, так и количественных реакций ОТ-ПЦР. Обычную ПЦР проводили с градиентом температуры и проводили на 8% полиакриламидном геле []. Анализ кривой плавления показал уникальные пики плавления без образования димера праймера []. Эффективность ПЦР подтверждена стандартной кривой, полученной из серийных разведений объединенных кДНК [].

Оптимизация реакции ПЦР в реальном времени. (a) Одна полоса продукта ПЦР на полиакриламидном геле, фрагмент 141 п.н. амплифицирован из TUB1 линий 1-5 и фрагмент 157 п.н. амплифицирован из ERG9 строк 7-11, линии 6 и 12: нематричный контроль (NTC) . (b) Конкретная кривая плавления без димеров праймеров для амплификации с помощью ПЦР в реальном времени. (c) Стандартные кривые серии разведений кДНК для TUB1 и ERG9 , показывающие эффективность амплификации, близкую к 1.00.

Экспрессия гена

ERG9 в дрожжах, обработанных экстрактом.

Относительные уровни мРНК определяли с помощью ПЦР в реальном времени. TUB1 в качестве контрольного гена использовали для нормализации данных всех образцов.

Было обнаружено, что экспрессия гена при концентрации экстракта 250 мкг / мл значительно снизилась по сравнению с контрольной группой (p <0,01). При концентрациях 1000 и 3000 мкг / мл экспрессия заметно снижалась, и Rotor-Gene 6000 (Corbett) [] не обнаруживал мРНК.

Влияние водно-спиртового экстракта ромашки на экспрессию гена ERG9 в дрожжах; Среда, содержащая 1% (об. / Об.) ДМСО, была определена как отрицательный контроль. Значения представляют собой средние значения ± стандартное отклонение (n = 3). р <0,01 по сравнению с контролем.

Обсуждение

Натуральные продукты являются важным источником терапевтических агентов, которые являются безопасными и экономичными лекарствами [17]. Чтобы понять роль этих природных соединений, нам нужны эффективные и экономичные биологические системы. S.cerevisiae является подходящей эукариотической модельной системой для открытия лекарств и лечения рака.Высокая сохранность многих основных клеточных и молекулярных процессов и функций генов стала причиной выбора S. cerevisiae в качестве модели организма для различных молекулярных анализов [18,19].

Около 30% известных генов, участвующих в заболеваниях человека, могут иметь ортологи у дрожжей [20–22]; одним из этих консервативных генов является ERG9 , кодирующий скваленсинтазу. Структура и механизм реакции скваленсинтазы (SQS) заметно сохраняются на протяжении всей эволюции [23,24].

SQS играет решающую роль в биосинтезе холестерина и катализирует первую стадию стериновой ветви мевалонатного / изопреноидного пути [24]. Активность SQS и синтез холестерина de novo определяют уровни содержания холестерина в липидных рафтах, мембранном домене, обогащенном холестерином и сфинголипидами. Повышенные уровни содержания холестерина в липидных рафтах связаны с усилением роста опухоли и снижением апоптоза [25]. Недавние открытия показали, что сверхэкспрессия усиливает метастазирование при раке легких [26].В нашей предыдущей работе мы показали, что воздействие экстрактов ромашки вызывало значительное снижение жизнеспособности клеток у S. cerevisiae [8] при концентрации 3000 мкг / мл, но не при концентрациях 500, 1000 и 2000 мкг / мл; Здесь мы использовали эти дрожжи как модель генетического организма, чтобы оценить механизм действия ромашки; мы обнаружили, что экстракт ромашки значительно снижал уровень мРНК ERG9 при концентрации 250 мкг / мл по сравнению с контролем. Интересно, что при концентрациях 1000 и 3000 мкг / мл Rotor-Gene 6000 не обнаруживал мРНК (p <0.01) []. Этот результат показал, что уменьшение или полное ингибирование гена ERG9 (250 мкг / мл и 1000 мкг / мл) не могло уменьшить рост дрожжевых клеток.

В Slusarz A et al. Было изучено противоопухолевое действие экстракта ромашки, наиболее важного компонента этого экстракта, эпигенина, который составляет 80% экстракта, и его влияние на сигнальный путь hedgehog. Путь передачи сигналов hedgehog является одним из наиболее важных путей, которые усиливают передачу сигналов и вносят большой вклад в прогрессирование рака простаты.Slusarz A et al., Исследование показало, что эпигенин снижает концентрацию мРНК Gli1 (фактор транскрипции, который вызывает активацию генов-мишеней в этом пути) [27].

Поскольку экстракт ромашки содержит более 120 биоактивных соединений, он может вызывать не только снижение пути передачи сигналов hedgehog за счет снижения экспрессии гена Gli1, но также может вызывать индуцированный апоптоз и уменьшать рост раковых клеток за счет снижения экспрессии гена ERG9 .

Примечательно, что нокдаун SQS ослабляет инвазионный потенциал клеток рака легких и предстательной железы, аналогичные эффекты могут возникать, когда раковые клетки обрабатываются химическим ингибитором SQS i.е. Zaragoza acid A. Следовательно, ингибиторы SQS могут иметь значительный потенциал для противоопухолевого вмешательства [25,26].

Это исследование показывает снижение экспрессии гена ERG9 при лечении экстрактом ромашки, но не показывает корреляции с уровнем белка или активностью SQS скваленсинтаз (SQS).

Следовательно, дополнительное внимание следует уделить механизму действия экстракта ромашки на уровне клеток млекопитающих, и рекомендуется идентифицировать эффективное вещество этого экстракта на экспрессию гена ERG9 .

Заключение

Это исследование демонстрирует молекулярный механизм антипролиферативного действия экстракта ромашки. Мы обнаружили, что экстракт ромашки значительно снижает концентрацию мРНК ERG9 ; Наши результаты о полном ингибировании экспрессии гена ERG9 в присутствии экстрактов ромашки позволяют сделать вывод о том, что его можно использовать в качестве перспективного доступного, более безопасного и более доступного противоракового агента.

Благодарности

Мы благодарны сотрудникам Центра клеточных и молекулярных исследований Университета медицинских наук Шахрекорд.Кроме того, мы благодарны аспирантуре Шахрекордского университета за финансовую и духовную поддержку. Работа была поддержана проректором по исследованиям и технологиям Университета медицинских наук Шахрекорд (1400 г.).

Примечания

Финансовые или другие конкурирующие интересы

Как указано выше.

Ссылки

[1] Толоуи М., Алинежад С., Сабери Р., Эсламифар А., Зад С.Дж., Джейманд К. и др. Эффект Matricaria chamomilla L.эфирное масло цветов на росте и ультраструктуре Aspergillus niger van Tieghem. Международный журнал пищевой микробиологии. 2010. 139 (3): 127–33. [PubMed] [Google Scholar] [2] Перейра Р.П., Фачинетто Р., де Соуза Престес А., Пунтель Р.Л., да Силва Г.Н.С., Хайнцманн Б.М. и др. Антиоксидантные эффекты различных экстрактов из Melissa officinalis, Matricaria recutita и Cymbopogon citratus . Neurochem Res. 2009. 34 (5): 973–83. [PubMed] [Google Scholar] [3] Ганзера М., Шнайдер П., Ступпнер Х.Ингибирующее действие эфирного масла ромашки Matricaria recutita L. и его основных компонентов на ферменты цитохрома P450 человека. Life Sci. 2006. 78 (8): 856–61. [PubMed] [Google Scholar] [4] Гупта В., Миттал П., Бансал П., Хокра С.Л., Каушик Д. Фармакологический потенциал Matricaria recutita -A review. Int J Pharm Sci Drug Res. 2010. 2 (1): 12–16. [Google Scholar] [5] Петронильо С., Марашин М., Коимбра М.А., Роча С.М. In vitro и in vivo исследования натуральных продуктов: проблема их оценки.Пример ромашки Matricaria recutita L. Ind Crops Prod. 2012; 40: 1–12. [Google Scholar] [7] Шривастава Дж. К., Гупта С. Антипролиферативные и апоптотические эффекты экстракта ромашки в различных раковых клетках человека. J. Agric Food Chem. 2007. 55 (23): 9470–78. [PubMed] [Google Scholar] [8] Хоссейнпур М., Мобини-Дехкорди М., Саффар Б., Хоссейн Т. Антипролиферативные эффекты Matricaria chamomilla на Saccharomyces cerevisiae . J Herb Med Pharmacol. 2013; 2 (2) [Google Scholar] [9] McKay DL, Blumberg JB.Обзор биологической активности и потенциальной пользы для здоровья чая из перечной мяты Mentha piperita L. Исследования в области фитотерапии. 2006. 20 (8): 619–33. [PubMed] [Google Scholar] [10] Рафиян-Копай М., Сьюэлл Р.Д. История и взлеты и падения использования лечебных трав. Журнал фармакологии Herb Med. 2014; 3 (1) [Google Scholar] [11] Бахмани М., Заргаран А., Рафиян-Копай М., Саки К. Этноботаническое исследование лекарственных растений, используемых для лечения сахарного диабета в Урмии, Северо-Западный Иран. Азиатско-Тихоокеанский журнал тропической медицины.2014; 7: S348 – S54. [PubMed] [Google Scholar] [12] Ширзад Х., Насри Х. Токсичность и безопасность лекарственных растений. Журнал фармакологии Herb Med. 2014; 2 (2) [Google Scholar] [13] Саки К., Бахмани М., Рафиян-Копай М. Влияние важнейших лекарственных растений на два важных психических расстройства (тревожность и депрессию) – обзор. Азиатско-Тихоокеанский журнал тропической медицины. 2014; 7: S34 – S42. [PubMed] [Google Scholar] [14] Karbalay-Doust S, Noorafshan A, Dehghani F, Panjehshahin M, Monabati A. Влияние водно-спиртового экстракта Matricaria chamomilla на уровни тестостерона и эстрадиола в сыворотке, качество сперматозоидов и длину хвоста у крыса.Iran J Med Sci. 2010. 35 (2): 122–28. [Google Scholar] [15] Сян Л., Сун К., Лу Дж., Венг Й., Таока А., Сакагами Ю. и др. Антивозрастное действие флоридзина, яблочного полифенола, на дрожжи через гены SOD и Sir2. Биология, биотехнология и биохимия. 2011; 75 (5): 854–58. [PubMed] [Google Scholar] [16] Ван Дж, Ни Зи, Дуань Зи, Ван Дж, Ли Ф. Измененная экспрессия индуцируемого гипоксией фактора-1α (HIF-1α) и его регуляторных генов в тканях рака желудка. ПлоС один. 2014; 9 (6): e99835. [Бесплатная статья PMC] [PubMed] [Google Scholar] [17] Лахлоу М.Успех натуральных продуктов в открытии лекарств. Фармакология и фармация. 2013; 4: 17–31. [Google Scholar] [18] Ма Д. Применение дрожжей в открытии лекарств. Прогресс в исследованиях лекарств. Springer; 2001. С. 117–62. [PubMed] [Google Scholar] [19] Ауэрбах Д., Арнольдо А., Богдан Б., Фетчко М., Стагляр И. Открытие лекарств с использованием дрожжей в качестве модельной системы: функциональный геномный и протеомный взгляд. Curr Proteomics. 2005; 2 (1): 1–13. [Google Scholar] [20] Каратия Х., Вилаприньо Э., Соррибас А., Алвес Р. Saccharomyces cerevisiae как модельный организм: сравнительное исследование.ПлоС один. 2011; 6 (2): e16015. [Бесплатная статья PMC] [PubMed] [Google Scholar] [21] Биррелл GW, Giaever G, Chu AM, Davis RW, Brown JM. Полногеномный скрининг в Saccharomyces cerevisiae на гены, влияющие на чувствительность к УФ-излучению. Труды Национальной академии наук. 2001. 98 (22): 12608–13. [Бесплатная статья PMC] [PubMed] [Google Scholar] [22] Фори Ф. Генетические болезни человека: перекрестный разговор между человеком и дрожжами. Ген. 1997. 195 (1): 1–10. [PubMed] [Google Scholar] [23] Робинсон Г.В., Цай Й., Кинцле Б.К., Смит-Монрой, Калифорния, Бишоп Р.В.Сохранение скваленсинтетаз человека и грибов: сходство по структуре, функциям и регуляции. Молекулярная и клеточная биология. 1993. 13 (5): 2706–17. [Бесплатная статья PMC] [PubMed] [Google Scholar] [24] Накашима Т., Иноуэ Т., Ока А., Нишино Т., Осуми Т., Хата С. Клонирование, экспрессия и характеристика кДНК, кодирующих скваленсинтазу Arabidopsis thaliana. Труды Национальной академии наук. 1995. 92 (6): 2328–32. [Бесплатная статья PMC] [PubMed] [Google Scholar] [25] Брюссельманс К., Тиммерманс Л., Ван де Санде Т., Ван Велдховен П. П., Гуан Г., Шехтер И. и др.Скваленсинтаза, детерминанта Raft-ассоциированного холестерина и модулятор пролиферации раковых клеток. J Biol Chem. 2007. 282 (26): 18777–85. [PubMed] [Google Scholar] [26] Ян И-Ф, Ян И-Х, Лю И-П, Ян Ц-Джей, Су Ц-И, Чанг И-Ц и др. Скваленсинтаза индуцирует обогащение рецептора фактора некроза опухоли 1 в липидных рафтах, способствуя метастазированию рака легких. Американский журнал респираторной медицины и реанимации. 2014; 190 (6): 675–87. [PubMed] [Google Scholar] [27] Слюсарз А., Шенуда Н.С., Сакла М.С., Дренкхан С.К., Нарула А.С., Макдональд Р.С. и др.Обычные растительные соединения подавляют сигнальный путь hedgehog при раке простаты. Cancer Res. 2010. 70 (8): 3382–90. [PubMed] [Google Scholar]

Anthemis – обзор | Темы ScienceDirect

4 Род

Matricaria в традиционной медицине

Исторически римские ( Chamaemelum nobile ) и немецкие ( M. recutita ) ромашки часто использовались взаимозаменяемо или смешивались. Термин «ромашка» происходит от греческого слова, означающего «молотое яблоко», которое относится к запаху ромашки, напоминающему запах некоторых сортов яблок.Это происхождение сохранилось в испанском названии «manzanilla», от «manzana», что означает «яблоко». Название «Матрикария» происходит от латинского ( matrix означает матка), этот термин происходит от его применения у женщин в качестве фитотерапевтического средства для лечения проблем, связанных с менструальным циклом и прерыванием беременности.

Первое письменное сообщение о ромашке относится к Древнему Египту. « Папирус Эберса » представляет собой первое письменное собрание использования растений (содержащее более 800 рецептов) в медицинских целях в Древнем Египте.Это медицинский папирус, датируемый примерно 1500 годом до нашей эры, хотя, вероятно, это переиздание гораздо более старых рецептов. В папирусе важная роль отведена матрицарии (Ebers, 1987). Измельченные цветки ромашки использовали для облегчения кожи и профилактики дерматитов, а также в косметических препаратах. Древние египтяне использовали это растение не только для лечения больных, но и для почитания богов и для бальзамирования мертвых. В повязках мумии Рамзеса II были обнаружены следы пыльцы от Matricaria ; это растение, вероятно, было добавлено для того, чтобы дать фараону силу и спокойствие, необходимые для загробного путешествия (Cattabiani, 1996).

Египетская информация о лекарственных травах и лекарственных препаратах легла в основу греческой и римской фармакопей. Гиппократ Кос (V век до нашей эры), повсеместно признанный отцом современной медицины, имел глубокие познания в лекарственных травах. Гиппократ рекомендовал ромашку для лечения нескольких заболеваний, например, для очищения, защиты и борьбы с простудой. Асклепиад из Вифинии (I век до н.э.) был первым врачом, основавшим греческую медицину в Риме.Он был большим знатоком растений, используемых в медицине, и его любимой травой была ромашка (Gumpert, 1794). Диоскорид (I век нашей эры) был военным врачом и фармакогнозистом армии Нерона. Многие применения ромашки ( Anthemis arvensis , кукурузная ромашка) описаны в его работе De materia medica . Некоторые примеры из De materia medica : корни, цветы или травы, взятые в виде отвара, были полезны в качестве тонизирующего средства для очищения и полоскания глаз, ушей, носа и рта.Такие отвары также были полезны для изгнания мочевых и желчных камней, при желудочно-кишечных расстройствах (для лечения глистов, язвенной болезни, спазмов и воспалений), при желтухе и заболеваниях печени. Местное применение растения использовалось как противовоспалительное средство для лечения ран, укусов, ожогов и язв. При повторяющейся лихорадке рекомендовали свечи с ромашкой (Osbaldeston and Wood, 2000). Плиний Старший, современник Диоскорида, в своей работе « Naturalis Historia » описал множество способов применения ромашки (Bostock, 1855).Он также написал, что все части растения использовались как противоядие от укусов змей. Кроме того, ромашку использовали как мочегонное средство и для растворения камней в мочевом пузыре, для лечения метеоризма и поражения печени. Еще одно применение, о котором сообщил Плиний Старший, было местное применение для лечения свищей глаза. Кроме того, местное применение измельченного растения использовалось для лечения нагноившихся язв. Плиний сообщил, что данное растение в виде питья является возбудителем менструального цикла и может быть полезно для изгнания мертвого плода.Среди римских врачей, а впоследствии и среди арабских врачей, ромашки считались растением, обладающим сильным абортивным действием и способным ускорять менструацию и высвобождение эмбрионов.

В средние века ромашка высоко ценилась в монастырской медицине. Ромашку рекомендовали при болях в желудке и животе, при дерматите, при нарушениях менструального цикла, как полоскание при воспалениях рта, как ванны при воспалениях в области гениталий (Srivastava and Gupta, 2011). Карл Великий, король франков и христианский император Запада, в Capitulare de villis , руководстве по управлению королевскими поместьями, вставил ромашку среди растений, которые он хотел выращивать на своих землях (Wagoner, 2011).В то время ромашка считалась одним из самых почитаемых растений. Христиане освятили ромашку Святой Анне, матери Богородицы. Англосаксы-язычники считали ромашку одной из «Девяти священных трав», подаренных человечеству нордическим богом Воденом (Гордон, 1962).

Арабы впитали древнегреческие и римские знания о терапевтическом использовании ромашки. В золотой век ислама персидский врач Авиценна (980–1037 гг. Н.э.), который был автором знаменитой книги Канон медицины , был отправной точкой медицины унани.Эта традиционная система исцеления и поддержания здоровья существовала на протяжении многих веков во всех сферах исламской культуры. В Каноне медицины Авиценна предположил эффективность некоторых лекарственных трав, в том числе ромашки, которую он использовал для лечения головной боли, отеков, конъюнктивита, желтухи, хронической лихорадки, литиаза, аменореи, зубной боли, афтозных язв и мышечной стянутости. . Ромашку также рекомендовали для снятия зуда и воспаления и облегчения заживления кожных повреждений у пациентов, перенесших операции (Mahdizadeh et al., 2015).

Все эти древние рукописи сильно повлияли на медицинское мышление средиземноморских врачей до развития современной медицины. Однако лекарственные средства на растительной основе сохранились до сегодняшнего дня с устными традициями, переданными местными народными лекарствами, и теперь переживают новое Возрождение. Обезболивающие и противовоспалительные эффекты ромашки в значительной степени доказаны современной медициной, см., Например, (Shoara et al., 2015). Ромашка отсутствовала в оригинальной древней китайской традиционной медицине и аюрведе, но она была введена совсем недавно.

Обзор биоактивности и потенциальной пользы для здоровья ромашкового чая (Matricaria recutita L.)

Heřmánek pravý (matricaria cHamomilla l.) A jeHo účinky na nervový systém cHamomile (matricaria cHamomilla tHe) и его влияние на нервную систему Zdeňka Navrátilová 1, orciD 0000-0001-5027-901X Jiří Patočka 2,3, orciD 0000-0002-1261-9703 1 Katedra botaniky, Přírodovědecká fakulta Univerzity Karlovy v Praze 2 Katedra radiologie, fc. univerzita v Českých Budějovicích 3 Centrum biomedicínského výzkumu, Fakultní nemocnice, Hradec Králové Souhrn heřmánek (Matricaria chamomilla L.) je rostlina známá již v nejstarších systémech tradiční medicíny. V současnosti představuje v západní kultuře jednu z nejpopulárnějších léčivých rostlin и je hojně využíván pro léčbu четных здоровых поруча. Externě urychluje hojení ran, interně se používá k léčbě poruch zažívacího traktu, průjmu, ztráty chuti k jídlu, zvracení, kinetózy, úzkosti, nespavosti a respirac-n. Ovlivňuje také nervový systém. В пробирке действует in vitro на животных, которые вызывают анксиолитические, седативные, антидепресивные, нейропротективные, прокогнитивные и антиконвульсивные средства.Anxiolytický účinek byl potvrzen i v klinických studiích. Резюме: Ромашка (Matricaria chamomilla L.) – широко известное растение в древнейшей традиционной медицине. В настоящее время он широко используется в западной культуре для лечения многих болезней. Это одно из самых популярных лекарственных растений. Наружно ускоряет заживление ран, внутрь используется для лечения расстройства желудка, диареи, потери аппетита, рвоты, укачивания, беспокойства, бессонницы и респираторных инфекций. Также влияет на нервную систему.Анксиолитический, седативный, антидепрессивный, нейропротекторный, прокогнитивный и противосудорожный эффекты наблюдались в экспериментах in vitro и на животных. Анксиолитический эффект был подтвержден и в клинических исследованиях. Vod V Evropském lidovém léčitelství se používá řada rostlin a jednou z nejznámějších a nejužívanějších bezesporu heřmánek pravý. Existují stovky studií, které zkoumaly obsahové látky a léčivé účinky heřmánku, a to in vitro, v Experimentech na zvířatech i v klinických studiích. V po-sledních 20 letech proběhla také řada studií, které hodnotí účinky na nervový systém (1,2).Jejich shrnutí přináší tento přehledový článek. Botanická charakteristika Heřmánek pravý (Matricaria chamomilla L., син. Matricaria recutita, Chamomilla recutita, обр. 1) Je jednoletá nebo ozimá vonná bylina z čeledi hvězdnicovitých (Asteraceae). Rostli-ny jsou 10-50 cm vysoké, mají přímé nebo vystoupavé vět-vené lodyhy, střídavé 2-3 × peřenosečné listy členěné v řídké čárkovité úkrojky a drobnéd květyané; ve střední části úboru jsou trubkovité žluté květy, na obvodu bílé jazykovité.Květní lůžko je vyklenuté a duté. Kvete od května do září, plodem je nažka bez chmýru (3). Heřmánek pravý je pvodní v jižní Evropě, hranice původního rozšíření však nelze přesně stanovit. V České republice se považuje za archeofyt, roste zejména v tep-lejších oblastech na obilných polích, úhorech, rumištích a okrajích cest. Pro léčebné účely se sbírá v přírodě i pěs-tuje. Mezi velké producenty heřmánku patří především Аргентина и Египет (3-5). tradiční medicína Heřmánek se odedávna používá v tradiční lidové medicí-ně, patří mezi nejpopulárnější léčivé rostliny.Zevně se užívá k urychlení hojení, to ve formě obkladů, koupelí a výplachů úst. Vnitřně se používá k léčbě zažívacích potíží, průjmu, nechutenství, zvracení, nachlazení, kinetózy, dny, úzkosti, nespavosti, malárie a dalšíčíchích parazitární. Silice se ingluje při Infkcích horních cest dýchacích (5-7).

Христантема персидская “Робинзон” – сорт микс; Ромашка пиретрум, расписная маргаритка, персидский цветок насекомых, персидский пеллиторий, кавказское порошковое растение насекомых – 180 семян – Garden Seeds Market

GardenSeedsMarket – работает более десяти лет, и с самого начала мы сделали качество нашей продукции своим главным приоритетом.На протяжении многих лет мы поставляем товары самого высокого качества десяткам тысяч клиентов со всего мира. Их удовлетворение доказывает, что мы выбрали правильный путь.

Все продаваемые нами семена проходят многоуровневый контроль качества и только после этого тщательно упаковываются и отправляются. Наша продукция отмечена многочисленными сертификатами и соответствует самым высоким стандартам Европейского Союза. Наши сотрудники – опытные садоводы, которые с радостью ответят на любой ваш вопрос.

Откуда берутся наши семена?

Все семена, продаваемые в нашем магазине, поступают от лучших производителей со всего Европейского Союза. Благодаря давнему сотрудничеству с ними мы смогли разработать наиболее подходящие условия хранения и отгрузки, гарантирующие, что вы всегда будете получать свежие и тщательно проверенные партии семян. Исключение посредников из всего процесса не только позволяет нам избежать отправки устаревших семян, которые могли слишком долго лежать на полке склада, но и обеспечивает наиболее привлекательную цену на продукцию высшего качества.

Процесс контроля качества

Все наши семена проходят четырехэтапный процесс контроля качества.

Первый этап начинается с тщательного отбора поставщиков. После того, как мы приступим к контролю их урожая, иностранные производители не исключаются из процесса контроля качества. Растения проверяют на каждом этапе их развития: когда они начинают расти, во время цветения и когда начинают плодоносить (семена). На этом этапе самое главное – обеспечить правильное расположение растений.Благодаря этому может быть обеспечено получение желаемых морфологических характеристик каждого конкретного вида или разновидности, таких как цвет, высота и форма.

Этап второй состоит из подробных поверочных испытаний в лабораторных условиях. Используя оборудование высочайшего качества и высококвалифицированный персонал, наши поставщики ежегодно проводят более 30 000 проверок качества. Семена, которые не соответствуют нашим требованиям, подвергаются технологическим процессам переработки, включая сушку, очистку, обновление и повторное тестирование.

Третий этап начинается с посева семян на выбранных контрольных делянках. Таким образом мы получаем ценную и точную информацию об их всхожести, которую необходимо поддерживать на соответствующем уровне. Одновременно на этом этапе проверяется сортовая принадлежность каждого вида.

Четвертый этап проходит на наших складах и заключается в удалении семян, которые слишком долго хранились на наших полках, и их замене новыми партиями. На каждой упаковке проставляется уникальный номер партии, а также дата посева.

Сочетание всех четырех этапов позволяет нам с уверенностью утверждать, что поставляемые нами семена соответствуют самым высоким стандартам и успешно прошли все необходимые этапы контроля.

Призы и награды

Семена, которые мы продаем, широко известны своим качеством и получили множество наград. Наши семена завоевали множество золотых медалей и наград за высокое качество. «Мир цветов» также удостоился награды за новаторский подход.

Среди этих наград: ТОП ИННОВАЦИИ (июнь 2015), ЗОЛОТАЯ МЕДАЛЬ НА ПОЗНАНСКОЙ МЕЖДУНАРОДНОЙ ЯРМАРКИ (2015), ЛИДЕР ПОТРЕБИТЕЛЬСКОГО КАЧЕСТВА (2014), ФЕРМЕР ГОДА (2014).

Кроме того, мы также два года подряд удостаиваемся сертификата «ИДЕАЛЬНЫЙ БИЗНЕС».

Всхожесть

Мы стремимся продавать только самые качественные семена. Принимая во внимание усилия, которые мы прилагаем ежедневно, обратите внимание, что растения являются живыми организмами, и их прорастание и рост зависят от многих факторов, таких как температура, тип почвы, влажность и частота, с которой они поливаются, время и условия посева, использование удобрений и средств защиты растений (пестицидов), а также погодных и климатических условий.Мы оказываем помощь, делясь точной и актуальной информацией о посеве и выращивании, однако мы не несем никакой ответственности за растения, которые не были выращены в условиях, подходящих для данного вида.

Сад Вирджинии Робинсон | Растущая одержимость

Всегда есть один-два сада местного города, которые мы никогда не сможем посетить, верно? И это верно даже для голодающей по садам Южной Калифорнии. Сад Вирджинии Робинсон в Беверли-Хиллз был написан и переписан, казалось бы, исчезающими чернилами, и был первым в моем списке обязательных для посещения на протяжении десятилетий.

Коробка сфер из даймондии, массированная тульбагия

Поскольку это первое поместье, построенное в Беверли-Хиллз в 1911 году, процветающий анклав впоследствии вырос вокруг него, давя со всех сторон крутого участка, в основном скрывая свое существование на вершине холма от непосвященных. Я знал, что это формальный сад богатой светской львицы, женатой на потомке династии универмагов Робинсонов, Гарри Робинсоне. Вероятно, я впервые узнал об этом малоизвестном саду от одного из моих учителей садоводства в начале 90-х годов.Чтобы не походить на ярого классового воина, но давайте просто скажем, что мой тусклый интерес к формальным, огражденным коробками трофейным садам продолжал отодвигать визит на какое-то смутное время в будущем, но в конечном итоге этот день оказался прошлой субботой. (Для полуторачасового тура, который стоит 11 долларов на человека, всегда требуется предварительный заказ, а небольшие туры заполняются быстро.)

И я должен сразу признать, что сильно недооценил Вирджинию.

Кактус вдалеке был подарком Арабеллы Хантингтон.Вирджиния знала всех , играла в теннис с Чарли Чаплином и в бридж с Фредом Астером.

Ее сад, завещанный округу Лос-Анджелес, очевидно, является творением человека, полностью влюбленного в него и созвучного идеалу, согласно которому хорошая жизнь состоит из как можно большего количества времени, проведенного на открытом воздухе в окружении друзей и домашних животных. Как бы я ни был подготовлен к показной витрине с осевыми видами, которые лучше всего ценились из окон гостиной, использование простых материалов, человеческий масштаб и цепкая проходимость по крутому ландшафту стали унизительным сюрпризом.Шаги Вирджинии ощущаются повсюду в саду.

Дорожка, пересекающая восемь уровней террасирования.

Путь через пальмовый сад, самую большую коллекцию пальм австралийского короля (Archontophoenix cunninghamiana) в этом полушарии.

Работая с ландшафтным архитектором Чарльзом Гиббсом Адамсом (который приложил руку к другому саду начала 20-го века, который я хотел бы увидеть, теперь мифическому Остину Валь Верде в Монтесито, который трагически пал жертвой запутанного управления и банкротства), Вирджиния использовала Она знала каждый дюйм и досконально знала каждый кирпичик своего террасного сада, ежедневно гуляя по территории в течение более шестидесяти лет, которые она жила здесь, с 1912 по 1977 год, почти до своего 100-летия.

Теперь, когда я совершил поездку по нему с очень восторженным доцентом, я могу авторитетно заявить, что это сад поместья площадью около 6 акров и, как я подозревал, здесь не так много подробных посадок, которые представляли бы интерес для современного вкуса. Вирджиния не была серьезным коллекционером растений, несмотря на то, что она посадила первое коралловое дерево в Лос-Анджелесе, Erythrina caffra, ныне зарегистрированное «Калифорнийское большое дерево», которое все еще находится на территории. Тем не менее, ее дом, несомненно, источает неповторимую атмосферу Старого Голливуда, которая создает мощное заклинание путешествия во времени.

Что меня так привлекает в этом саду, так это то, что его можно рассматривать как живой прототип садовой иконографии высших классов Лос-Анджелеса 1920-х годов, сочетающую элементы дизайна, почерпнутые из de rigueur Grand Tour по европейским и средиземноморским садам. во Франции, Италии и Испании. В результате получилось средиземноморское месиво, которое разделяет черты бесчисленного множества садов поместья, большинство из которых давно списано и застроено.(Легендарное поместье и сад Гарольда Ллойда на соседней улице Бенедикт-Каньон-драйв было разрушено и разделено на части в 1975 году.)

Вирджиния пришла к идее создания этой кирпичной воронки во время посещения Альгамбры в Испании

Многие элементы и идеи для ее дома и сада были вдохновлены ее трехлетним медовым месяцем за границей, когда было собрано много скульптур, мебели и даже семян. (Напротив, мой медовый месяц состоял из полуденной поездки на юг через границу, чтобы поесть лобстера и фасоль в Порто-Нуэво.)

Хотя она общалась с семьями, носящими имена Дисней, Херст и Хантингтон, в этом поместье чувствуется почти домотканый вид, и она редко балуется беспричинной хвастовством.

Дом и сад

Вирджиния не только исторически значимы, поскольку были первым поместьем в Беверли-Хиллз, но и могли оказаться последним в своем роде, пережившим бурное экономическое давление на пригодные для строительства земли в Беверли-Хиллз.

Это заразительная и мощная мечта о саду, в котором можно бродить, плавать и играть в теннис, устраивать вечеринки на лужайке, вечерний воздух благоухает магнолией, гранатом, цитрусовыми и кипарисами. Основы средиземноморского дизайна, такие как стратегический контроль и отображение воды, проявляются повсюду.

Павильон с бассейном был пристроен в 1924 году.

По словам доцента, архитектор Джордж Уайман, известный в Брэдбери-билдинг, отвечал за некоторые аспекты дизайна павильона с бассейном, но я не могу найти никаких ссылок, чтобы уточнить эту ассоциацию.

Павильон основан на дизайне виллы Пизани в Италии, а интерьер богат искусной деревянной отделкой и лепниной.

В отличие от этого, дом с низким потолком не обшит деревом и выкрашен в приглушенные зеленые и серые тона Farrow & Ball. В резиденции нельзя фотографировать: здесь есть великолепные персидские ковры и мебель, а также прекрасная личная библиотека, но в остальном она довольно скромная по своим масштабам. Когда в 1911 году ее отец Натаниэль построил простой одноэтажный дом, он стал первым поместьем Беверли-Хиллз.На старых фотографиях (см. «Когда Лос-Анджелес был пуст») все, что окружало поместье, выглядит как пустырь, очищенный от скотоводства и земледелия.

Вирджиния была известна своими вечеринками, которые выходили на лужайку и даже в бассейн, который, когда это было необходимо для танцев, покрывали твердым покрытием.

Ей очень нравились люди в приступах продолжительностью до трех часов, после чего затухание свечей было первым дипломатическим знаком того, что гости должны были уходить.Если это приглашение не получалось, Вирджиния заказывала вечернюю чашку ромашкового чая в одном из своих главных домиков, которые исполняли все более значимые второстепенные роли после того, как ее муж умер относительно молодым, в возрасте 50 лет.

вольер пустой

После смерти Вирджинии в ее завещании говорилось, что ее главный домоправитель будет жить на территории, чтобы заботиться о своих выживших домашних животных.

Дом из обрешетки / теплица на огороде

Обилие мест для отдыха и террас украшает территорию.

Усиливая исторический диссонанс посещения поместья, я не мог не наложить это видение легкости, ставшей возможным благодаря деньгам универмагов, на крах империи розничных магазинов, продолжающийся сегодня. Участок бывшего универмага Робинсона, расположенный чуть ниже холма от сада Вирджинии на бульваре Уилшир, был продан китайским инвесторам за 420 миллионов долларов в 2014 году. Строительство начнется в этом году в многоквартирном / торговом / гостиничном комплексе под названием One Beverly. , под руководством архитектора Ричарда Мейера, спроектировавшего Центр Гетти.

Уход за такой собственностью требует твердой решимости и хорошо организованных способностей по сбору средств. В заключение приведу частичный список некоторых проектов, завершенных в 2017 году при финансовой поддержке Friends of Robinson Gardens:

1. «Отреставрированный и сохраненный в мавританском стиле потолок с ручной росписью в солярии павильона у бассейна. Восстановлен первоначальный цвет краски для стен и молдинга в солярии.

2. «Отреставрированы два напольных часа в итальянском стиле XIX века: одни в главном доме-музее, а другие – в павильоне у бассейна.Оба теперь показывают точное время и отбивают час и полчаса.

3. «Очистили и законсервировали два антикварных персидских ковра начала 19 века в Главном доме.

4. «Заменил лужайку перед домом площадью 5000 квадратных футов и создал естественный луг из семян. Это помогло обеспечить сокращение расхода воды на 33%, требуемое городом Беверли-Хиллз.

5. «Улучшен выставочный розарий, добавив исторически подходящие растения-компаньоны и новые чайные розы.

6. «Реставрация бассейна – заменена сломанная плитка на копии, соответствующие оригинальному дизайну.Дополнительно был очищен бассейн.

7. «Терракотовые львы, охраняющие великолепный Итальянский сад на террасе, были отреставрированы.

8. «Пара японских журавлей начала 20 века, украшающих Большую лужайку в Вирджиния Робинсон Гарденс, была восстановлена ​​до своего первоначального элегантного роста».

Беспокойство, паника и фобии | Королевский колледж психиатров

Беспокойство – очень распространенное явление, и многие из нас преодолевают его или справляются с ним без профессиональной помощи.

Однако, если оно серьезное или длится долгое время, беспокойство может повлиять на ваше физическое здоровье и помешать вам делать то, что вы хотите делать.

Хорошая новость в том, что есть способы помочь себе.

Помогите себе

  • Поговорите об этом. Это может помочь, когда беспокойство вызвано недавними ударами, например, уходом партнера, заболеванием ребенка или потерей работы. С кем поговорить? Попробуйте найти друга или родственника, которому вы доверяете и уважаете, и который умеет слушать.Возможно, они сами сталкивались с такой же проблемой или знают кого-то еще, у кого она есть.
  • Группы самопомощи. Это хороший способ связаться с людьми, у которых есть похожие проблемы. Они могут понять, через что вы проходите. Помимо возможности поговорить, вы можете узнать, как другие люди справился. Некоторые из этих групп посвящены именно тревогам и фобиям. Другие могут быть предназначены для людей, которые пережили подобный опыт – женские группы, группы родителей, потерявших близких, переживших жестокое обращение.
  • Научиться расслабляться . Звучит слишком очевидно – ведь расслабиться может каждый? Но если ваше беспокойство просто не проходит, может быть действительно полезно изучить некоторые особые способы расслабления, чтобы лучше контролировать свое беспокойство и напряжение. Вы можете изучить их в группах с профессионалами, но есть несколько книг и материалов для самопомощи, которые вы можете использовать, чтобы научить себя. Рекомендуется регулярно заниматься релаксацией, а не только во время кризиса.
  • Использование книги самопомощи .Это хорошо работает для многих людей. В большинстве книг используются принципы когнитивно-поведенческой терапии (КПТ) – см. Ниже.

Семья и друзья

Человек, страдающий тревожным беспокойством или фобией, может не говорить о своих чувствах даже с семьей или близкими друзьями.

Даже в этом случае обычно очевидно, что что-то не так. Больной будет выглядеть бледным и напряженным, его легко напугать обычными звуками, такими как звонок в дверь или автомобильный гудок.

Они могут быть раздражительными, и это может вызвать споры с окружающими, особенно если они не понимают, почему человек чувствует, что не может делать определенные вещи.

Хотя друзья и семья могут понять страдания тревожного человека, им может быть трудно с ними жить, особенно если страх кажется необоснованным.

Другие виды помощи

Если у вас есть проблема с тревогой, которая не проходит, вы можете не обращаться за помощью, потому что беспокоитесь, что люди могут подумать, что вы «сумасшедший». Они этого не сделают. Это обычная проблема, и гораздо лучше получить помощь, чем молча страдать.

  • Когнитивно-поведенческая терапия (КПТ)

Это разговорная терапия, которая может помочь вам понять, как некоторые из ваших «привычек мышления» могут усугубить тревогу – или даже вызвать ее – и смириться с этим. причины вашего беспокойства, которые вы могли не осознавать.Лечение могут проходить в группах или индивидуально и обычно еженедельно в течение нескольких недель или месяцев.

В настоящее время существует ряд компьютерных программ, которые вы можете использовать для проведения КПТ. Национальный институт здравоохранения и передового опыта (NICE) рекомендует программу под названием «Fearfighter» от паники или фобии. Вы можете получить это у своего терапевта.

Если этого недостаточно, есть несколько разных специалистов, которые могут помочь: терапевт, психиатр, психолог, социальный работник, медсестра или консультант.Психотерапевты могут быть или не иметь медицинской квалификации.

Лекарства могут играть определенную роль в лечении некоторых людей с тревогой или фобиями. Наиболее распространенными транквилизаторами являются препараты, подобные валиуму, бензодиазепины (большинство снотворные также относятся к этому классу препаратов). Они очень эффективны для снятия беспокойства, но также вызывают сильное привыкание после четырех недель регулярного использования. Когда люди пытаются прекратить их прием, у них могут возникнуть неприятные симптомы отмены. что может продолжаться какое-то время.Эти препараты следует использовать только в течение коротких периодов времени, обычно до 2 недель, возможно, для помощи во время кризиса.

  • Они не должны использоваться для длительного лечения тревоги.
  • Они должны вообще не использоваться при паническом расстройстве.

Антидепрессанты могут помочь уменьшить беспокойство, а также депрессию, от которой их обычно назначают. Обычно они работают от 2 до 4 недель, и для правильной работы их нужно принимать регулярно.

Бета-адреноблокаторы в низких дозах иногда могут контролировать физическую дрожь при тревоге. Их можно принимать незадолго до встречи с людьми, перед публичным выступлением или перед выступлением.

Исследования показывают, что валериана лекарственная (валериана) не помогает при тревоге, хотя Matricaria recutitat (немецкая ромашка) и Melissa officinalis (мелисса) «многообещающие».

Добавить комментарий

Ваш адрес email не будет опубликован. Обязательные поля помечены *