Арабис многолетний: посадка и уход, фото на клумбе, размножение резухи-многолетки

Содержание

посадка и уход, фото на клумбе, размножение резухи-многолетки

Арабис многолетний или резуха (латинское название Arabis) полностью покрывает землю. Прополка ему требуется только тогда, когда всходы еще небольшие. Как только они подрастут, то растение вытеснит все сорняки из цветника. Каменистые клумбы, на которых высажено травянистое растение, долгие годы сохраняют высокодекоративный вид.

Растение относится к семейству крестоцветных (капустных). В природе оно произрастает в умеренном климате и в горной местности Африки. Причем неприхотливое растение прекрасно себя чувствует на осыпях, скалах, глинистых склонах, песках.

Имя резуха почвопокровное растение получило за то, что его листовые пластинки покрыты жесткими волосками. Они могут поранить, если человек неаккуратно прикоснется к ним.

Арабис многолетний: описание с фото, использование в ландшафтном дизайне

Внешний вид многолетника можно описать таким образом:

  1. Высота зависит от сорта, не превышает 30 см.
  2. Цельные сердцевидные опушенные листовые пластинки зеленого цвета зубчатые по краям.
  3. Плотные некрупные кистевидные соцветия состоят из цветков диаметром 1-1,5 см. Они бывают простыми либо махровыми белого, светло-желтого, розового, лилового окраса.
  4. Плод ― стручок с плоскими, иногда крылатыми семенами.

Арабис многолетний на клумбе:

Буйное цветение начинается в середине весны, длится примерно месяц. От травянистых растений распространяется сладкий аромат. Повторное появление цветков происходит в сентябре.

Резуха прекрасно вписывается в убранство приусадебного участка, украшает любой цветник как почвопокровное растение. Она невысока, очень быстро растет. За короткое время многолетник затягивает пустую землю, покрывает ее пушистым зеленым ковром. Арабис многолетку садят под деревьями, около цветущих растений среднего или высокого роста либо на альпийских горках.

Высаживая на участке резуху, надо не забывать о том, что в тени они сильно разрастаются и вытягиваются. А на солнце – цветут ярче.

Сорта и виды с описанием и фото

Существуют такие виды резухи.

Альпийский (Arabis alpina)

Название сорта Высота растения в сантиметрах Диаметр соцветий в сантиметрах Окрас цветов
Шнеесхаубе 25 15 Белый
Розовый 20 12 Розовый

Кавказский (Arabis caucasica)

Название сорта Высота растения в сантиметрах Диаметр соцветий в сантиметрах Окрас цветов
Флоре-плено 20-25 8 Белый
Вариегата 20-25 8 Молочно-белый
Розабелла 20-25 8 Розовый
Кокцинеа 20-25 8 Пурпурный
Литтл Треже Роуз 20-25 8 Белый, розовый, лиловый, сиреневый
Lotti White 15 15 Белоснежный

Реснитчатолистный (Arabis blepharophylla)

Название сорта Высота растения в сантиметрах Окрас цветов
Роут Сенсейшн 8 Насыщенно-розовый
Фрюлингшабер 8 Нежно-розовый
Роуз делайт 8 Ярко-розовый

Стреловидный (Arabis hirsuta)

Вырастает ввысь до 45 см. Прикорневые листовые пластинки многолетника стреловидные, собраны в розетку. Узкие и длинные соцветия состоят из белых цветков в диаметре полсантиметра. Мелкие, коричневые семена находятся в стручках длиной 2-6 см. Цветение резухи начинается в конце июня — начале июля. Плоды появляются в начале августа.

Повислый (Arabis pendula)

Резуха достигает высоты 12 см.,характеризуется сильно ветвящимся стеблем. Листовые пластинки овальные либо ланцетные с заострением. Белые, мелкие цветки покрытыми волосками. В плоском, дугообразном стручке расположены мелкие семена. Цветет резуха с июля, по август.

Песчаный (Arabis arenosa)

Вырастает высотой 2 см – это растение с прямостоячими, ветвистыми побегами. Их отличительная особенность в том, что они голые сверху, но опушенные снизу. Белые, розовые, сиреневые цветки собраны в соцветия. Появляются в июне, увядают в сентябре.

Фердинанд Кобургский (Arabis ferdinandi-coburgii)

Блестящие, светло-зеленые листья имеют тонкую белую кайму по краю. Белые мелкие цветки соединяются в рыхлые соцветия, которые цветут с мая по июнь.

Грандифлора

Резуха розовая с побегами, достигающими высоты 25 – 30 см, украсит любой участок нежно-розовыми цветками. Бутоны достигают 2 см в диаметре.

Видов и сортов арабиса многолетнего множество. Каждый садовод сможет выбрать резуху по своему вкусу.

Сроки посадки на рассаду

Почвопокровное растение можно выращивать рассадным способом. В I декаду марта посевной материал помещают в емкости с влажной смесью речного песка и садовой земли на глубину полсантиметра. Тару помещают в полиэтиленовый пакет, оставляют в теплом месте.

Всходы появятся через месяц, за это время грунт несколько раз поливают по мере высыхания. Пленку убирают, а емкость выставляют в светлое место. Маленькие растеньица своевременно увлажняют, удобряют 2 раза. Не забывают и про рыхление почвы.

Если садовод планирует травянистые растения высаживать на грядку так, чтобы впоследствии образовался травяной «ковер», то пикировку не проводят.

Рассада резухи

Посадка в открытый грунт

Вначале готовят грядки. Землю перекапывают с комплексным удобрением, удаляют все сорняки. Лучше для многолетника выбрать легкие почвы с примесью речного песка. Если земля глинистая, то обязательно делают дренаж. Выкапывают неглубокие канавки, на их дно укладывают некрупные камни, битый кирпич. Засыпают углубления речным песком.

Высадку семян в открытый грунт производят, как только оттает земля. Цветник поливают и укрывают пленкой. После появления всходов ее убирают. Или в конце октября, чтобы посадочный материал не пророс.

Рассаду помещают на клумбы, как только минует угроза ночных заморозков.

Особенности ухода

Уход за резухой заключается в подкормках, поливах, обрезке. В момент закладывания бутонов вносят минеральный комплекс для садовых цветов. Второй раз удобрение без азота вносят в конце лета. Орошение проводят регулярно по мере высыхания земли. После завершения цветения сухие части удаляют, а стебли подрезают на 1/3.

Почвопокровное растение выдерживает зимние морозы до -5°C. Если в местности температура опускается ниже, то цветник с резухой укрывают ветками хвойных деревьев, пленкой. А сверху конструкцию заваливают досками, чтобы сильный ветер не разрушил ее.

Размножение

Арабис многолетний можно размножать черенками, перевалкой и делением. Ранней весной или в середине осени хорошо разросшиеся кусты выкапывают, острым ножом делят на несколько частей так, чтобы у каждой были точки роста. Затем новые растеньица помещают в стимулятор роста на несколько часов. Только потом высаживают в цветник. Дистанция между саженцами должна быть не менее 30 – 40 см.

В конце весны – начале лета можно проводить черенкование. Вначале с самых здоровых экземпляров нарезают десятисантиметровые черенки. Снизу удаляют листовые пластинки, производят высаживание в удобренный грунт. Каждый день черенки и землю рядом с ними опрыскивают из пульверизатора. Через месяц молоденькие растеньица с корешками рассаживают на клумбе.

Тонкие корни резухи непрочны, их легко можно повредить. Поэтому метод перевалки считается самым лучшим. Вначале в земле выкапывают лунки глубиной 10-15 см. В них насыпают древесную золу и поливают. Грунт на грядке с многолетником разрыхляют, его извлекают вместе с комом земли. Растения переваливают в углубления, засыпают перегноем, слегка уплотняют и еще раз поливают.

Молодые растения в саду

Вредители, болезни

Арабис многолетний может заболеть вирусной мозаикой. Пораженные экземпляры удаляют с участка, а грядку проливают раствором хлорной извести. Только следующей зимой на этом участке земли можно высаживать травянистые растения.

Крестоцветная блошка тоже способна напасть на растения. Если это произошло, то кустики проливают раствором почвенного инсектицида под названием «Почин». Это самое эффективное средство, так как оно быстро уничтожает насекомых и долгое время защищает многолетник.

Чтобы неприятности в виде болезней и вредителей не возникали, садоводу требуется выполнять ряд профилактических мероприятий:

  • осуществление глубокой перекопки грунта перед посадкой многолетника на постоянное место;
  • тщательная прополка сорняков, пока почвопокровное растение не затянет всю землю;
  • периодическое удаление отмерших и поврежденных частей резухи и растений, находящихся рядом.

А еще травянистому растению не помешает опрыскивание современными иммуностимуляторами.

Почвопокровное растение обладает лечебным свойством – своим прекрасным видом услаждать взгляд человека.

Интересный факт-легенда

Историки утверждают, что арабис знаком человеческому обществу не меньше двух веков. А любителям исландского фольклора известна легенда о неприметном цветке, которому эльфы подарили магическое очарование.

Волшебная семья жила в кроне высокого дерева. Оно дарило маленьким существам прохладу. А питались они нектаром близлежащих цветов. Но однажды ночью началась страшная гроза. Раскаты грома сотрясали воздух. Огромная молния ударила в дерево, и оно загорелось. Испуганные эльфы в спешке покинули свое жилище и спрятались в мокрой траве. Утром они обнаружили, что дождь потушил огонь, но дерево успело полностью выгореть.

Пришлось маленьким существам отправляться на поиски нового места обитания. Весь день они пытались осуществить задуманное, но это не получалось. Кустарники были уже заселены насекомыми. А деревья – мелкими зверьками и птицами.

Вечером обессиленные беженцы обратились к цветам с просьбой приютить их. Но представители флоры не желали мять свои пышные лепесточки. Только арабис разрешил эльфам укрыться в своих зарослях. Утром все растения увидели, что неказистая резуха приобрела магическое очарование. Теперь от прекрасных кустиков с маленькими цветками невозможно было отвести взгляд. Это был подарок благодарных эльфов.

Резуху не считают экзотическим растением, поражающим воображение. Она невелика, соцветия скромны, а листовые пластинки не имеют оригинальной формы. Но многие садовники любят высаживать арабис на участках. Он достаточно неприхотлив в уходе. Его нежная красота пленяет любого человека.

описание, посадка и уход, виды и фото

Растение Арабис (лат. Arabis) относится к роду травянистых многолетников семейства Капустные, или Крестоцветные, насчитывающего более 100 видов. В природе цветок Арабис встречается в горах тропической Африки и в районах с умеренным климатом Северного полушария. Происхождение латинского названия ‘Arabis’ доподлинно не известно. Ботаническое название Arabis, вероятно, относится к тому факту, что многие виды являются родными для гор Аравии.В садоводстве культура используется более двухсот лет. В ландшафтном дизайне растение Арабис высаживают в миксбордерах и клумбах, для украшения бордюров, рабаток и альпийских горок. В нашей статье мы расскажем, как сажать и ухаживать за Арабисом в открытом грунте.

Содержание статьи

Описание растения Arabis

Арабис или Резуха — многолетнее раннецветущее почвопокровное растение.  Высота растения до 30 см. Стебли, стелющиеся, укореняющиеся. Листья зубчатые, опушенные. Арабис многолетний — медонос. Прикорневые листья часто собраны в розетку. Все виды Арабиса имеют привлекательную круглогодичную листву и скопления маленьких, белых, розовых или фиолетовых цветов.

Цветет Резуха обильно, с апреля и довольно долго, до 8 недель. В период цветения арабис хорошо разрастается. Резуха хорошо растет в песчаных, хорошо дренированных почвах на солнце. Сокращает количество листвы после цветения, чтобы способствовать хорошему росту. Незря данную культуру причисляют к растениям-коврикам для сада. От цветов растения исходит приятный запах, привлекающий пчел. Но некоторые виды Арабиса причисляют к сорнякам.

Вы также можете ознакомиться с цветком Иберис

Посадка и уход за многолетними цветами Арабис

Цветок Арабис достаточно легко выращивается из семян, которые продаются во флористических магазинах. Высевать семенной материал можно непосредственно в открытую почву. Лучше выбирать для таких целей октябрь. Если вы планируете сеять культуру весной, тогда оптимальным решением станет апрель. В данном случае лучше подойдет рассадный метод. Для него выбирают контейнеры или ящики, наполненные садовым грунтом с добавлением песчано-каменной смеси (пропорция – 3 к 1).

Заделывать семенной материал не нужно слишком глубоко – достаточно всего 5 мм. Для проращивания регулируют температуру в +20 градусов. Повысить всхожесть позволит укрытие из нетканого материала.

Как ухаживать за рассадой

Спустя 20-25 суток после появления всходов Арабиса, убирается укрытие, сокращаются поливы. Саму емкость ставят в теплое и светлое место. По мере необходимости рассаду следует поливать, а также немного рыхлить субстрат.

Проведение пикировки

Как только появится первый настоящий листик, предстоит провести пикировку растений. Сеянцы рассаживают на дистанции минимум в 30 сантиметров друг от друга, а опытные садоводы рекомендуют и вовсе рассадить культуры в отдельную тару.

Желая выращивать культуру как почвопокровник, пикировку можно не делать. Перед тем, как сажать растения в открытую почву, проведите закалывание растения. Этот процесс делают на протяжении 10-12 суток. Каждый день рекомендуется выносить растения на открытый балкон или на улицу. Но только избегайте мест, где сквозные ветры. После адаптации рассады к холодным условиям, пересадите ее в сад на выбранное место.

Посадка Арабиса в открытый грунт

Посадка Резухи выполняется под конец весны – в начале лета. Это делают до момента формирования у культуры трех настоящих листиков. Отдавайте предпочтение участкам с хорошим солнечным освещением, но и в полутени растения могут неплохо развиваться. Но цветение не будет таким пышным. Также при выборе места для Резухи учитывайте, что растения не любят сквозных ветров.

Как высаживать растение Резуха

Создайте для культуры оптимальные условия – выбирайте рыхлую, песчаную почву, желательно не очень влажную. Обязательно ее очищают от сорных растений, обогащают минеральными веществами. Чтобы улучшить водопроницаемость, внесите в садовый грунт немного мелких камешков.

Рассаживая кустики, придерживайтесь расстояния в 40 сантиметров. Достаточно посадить в каждую ямку до 4 сеянцев. После высадки предстоит полить участок. Если обогащения грунта не было до этого момента, тогда через 1-2 дня удобрите культуру минеральными веществами. Помните еще один важный момент – цветение Арабиса, выращенного из семян, начнется только на 2-й год после высадки.

Как выращивать цветок Арабис

Какие условия надо знать и соблюдать для безпроблемного ухода за Резухой — давайте ознакомимся ближе.

Правила полива и внесения удобрений

Почвопокровные многолетние цветы Арабис считаются засухоустойчивыми. Поэтому дополнительный умеренный полив им потребуется только в засушливые периоды года.

Подкармливать растения рекомендуется 1 раз в год, лучше всего в весеннюю пору. Использовать для таких целей следует перегной или компост. Также перед началом цветения понадобится внести под корень комплексные минеральные составы.

Как проводить обрезку растения

Проведение систематической стрижки и формировки кустиков может потребоваться, если цветок Арабис используется в коврово-мозаичных композициях или в качестве коврового цветника.

Также во избежание разрастания цветка, нарушения установленных границ, потребуется провести прищипывание длинных побегов. Черенки, что срезаются, можно легко применять для дальнейшего размножения.

Когда будет проведена весенняя обрезка, наращивание молодых побегов, может начаться повторное цветение. В июне обязательно избавляются от старых листиков, а длинные стебельки укорачиваются.

Пересадка Арабиса

Выращивание Арабиса включает также необходимость проведения пересадки. Данную агропроцедуру лучше выполнять через способ перевалки. Поэтапно этот процесс выглядит так:

  • готовят лунки для посадки в глубину до 25 сантиметров;
  • почва поливается под кустом, чтобы сделать ее умеренно влажной;
  • аккуратно разрыхляется земля, а растение извлекается совместно с земляным комом;
  • культура переваливается в лунку, засыпается почвой, немного уплотняется и поливается.

Пересадка не вредит Резухе, культура быстро адаптируется и начинает активно развиваться.

Сбор семян

При желании можно собрать семенной материал. Сбор семян осуществляется в сухое время года. Соцветия предстоит срезать совместно с цветоносами, разложить их на бумагу, установить температуру в +20…23 градуса. После досушивания семенной материал помещают в мешочки и кладут в холодильник.

Подготовка к зимовке

Цветок Арабис (Резуха) в наших условиях зимует плохо. Его необходимо подготавливать к такому процессу. После цветения культура обрезается до 3-4 сантиметров, а затем сверху засыпается листиками. Также поверх укладывается спанбод или геотекстиль. Только укрывной материал не должен касаться стеблей растений. Необходимо соорудить каркас из реек, а сверху уложить укрывной материал. Ткань обязательно фиксируется с помощью камней.

Самый простой способ размножения многолетнего растения Арабис — черенкование. Для этого выбираются здоровые, не цветущие розетки с небольшой длиной стебля, прикрепленного к родительскому растению. Обязательно сделайте чистый срез. Обращайтесь с черенками с помощью пинцета, если они очень маленькие. Обрежьте каждый черенок ниже узла и удалите листья с нижнего конца стебля. Готовый черенок должен иметь короткий стебель и розетку листьев сверху.

Акуратно поместите черенки в небольшой горшок с раннее подготовленой почвосмесью. Не переусердствуйте с поливом — это может погубить растение. Черенкам нельзя дать высохнуть, поэтому проверяйте и поливайте их осторожно. Храните черенки при температуре около 10-15 ° C, вдали от прямых солнечных лучей. Накройте, чтобы держать во влаге, но проветривайте растения часто. Удаляйте все черенки, которые быстро отмирают, чтобы не распространять инфекцию. Как только у черенков появятся новые корни и листья, высаживайте их по одному в выбранное вами место.

Какими методами можно размножить цветок Арабис

Рассмотрим два вегетативных методов размножения культуры.

Черенкование растения

Самый простой способ размножения многолетнего растения Арабис — черенкование. Для этого выбираются здоровые, не цветущие розетки с небольшой длиной стебля, прикрепленного к родительскому растению. Обязательно сделайте чистый срез. Обращайтесь с черенками с помощью пинцета, если они очень маленькие. Обрежьте каждый черенок ниже узла и удалите листья с нижнего конца стебля. Готовый черенок должен иметь короткий стебель и розетку листьев сверху.

Подготовленные к высадке черенки Арабиса

Акуратно поместите черенки в небольшой горшок с раннее подготовленой почвосмесью. Не переусердствуйте с поливом — это может погубить растение. Черенкам нельзя дать высохнуть, поэтому проверяйте и поливайте их осторожно. Храните черенки при температуре около 10-15 ° C, вдали от прямых солнечных лучей. Накройте, чтобы держать во влаге, но проветривайте растения часто. Удаляйте все черенки, которые быстро отмирают, чтобы не распространять инфекцию. Как только у черенков появятся новые корни и листья, высаживайте их по одному в выбранное вами место.

Метод деления кустарника

Кусты, которым больше 4 лет, делят на несколько частей. Сначала растения, что отцвели, поливают водой, а после с помощью деревянного колышка проводят рыхление грунта вокруг культуры.

Резуху следует извлечь из грунта, немного отряхнуть землю, разделить на несколько частей руками или острым ножом. Обработку срезов проводят с помощью измельчённого угля. Каждая деленка опускается в подготовленную ямку, сверху присыпается грунтом, а затем поливается.

Вредители и болезни многолетнего растения Арабис

Среди заболеваний растение может быть восприимчивым к белой ржавчине и мучнистой росе — для предотвращения этих заболеваний, оставляйте больше пространства вокруг стеблей и листьев. Если почва слишком влажная или плохо дренирована, у резухи может развиться корневая гниль.

Лучше всего исправить любые тяжелые, глинистые почвы с песком или даже гравием, чтобы сделать его более подходящим для этого растения.

Наиболее опасными вредителями для выращивания такого почвопокровного растения считают:

  • Моллюсков, которые начинают прогрызать дыры на листиках культуры, наиболее уязвимыми являются растения, что развиваются в местах застоя влаги.
  • Гусеницы капустной совки, они могут обгрызать листики, побеги и цветочки растения. Чтобы уничтожить вредителей, предстоит проводить систематические прополки участка, его мульчирование.

Чтобы бороться с такими вредителями, лучше всего использовать инсектициды – Карбофос, Актеллик, Актару. Лучше всего исправить любые тяжелые, глинистые почвы с песком или даже гравием, чтобы сделать его более подходящим для этого растения.

Вы также можете ознакомиться с таким удивительным цветком как Обриета

Советы по применению Арабиса в дизайне сада

Цветок Арабис многолетний хорошо подходит к рокариям, сухим ручьям или каменным стенам. Листва особенно эффективна, поднимаясь над скалами или каскадом над стенами.

Цветы образуют плотный, ползучий мат, отлично подходящий для горных садов, подпорных стен, крутых берегов и как почвенный покров для бедных, сухих, солнечных областей. «Ковер» из цветов прекрасно контрастирует с более крупными, насыщенными или вертикальными многолетниками. Резуха также хорошо смотрится в миксбордерах, разного рода клумбах. Отличным вариантом будет посадка растения по краям клумбы или цветника.

Популярные виды рода Arabis

На даный момент известно больше 100 видов Арабиса. Перечислим только самые востребованные в ландшафтном дизайне виды.

Арабис альпийский (Arabis alpina, или A. flaviflora)

Отличное растение для открытого грунта. В природе растет в Скандинавии, высокогорьях  Европы и Америки и за Уралом.

Арабис альпийский (A. alpina, или A. flaviflora)

Высота растения может достигать 35 см в высоту. Стебли у резухи альпийской прижатые к земле. Листики имеют овальную форму, а цветочки могут быть розового или белого цвета, обычно отличаются небольшим объемом – до 1 сантиметра. Соцветия – кистевидные, длительность цветения – до 1 месяца. Наиболее популярными садовыми формами считают:

  • Шнеесхаубе. В высоту до 25 сантиметров, имеют беленькие цветочки, их диаметр до 2 сантиметров.
  • Махровую. От Альпийской разновидности отличается только тем, что ее соцветия чуть крупнее.
  • Розовую. В высоту до 20 сантиметров, цветочки – розовенькие, соцветия достигают длины до 12 сантиметров.

Арабис кавказский или беловатый (Arabis caucasica)

Это вечнозеленое многолетнее растение растет на Кавказе, в Крыму, в горах Азии. Вырастает до 30 см.

Арабис кавказский

Листья небольшие, продолговатые. Резуха кавказская  очень быстро разрастается со средней скоростью до 0,2 м на 1 м. Листья растут круглый год, цветут с января по май, а семена созревают с апреля по июнь.
Подходит для: легких (песчаных), средних (суглинистых) и тяжелых (глинистых) почв, предпочитает хорошо дренированные почвы и может расти на питательно бедных почвах.

Наиболее распространенными садовыми формами являются:

  • Флоре-плено. Отличается красивыми махровыми цветочками белого оттенка.
  • Вариегату. Эти растения имеют листики с небольшими желтыми потертостями по краям.
  • Розабеллу. Цветет розовыми бутончиками.

Арабис низкорослый (Arabis pumila)

Родиной растения являются Альпы и Аппенины. Высота до 15 см. Цветки белые. Период цветения — май-июнь.

Фото Арабиса низкорослого

Этот почвопокровный цветок создает низкие вечнозеленые заросли. Белые соцветия  собраны в недольшие кисти. Хорошо растет на открытых, солнечных участках, не против и от полутени.

Арабис реснитчатолистный (Arabis blepharophylla)

Растет в горах Калифорнии. Низкорослое растение, высота до 8 см. Листва серо-зеленая. Окраска цветков темно-розовая.

Арабис реснитчатолистный

Густой многолетник с эффектными цветами. Лучше всего высаживать вдоль бордюров с хорошим дренажом почвы. отлично себя чувствует на полном или частичном освещении. Сортовые разновидности «Фрюлингшабер» и «Роут Сенсейшн» пользуются наибольшей популярностью. У них розовые соцветия.

фото, описание видов, выращивание, посадка, уход

Семейство Крестоцветные.

В естественных условиях произрастает от Арктики до тропиков Европы, Азии и Южной Америки.

Арабис(Arabis) или резуха обладает высокими декоративными качествами, которые позволяют широко использовать эту культуру на садовом участке. Она помогает создавать интересные композиции, эффектно смотрится пышным ковром, выигрышно заполняя пустоты, а также в сочетании с другими пестрыми цветами. Растение резуха весьма неприхотливо, уход за ним необременителен, и, посадив его в саду, можно быть уверенным, что оно даже на скудной почве без поливов и подкормок будет расти и развиваться. Но для того чтобы растение радовало глаз своей красотой и пышным цветением, нужно уделять ему хотя бы немного времени, учитывать при каких условиях этот цветок будет чувствовать себя наиболее комфортно.

Ботаническое описание растения резухи (с фото)

Согласно ботаническому описанию арабис – многолетнее, реже однолетнее растение со стелющимися и укореняющимися стеблями. В садоводстве в основном используются многолетние виды.

Это почвопокровник со стелющимися побегами, дающими корни, высотой не более 30 см. Листовые пластины ярко-зеленые, плотные, сердцевидные или цельные, изредка зубчатые, с густым ворсом на поверхности. Соцветия – кисти, состоящие из махровых или простых цветков диаметром 1.5 см.

Цветки могут быть белого, розового, желтого, лилового оттенка, обладают сильным, приятным ароматом. Цветение наступает в начале мая. После цветения формируется плод – стручок с множеством плоских семян.

Цветет в мае — июне.

Каковы характерные особенности цветка арабиса или резухи, видно на фото, продемонстрированном ниже:

       

Виды и сорта резухи

Резуха альпийская (A. alpina).

   

Многолетнее травянистое стелящееся растение высотой до 30 см. Вегетативные побеги прямые, генеративные – сильноветвящиеся, имеют петлевидную форму, сильно прижаты к земле, зимой не отмирают, сохраняя весь сезон плотные куртины. Листья арабиса альпийского сердцевидно-стреловидные, прикорневые – овальные, густо опушенные, сохраняются и зимой. Цветки мелкие, диаметром до 1 см, белые или розовые, собраны в кисть. Цветение данного вида наступает в апреле, длится на протяжении месяца.

Сорта резухи альпийской:

«Шнеесхаубе» — белый сорт резухи альпийской, который представляет собой куст высотой около 25 см, с кистевидными соцветиями длиной до 15 см, состоящими из крупных цветков до 2 см в диаметре. Арабис белый является одним из наиболее популярных многолетников, который ценится за свою красоту и способность органично вписываться в любые садовые композиции;

«Махровая» — сорт с махровыми соцветиями среднего размера;

«Розовая» — куст высотой до 20 см с соцветиями до 12 см в длину, состоящими из розовых цветков диаметром 2 см.

Резуха кавказская (A. caucasica)

   

Многолетнее травянистое растение высотой 20-25 см. Листья арабиса кавказского мелкие, продолговатые, по краю зубчатые, густо опушенные, насыщенно-зеленые. Цветки мелкие, махровые, белые, собраны в кистевидные соцветия длиной около 8 см. Диаметр цветков составляет 1.5 см. Цветение наступает в июне, длится в течение 28 – 30 дней. Иногда на кусте отдельные цветки распускаются до начала сентября. Плод овально-удлиненный.

Сорта резухи кавказской:

«Флоре-плено» — сорт резухи кавказской, который отличается пышным цветением, в этот период куст густо покрыт белыми махровыми цветками на длинных цветоносах;

«Вариегата» — отличается листовыми пластинами с желтой кромкой;

«Розабелла» — эффектный сорт с крупными розовыми соцветиями;

«Кокцинеа» — сорт с пурпурными цветками;

«Литтл Треже Роуз» — сорт кавказского арабиса, который ценится за то, что в короткие сроки образовывает на участке эффектный ковер из ярко-зеленых листьев, скрывающихся за многочисленными мелкими цветками. Цветки могут иметь белый, розовый, лиловый и сиреневый окрас. Этот многолетник отличается неприхотливость к условиям произрастания и способностью успешно развиваться даже при отсутствии ухода;

«Lotti White» — сорт кавказского арабиса, который часто можно встретить на участках опытных садоводов и новичков. Это компактный многолетник высотой, не превышающей 15 см. Листья мелкие, насыщенно-зеленые. Белоснежные цветки собраны в кистевидные соцветия. Их диаметр составляет 15 мм. Это морозостойкий сорт, выдерживающий заморозки до -25 градусов.

На фото продемонстрированы сорта арабиса или резухи кавказской, посмотрев которые, можно понять, как они смотрятся на приусадебном участке:

       

Резуха стреловидная (A. sagittata).

   

Однолетнее или двулетнее травянистое растение 30-45 см высотой. Стебель и листья шершавые от ветвистых волосков, в нижней части — с примесью простых. Прикорневые листья резухи стреловидной в розетке, продолговатые, суженные в черешок; стеблевые — сидячие, более или менее отклоненные от стебля, с сердцевидным основанием и тупыми ушками, не заходящими друг за друга. Соцветие — узкая и длинная кисть. Цветки белые, 5-6 мм в диаметре, лепестки горизонтально отклоненные. Цветоножки при плодах 3-8 мм длиной. Стручки 2-6 см длиной, прямые, прижатые к цветоносу, линейные, сплюснутые; створки с выдающейся средней жилкой. Семена мелкие, коричневые, гладкие или мелкоточечные, узкокрылатые. Цветет в июне — июле, плодоносит в июле — августе. Размножается исключительно семенами.

Растет по берегам рек и озер, на пойменных лугах, на сухих прогреваемых береговых склонах, на выходах известняков, реже — в сосняках, на сорных местах.

Арабис реснитчатый или реснитчатолистный (A. blepharophylla)

Низкорослое травянистое растение высотой не более 8 см. Разрастается до 24 см в ширину, образует пышные куртины.

Листья и стебли темно-зеленые, густо опушены, поэтому имеют серый оттенок. Цветки насыщенно-розовые или сиреневые, собраны в кистевидные соцветия.

Цветение наступает в мае, длится по июнь. Данный вид резухи является одним из самых капризных. Требует особого ухода. Любит жару, не переносит заморозки. Недостаток или избыток влаги негативно влияют на это растение. Арабис реснитчатый не может расти на бедной почве, но избыток удобрений также негативно влияет на его самочувствие.

Сорта арабиса реснитчатолистного:

«Роут Сенсейшн» — сорт, отличающийся узкими, удлиненными листовыми пластинами ярко-зеленого оттенка и насыщенно-розовыми цветками;

«Фрюлингшабер» — растение с мелкими листьями темно-зеленого окраса, цветки нежно-розовые;

«Роуз делайт» — сорт арабиса реснитчатого, представляющий собой компактный многолетний куст высотой от 10 до 20 см. Его стебли тонкие, стелящиеся. Сорт обладает ярко-розовыми соцветиями, которые очень красиво смотрятся на фоне зеленых листьев. Цвести начинает в марте-апреле-мае, в зависимости от региона. Этот цветок прекрасно подходит для оформления участков с бедным грунтом, где другие декоративные растения не могут расти.

Резуха повислая (A. pendula).

   

Резуха повислая представляет собой травянистый однолетник или многолетник высотой до 120 см, имеет сильно ветвящийся стебель. Листья темно-зеленые, простые, покрыты жесткими волосками. Нижние листья крепятся к черешкам, верхние – сидячие с сердцевидным основанием, овальные, продолговатые или ланцетные, заостренные. На верхушках побегов формируются соцветия –кисти. Цветки мелкие, белые, с чашелистиками, покрытыми волосками. Плод – плоский, дугообразный стручок длиной до 10 см. Внутри плода содержатся семена длиной 2 мм. Цветение этого вида наступает в июле, длится по август.

Резуха песчаная (A. arenosa ).

   

Однолетнее или многолетнее травянистое растение высотой около 100 см с тонким нитевидным корнем. Побеги прямостоячие, сильно ветвистые, сверху голые, в нижней части имеется густое опушение. Листья сформированы в прикорневую розетку. На стеблевых листья имеются мелкие, жесткие волоски, из-за чего их поверхность шероховатая. Верхние листья простые, линейные, с небольшим опушением. Соцветие резухи песчаной – кисть с многочисленными цветками белого, розового и сиреневого оттенка. Цветение начинается в июне, длится по сентябрь.

Резуха Фердинанда Кобургского (A. ferdinandi-coburgii).

   

Арабис Фердинанда Кобургского – это многолетний травянистый почвопокровник, разрастающийся широким, пышным ковром. Его высота составляет не более 8 см. Побеги жесткие, разветвленные, быстро укореняются при соприкосновении с почвой. Листья светло-зеленые, блестящие, с тонкой белой каймой по краю. Кистевидные, рыхлые соцветия длиной около 10 см формируются на верхушках стеблей. Состоят из множества белых цветков диаметром 0.5 см. Цветение длится с мая по июнь.

Резуха Грандифлора розовая.

   

Арабис Грандифлора розовая представляет собой среднерослый многолетник с побегами высотой около 25 – 30 см. Ценится за крупные, до 2 см в поперечнике, нежно-розовые цветки. Стебли данного вида имеют свойство быстро распространяться на большие территории и образовывают пышный, яркий ковер. Данный вид может успешно расти на любой, даже скудной почве.

Уход за арабисом

Месторасположение. Резуха светолюбива, ей необходимы светлые, незатененные участки. Можно высадить арабис на открытых местах сада, где растение будет получать достаточно солнечного света.

Почва. К грунту данная культура нетребовательна, для ее посадки пригодны любые рыхлые, достаточно сухие почвы. В бедную почву рекомендуется внести минеральное или органическое удобрение. Если земля на участке плотная, следует внести небольшое количество песка.

Подкормка. Удобрение вносят перед началом цветения, используя для этого минеральные комплексы для садовых цветов или перегной.

Полив и другой уход. Чтобы кусты арабиса обильно цвели и формировали пышный ковер, при его содержании на участке необходимы регулярные поливы. После орошения обязательна прополка почвы и удаление сорной травы. Для сохранения опрятного вида растения требуется укорачивание сильно растущих и расходящися в стороны побегов. После цветения побеги подрезают на 1/3. Увядшие соцветия сразу устраняют для активизации повторного цветения и сохранения декоративности куста.

Укрытие на зиму. Большинство видов резухи обладают высокой морозостойкостью и не нуждаются в зимнем укрытии. Но некоторые разновидности и сорта арабиса выдерживают температуру не ниже -7 градусов. Стебли этих растений обрезают, оставляя длину не более 4 см, затем накрывают сухой листвой, лапником или укрывным материалом.

Особенности выращивания арабиса из семян

Размножение арабиса осуществляется несколькими способами: семенами, черенками, делением, отводками. Каждый из них имеет свои особенности. Какой способ выбрать, каждый садовод решает сам, но стоит учитывать, что выращивание резухи или арабиса альпийского и кавказского из семян наиболее предпочтительно.

   

Сажают арабис либо семенами в мае, прямо в открытый грунт, либо, выращивая рассаду, а затем, пересаживая ее на постоянное место после того, как минуют возвратные заморозки.

В теплых регионах можно высаживать семена в почву в апреле. Семена заглубляют на 0.5 см, после чего орошают гряду. Можно сначала вырастить рассаду из семян, а подросшие саженцы поместить в открытый грунт с наступлением теплых дней. Посевной материал помещают в небольшие ящики, наполненные смесью из садовой земли и песка с мелкой галькой в соотношении 1:3. Ящики с посевами убирают в теплое место с температурой 20 – 24 градуса. Для более высокой всхожести сооружают мини-парник из агроспана. Периодически укрытия снимают для проветривания парника, почву опрыскивают из пульверизатора. В таких условиях всходы появятся через месяц. После этого укрытие убирают, полив производят уже не так часто. При появлении первой пары листьев сеянцы пикируют в отдельные горшочки или в один большой контейнер на расстоянии 30 см друг от друга. Перед посевом в открытый грунт рассаду закаливают. Для этого в течение 14 дней выносят на улицу, постепенно увеличивая время пребывания. Держат вдали от сквозняков, которые негативно влияют на молодые неокрепшие растения. По окончании периода закаливания саженцы помещают на садовый участок на заранее отведенное для них место. Как отмечалось, оно должно быть достаточно открытым для солнечных лучей. В тени цветение будет не столь пышным, а размер цветков будет меньше, чем при хорошем освещении.

Как проводится работа на участке по посадке и уходу за арабисом многолетним или резухой на фото ниже хорошо продемонстрировано:

   

Размножение резухи делением и черенками

Кусты делят и рассаживают весной и осенью после цветения. Выбирают хорошо разросшийся куст, выкапывают его и осторожно, стараясь не повредить корни, с помощью острого ножа делят его на 3 – 4 равные части, чтобы у каждой оставались здоровые корни и точки роста. Саженцы заглубляют в посадочные ямы. Расстояние между ними должно составлять 30 – 40 см.

   

Черенкование проводят с середины мая до начала июня. Для этого с взрослого растения нарезают черенки длиной 10 см. С их нижней части убирают листья и помещают в песчаный грунт под углом. Черенки ежедневно опрыскивают и осторожно поливают. Корневая система у черенков сформируется в течение 3 недель. После этого их можно рассаживать на постоянное место.

Использование резухи в саду

Арабис – ценное растение, которое помогает ярко, красиво и необычно украсить участок, оживить его, сделать привлекательным и незаурядным.

   

Часто применяют данную культуру для оформления бордюров, каменистых горок, рокариев. Посадив арабис весной в саду, цветение его можно увидеть только в следующем году, поэтому, чтобы горка не выглядела пустой и блеклой, следует подсадить в это место какое-нибудь однолетнее растение. Оно не помешает расти многолетнику — резухе, но зато украсит горку уже в этом году.

Незаменима резуха для декорирования подпорных стенок, облагораживания проблемных мест на участке. Пышный ковер украсит приствольные круги кустарников и крупных садовых деревьев.

При выращивании арабиса стоит учитывать, что эта культура быстро разрастается и образует пышный ковер. Его можно высаживать отдельно от других растений для оформления поляны. Любое место, где высажена резуха смотрится ярко и нарядно.

   

Арабис является прекрасным медоносом. Его сильный приятный аромат привлекает пчел. Если необходимо, чтобы запах цветов сохранялся в саду как можно дольше, следует высаживать его на участке, закрытом от ветра.


Как вырастить арабис многолетний из семян: опыт посадки и ухода

Цветущий арабис привлекает не только своей красотой, но и дивным, тонким ароматом. Посадите на своем участке этот чудесный неприхотливый многолетник, соблюдайте простые правила ухода, и он будет многие годы радовать вас своей красотой и ароматом.

В чем особенности арабиса?

В этот цветок я влюбилась с первого взгляда, как только увидела в магазине пакетик, на котором красовались нежно-розовые цветы.

Арабис по-другому называют резухой. Несмотря на такое прозвище, листочки у растения мягкие, порезаться невозможно.

  • Этот почвопокровник растет в природе в сухой, жаркой, каменистой местности.
     
  • Легко переносит бедные почвы.
     
  • Арабис идеально вписывается в концепцию неприхотливого, малоуходного сада.
     
  • Для невысоких кустиков арабиса (в высоту ок. 30 см) самое главное — чтобы не было застоев влаги.

Секреты ухода

Поливать только в засушливые периоды. Не допускать сильного разрастания. Арабис довольно быстро заселяет пустующие территории и даже может вытеснять своих соседей, тех, что скромнее и меньше ростом. Поэтому при посадке предусмотрите достаточно места для резухи или поставьте ограничители.

  1. После цветения обрезаю цветоносы. Такая процедура арабису на пользу: он разрастается пышной зеленью и дает еще более обильное цветение.
     
  2. Также слегка укорачиваю разрастающиеся побеги, чтобы арабис не заглушил соседние растения.
     
  3. Регулярно рыхлю почву, удаляю сорняки.
     
  4. Поливаю умеренно, только в самую засушливую погоду – при застое воды могут загнить корни.

Арабис – достаточно морозоустойчивое растение. Он может спокойно зимовать под слоем снега. Иногда после зимы в больших кустах появляются проплешины. Я засыпаю оголенные участки универсальным грунтом, смешанным с перегноем, и вскоре растение омолаживается: дает новые корни, стебли и листья.

Фото: арабис кавказский Розеа (Arabis caucasica Rosea)

Чем хорош в дизайне сада?

Почвопокровное неприхотливое растение. Цвести начинает рано, в теплых регионах - с середины апреля. Цветение продолжается 1 месяц.

  1. Поэтому ценность арабиса — не в цветах, а в сочной густой листве. В теплом климате это вечнозеленое растение. 
     
  2. Арабис любит солнечные жаркие места, хорошо растет на камнях, значит можно посадить в рокариях и на альпийских горках.
     
  3. Листочки, кстати довольно крупные для почвопокровника, имеют приятный серебристый оттенок. Поэтому арабис прекрасно дополнит ваш сад в серых тонах.

Сочетание с другими растениями

Арабис будет хорошо сочетаться с такими растениями, как:

  • лаванда,
  • ясколка Биберштейна,
  • можжевельники,
  • юкка,
  • очитки,
  • опунция,
  • маклея (боккония),
  • яснотка,
  • бруннера,
  • шалфей лекарственный,
  • обриета,
  • райграс бульбоосный,
  • чистец византийский (овечье ушко).

Удивительное цветение

Зацвел мой арабис на 2-й год после пересадки. Цветет он почти месяц, с середины апреля до середины мая. Когда весна бывает ранняя, то арабис зацветает еще раньше, в начале апреля. А если весна затяжная и прохладная, зацветает позже обычного и цветет дольше.

Цветущий арабис не только потрясающе красив – он наполняет сад потрясающим нежно-сладким ароматом. Растение является хорошим медоносом и привлекает большое количество полезных насекомых – бабочек, шмелей, пчел.

Фото: арабис кавказский

Как размножить

Кустики арабиса легко делятся, это самый доступный и простой способ размножения. Куст делят каждые 3-4 года, растение хорошо приживается.

Деленку пересаживать легко. Можно выкопать кустик и аккуратно разделить корни руками, либо же просто разрезать лопатой разросший куст и выкопать деленки.

Почву никак особенно готовить не нужно. Достаточно выкопать ямку, взрыхлить, присыпать кустик и умеренно, но регулярно поливать первое время. 

При семенном размножении цветение наступит только через год. 

Можно пришпиливыть побеги и ждать их укоренения. 

Размножается арабис семенами,
а махровые сорта – делением и черенкованием

Арабис из семян

Каждую весну на моей клумбе появляется розовое душистое облачко. Это цветет арабис. Он растет пышными кустиками, достигая в высоту 15–20 см и разрастаясь в ширину до 40–50 см.

Посеяла
  1. В конце марта посеяла семена в горшочки с универсальным грунтом и оставила на улице (у нас на юге в это время уже тепло). Глубина заделки семян – 0,5 см.
     
  2. Днем ставила контейнер с горшочками на солнце, на ночь и на время дождей заносила под навес.
     
  3. Поливала из пульверизатора, сбрызгивая землю в горшках 1 раз в 3 дня.

Всходы появились через 3 недели, когда воздух сильнее прогрелся.

Пересадила

После появления 2–3 листочков пересадила растения на постоянное место.

Сначала высадила с краю центральной клумбы, с западной стороны. Но потом поняла, что это была ошибка. Растения у меня на клумбах высажены «по росту», т. е. с краев – более низкорослые, а дальше, вглубь клумбы, высота растений увеличивается. И получалось, что высокорослые растения заслоняли солнце, и арабис получал мало света.

Осенью пересадила арабис на край противоположной клумбы – там света вдоволь. Так как арабис любит рыхлую почву, то для большего разрастания и буйного цветения при пересадке добавила в грунт песка.

Удобрила

У меня было 4 кустика арабиса. Высадила их на расстоянии 30–35 см друг от друга. В каждую лунку насыпала несколько гранул азотного удобрения для лучшего роста.

В дальнейшем удобряла арабис один раз в год, перед цветением.

Фото: арабис альпийский

Желаю всем дачникам, садоводам, огородникам, цветоводам огромных успехов в достижении намеченных целей и преображении нашего мира!

Т. Клепова, г. Ростов-на-Дону; Анна Еланская, журналист

Арабис. Виды и сорта, посадка и уход. Фото арабиса.

Род объединяет больше 100 видов, произрастающих от арктической до тропической зоны Европы и Южной Америки. Многолетние или однолетние растения со стелющимися, а также укореняющимися стеблями.

Листва арабиса цельная, густо опушенная. У арабиса цветки розовые, белые, желтоватые или лиловые 1,5 см диаметром, махровые или простые, в маленьких кистевидных соцветиях.

Виды и сорта арабиса

Самые распространенные в культуре виды: 

Арабис альпийский

встречается на Дальнем Востоке, Полярном Урале, в Северной Скандинавии, в Северной Америке, Западной Европе.

Многолетник 30 см высотой. У арабиса альпийского генеративные побеги восходящие, а вегетативные — ветвистые, прижаты к почве, образуют подушковидные куртины, которые на зимний период не отмирают.

Прикорневая листва арабиса альпийского овальная, а стеблевая — сердцевидно-стреловидная, серая. Цветки розовые, белые, пахучие. Цветение приходится на конец апреля и длится около 25 дней.

Имеет махровую разновидность, почти ни чем не отличающуюся от исходной формы, однако соцветия намного крупнее. Цветки 2 см диаметром. Цветет эта разновидность в мае.

Арабис кавказский

Некоторые ботаники арабис кавказский рассматривают, как разновидность альпийского.

Произрастает в Крыму, и в Малой Азии.

Многолетник, достигающий 30 см высотой во время своего цветения. Полегающие побеги с легкостью укореняются.

Листья продолговатые, серо-зеленые, небольшие, крупнозубчатые по краю. В теплые зимы листва вегетативных побегов арабиса кавказского зимует.

Цветки белоснежные, собраны они в кистевидное соцветие. Обильно цветет с начала июня около месяца.

Имеет формы и сорта. К примеру: 'Шнеехаубе' — с белыми цветками; 'Rosabella' с розовыми цветами.

Арабис проломниковый

Родиной являются горы Турции.

Подушковидное многолетнее растение  до 10 см высотой. Листва овальная с острым концом. Цветки белые появляются летом. Нуждается в открытом месте в расщелинах камней. Почву предпочитает бедную, сухую.

На зиму нуждается в сухом укрытии. Семена сеют весной. Растение делят осенью, а черенками размножают летом.

Арабис реснитчатолистный

Родиной считаются горы Калифорнии.

Многолетник 8 см высотой. Листья этого арабиса серо-зеленые, а цветки розовые. В культуре, распространены сорта. 'Fruhlingszauber' - с небольшими листиками и розовыми цветками; 'Rote Sensation' - с розовыми цветками, более удлиненной листвой.

Арабис Фердинанда Кобургского "Вариегата"

Растет в Болгарии.

Многолетнее полувечнозеленое растение 5 см высотой и кустиком 30 см диаметром. Ценится за пышное цветение, цветки белые. Ко всему имеет зеленую с белым окаймлением листву. Встречаются формы и с розоватым окаймлением. Любит бедную, дренированную, но не чересчур сухую почву. Предпочитает легкую полутень. 

Месторасположение арабиса в саду

Требует солнечных, открытых мест, также растет и в небольшой тени, однако на солнце арабис получается более компактным, быстро разрастается, и богаче цветет.

Почва для арабиса

Отдает предпочтение песчаной, рыхлой, правильно обработанной почве.

Уход за арабисом

В России в средней полосе требуют небольшого укрытия. Ухаживать следует также как и за всеми многолетними цветами. Большое внимание надо обращать на прополку сорняков. Эта культура быстро разрастается и заглушает рядом растущие растения, поэтому надо укорачивать побеги, а это улучшит цветение на следующий год.

Размножение арабиса

Семенами, махровые формы — черенками, а также делением куста. Семена сеют весной или в зиму, сеянцы зацветут на второй год. Посадку совершают весной или осенью, оставляя расстояние между экземплярами 30 см.

Черенкуют арабис в начале июня. Укоренение наступает через несколько недель. В открытый грунт черенки сажают в сентябре.

Использование арабиса в ландшафтном дизайне

В бордюрах, миксбордерах, в альпинариях.

Партнеры арабиса

Очень красив рядом с тюльпанами.

Арабис многолетний: посадка и уход, фото

Решила на дачном участке сделать каменистый садик небольшого размера, мою давнюю мечту. Помогала мне подруга — ландшафтный дизайнер. Она подсказала в качестве фонового небольшого растения выращивать Арабис разных сортов. Действительно, получилось очень симпатично.

Мелкие яркие цветочки и пышная зелень очень украшают мой экспериментальный проект. Растение неприхотливое, а пользы много. В статье хочу рассказать всем желающим и увлекающимся выращиванием садовых цветов и украшением дачных участков об Арабисе многолетнем, правилах посадки и уходе за ним.

Содержание статьи

Арабис многолетний — прекрасное украшение сада

Нетребовательное растение очень популярно у цветоводов, ландшафтных дизайнеров и всех тех, кто любит выращивать садовые цветы и делать свой дачный участок привлекательным. Уже более 2 — х столетий арабис используют для придания яркости и стиля альпийским горкам, каменистым садикам, рабаткам, да и просто высаживают вдоль садовых дорожек. Везде он смотрится одинаково изысканно.

Ботаническое описание

  • Причисляется арабис или Резуха к многолетникам и травянистым растениям семейства Крестоцветные (Капустные). В мире на сегодняшний день известно около 200 видов этого нетребовательного низкорослого растения.
  • Работа селекционеров приносит свои плоды: среди этих видов половина — выведенные гибриды, интересные по своему строению и характеристикам.
  • В дикой природе арабис можно встретить в северной части Америки, в регионах с умеренным климатом, горной местности Евразии, на каменистых склонах, а также в тропической части горной Африки. Любит арабис и песчаную местность.
  • Это прекрасный медонос, поэтому возле пахучих ароматных кустиков постоянно летают насекомые. Второе название дали в народе по причине наличия волосков опушения, имеющих жесткую структуру. Появление же латинского названия остается тайной и по сей день.
  • Можно выращивать цветы как однолетники и многолетние. Это почвопокровные растения с небольшой корневой системой и высотой всего 30 — 35 см. Строение стеблей стелющееся, и они могут укореняться.
  • Куст обильно украшен яркой зеленой листвой. Поверхность листовой пластины имеет густую опушенность, листья цельные, форма их в виде сердца. У некоторых видов кромка зубчатая.
  • В период цветения кустик покрывается небольшими соцветиями в форме кисти, состоящими из маленьких цветочков не более полутора сантиметров в диаметре. Окраска их ограничивается 4 основными расцветками: желтым, розовым, белым, лиловым. Строение цветка может быть простым и махровым.
  • Цветение начинается со второй половины апреля. Обычно оно обильное и пышное, весь куст покрывается соцветиями, вокруг которых летают пчелы.
  • После фазы цветения созревает плод в виде стручка, в котором располагаются семена плоской формы. Некоторые разновидности арабиса имеют крылатые.

Популярные разновидности

Ниже представлено несколько самых популярных сортов, которые можно предложить выращивать в средней полосе России. Они нетребовательны и декоративны, обладают простой красотой и привлекательностью.

Кавказский

  • Корневая система развита очень хорошо, приспособлена для роста и развития в горной местности, подойдет для выращивания в каменистых садах.
  • Сорт способен очень быстро укорениться в самых труднодоступных каменистых расщелинах. В высоту достигает не более 15 — 17 см, но в ширину расстилается «ковром» почти на пол метра.
  • Пик цветения приходится на май. В цветущем состоянии выглядит очень нежно на фоне густой зеленой листвы. Этот арабис имеет, как и многие сорта, приятный и достаточно сильный аромат. Цветки могут иметь молочно — белый оттенок или светло — розовый.
Реснитчатолистный

  • В дикой природе можно встретить в горной местности Калифорнии, на высоте полкилометра. Высота совсем небольшая — всего 8 см, куст компактный, строение почвопокровное. Растение стелется по земле, и прекрасно выдерживает палящее солнце и засуху.
  • Это многолетник, окружность кроны около 25 — 30 см, листва темно — зеленая с сероватым оттенком, а цветки имеют яркий розовато — малиновый окрас.
  • На клумбах и в цветниках наиболее популярны несколько сортов: Роут сенсейшн и Фрюлингшабер.
Альпийский

  • Ареал произрастания очень велик: обитает высоко в горах на севере Америки и в Европе, а также встречается на Урале, Дальнем Востоке. Вид один из самых высоких — побеги достигают 30 — 35 см.
  • Ростки крепкие, сильно ветвятся, образуют «подушку». Вид обладает несколькими видами побегов: одни устремляются вверх — генеративные, вторые — в виде плетей, стелются. В итоге получается очень пышный симметричный, хорошо сформированный куст.
  • Цветки белого или светлого розового оттенка, окружность около сантиметра, собраны в кистевидные соцветия длиной 5 см. Листья, растущие у основания куста имеют овальную форму, на стеблях — стреловидно — сердцевидные.
  • Пик цветения — во второй декаде апреля, продолжается цветение довольно долго — почти месяц. Цветки источают приятный аромат.
  • Известные сорта: Шнеесхаубе, розовая и белая садовые формы.

Также известны такие виды: Бруовидный, Выбегающий, Низкорослый, Проломниковый, Фердинанда Кобургского Вариегата. Можно приобрести семена сразу нескольких видов арабиса, и составить замечательный ансамбль, разбавляя другими садовыми растениями. Как правильно вырастить его, смотрите ниже.

Особенности посадки

Есть несколько вариантов посадки семенного материала — сразу в грунт или предварительно вырастить в помещении рассаду. В почву высаживать необходимо под зиму, то есть поздней осенью, чтобы семена не успели прорасти, желательно во второй половине октября.

Выращивание рассады

  1. Приобретите семена в садовом центре или специализированном магазине. Приступайте к процедуре посадки семечек в апреле.
  2. Приготовьте контейнеры, ящики или другие емкости, засыпьте питательную почвосмесь, состоящую из 3 — х долей садовой земли и 1 доли песка или керамзита для легкости и рыхлости.
  3. Семена заглубите не более чем на 0,5 см. Увлажните почву, и накройте нетканым материалом (подойдет агроспан). Так посадочный материал взойдет быстрей.
  4. Далее контейнеры определите на место, где должен поддерживаться постоянный температурный режим + 20 градусов.
  5. Периодически снимайте укрытие и проветривайте, совмещайте с умеренным, но регулярным поливом. Через 20 — 25 дней снимите укрытие совсем. Увлажняйте субстрат немного реже.
  6. Затем перенесите контейнеры в тепло и на место (подоконник), где достаточно света, иначе всходы вытянутся.
  7. Когда на ростках сформируется несколько самостоятельных взрослых листиков, рассаду можно пикировать. Но только в том случае, если арабис будете выращивать как растение одиночное. Тогда рассадите в отдельные стаканчики или горшочки или в контейнер с промежутком 25 — 30 см.

За несколько недель до пересадки в открытую почву на постоянное место необходимо выносить рассаду на улицу, чтобы растения привыкали к свежему воздуху. Каждый день следует увеличивать количество часов, пока молодые ростки арабиса целый день не будут находиться за пределами помещения. Тогда их можно высаживать на постоянное место на клумбу.

Пересадка в открытый грунт

  • Желательно процедуру осуществлять в середине мая. Пересадите растения на солнечное, хорошо освещенное место. Можно выбрать участок, где полутень, но цветение не будет таким обильным и продолжительным.
  • Важно, чтобы почва была песчаной, рыхлой и легкой. Можно высадить сразу несколько растений в одну ямку.
  • Промежуток между лунками сделайте 40 — 50 см. Внесите в почву дерн, торф и песок. Можно посадить росточки даже в грунт с высоким уровнем кислотности или бедный, но тогда сильного разрастания не ждите.
  • После посадки хорошо увлажните почву. Если она бедная на удобрения, то спустя несколько дней внесите дополнительные питательные вещества в виде минеральных комплексов.

Цветение арабиса произойдет только на следующий год после посадки.

Рекомендации по уходу

  1. Выращивание включает в себя все обычные процедуры: удобрение, рыхление грунта возле растений, устранение сорной травы, санитарную и формирующую обрезку.
  2. Полив необходимо проводить очень умеренно. Арабис — засухоустойчивое растение, поэтому лучше лишний раз не полить, чем заболачивать грунт. Увеличьте количество увлажнений грунта во время очень жарких и засушливых летних дней.
  3. Периодически удаляйте отцветшие соцветия, тогда период цветения увеличивается. Также следите, чтобы не оставались поврежденные, подсохшие побеги. Периодически прореживайте кустики, чтобы солнце проникало в нужном количестве ко всем частям растения.
  4. Арабис редко подвергается атакам вредных насекомых. Только в некоторых случаях он поражается крестоцветной блошкой или вирусной мозаикой. С последней бороться бесполезно.
  5. Когда появляются небольшие пятна коричневатого оттенка, которые со временем увеличиваются, то срочно выкопайте растение. Затем обработайте почву сильным раствором марганцовки. На это место высаживайте растения только через год.
  6. От крестоцветной блошки поможет обработка кустов препаратами: Карбофосом, Актарой, Искрой, Актелликой.

Заключение

  • Находка для украшения садового участка или клумбы возле дома — посадка и выращивание арабиса многолетнего. Видов растения существует довольно много.
  • Арабис неприхотливый, поэтому его под силу вырастить даже новичку. Рекомендуется рассадный способ. Уход обычный, как за всеми остальными садовыми растениями.

посадка и уход в открытом грунте, выращивание из семян, виды и сорта с фото

Многолетнее травянистое растение арабис (Arabis), еще именуемое резухой, является представителем семейства крестоцветные, либо капустные. В данный род включено больше 100 видов. В диких условиях такое растение можно повстречать в областях с умеренным климатом Северного полушария, а также в горах тропической Африки. Точно не выяснено, как и откуда произошло латинское название данного растения. Резухой же его именуют потому, что куст опушен жесткими волосками, о которые можно достаточно легко пораниться. Культивируется арабис уже больше двух веков. В ландшафтном дизайне данными цветами украшают клумбы и миксбордеры, а также рабатки, бордюры и альпийские горки.

Особенности арабиса

Арабис культивируют в качестве однолетника либо многолетника. Его используют как почвопокровное растение, так как оно обладает стелющимися укореняющимися побегами. Высота куста не превышает 0,3 метров. На поверхности зеленых листовых пластин имеется плотное опушение, их форма сердцевидная, они цельные, иногда с зубчатой кромкой. Не очень большие плотные соцветия кистевидной формы состоят из махровых либо простых цветков, в диаметре достигающих 15 мм, они могут быть окрашены в белый, светло-желтый, розовый либо лиловый цвет. Обильное цветение растение является сравнительно длительным, и начинается оно примерно в середине весеннего периода. От соцветий исходит очень приятный запах, который привлекает в сад большое количество пчел. Плод ― это стручок, внутри которого находятся семена плоской формы. Есть виды, обладающие крылатыми семенами. Данное растение состоит в родстве с хреном, капустой, иберисом, алиссумом, сурепкой, горчицей, редькой и иными представителями семейства крестоцветные. Оно обладает не только резким запахом, но и является неприхотливым к условиям выращивания.

Выращивание арабиса из семян

Посев

Арабис очень легко и просто вырастить из семян, купить которые можно в специальных магазинах, садовых центрах либо на цветочных выставках. Высев семян можно произвести непосредственно в открытую почву под зиму в октябре. Также резуху можно выращивать через рассаду, в этом случае посеять семена нужно в апреле. Для этого наполните контейнеры либо ящики почвосмесью, состоящей из садовой земли и меленьких камней либо песка (3:1). Семена нужно заглубить в субстрат всего на полсантиметра, затем емкость ставят в место, где температура воздуха примерно 20 градусов. Чтобы увеличить всхожесть семян, емкость нужно накрыть нетканым материалом, к примеру, агроспаном.

Выращивание рассады

Спустя 3–3,5 недели после появления сеянцев укрытие убирается, при этом полив необходимо сократить. Рассаду нужно перенести в теплое и хорошо освещенное место. Уход за данной рассадой не составит особого труда. Ее лишь нужно поливать, когда это необходимо, а также систематически аккуратно рыхлить поверхность субстрата.

Пикировка

Когда у сеянцев появится первая настоящая листовая пластина, необходимо произвести их пикировку, но только в том случае, если вы собираетесь выращивать резуху, как отдельное растение. Для этого растеньица пикируют в индивидуальные стаканчики либо рассаживают на расстояние не меньше 0,3 м. В том случае, если вы предполагаете использовать данный цветок, как почвопокровное растение, то пикировать его не нужно. За 10–12 суток до пересадки арабиса в открытую почву, необходимо заняться его закалкой. Для этого растения переносят на улицу каждый день, при этом продолжительность закаливающих процедур нужно увеличивать постепенно. Во время нахождения рассады на свежем воздухе, обеспечьте ей надежную защиту от сквозняков. После того как растеньица полностью адаптируются к новым условиям, их можно будет высаживать в открытую почву.

Посадка арабиса в открытый грунт

В какое время высаживать

Высадкой рассады в открытую почву необходимо заняться в последние дни мая либо первые ― июня, но при этом следует учесть, что у растеньиц должно обязательно быть не меньше трех настоящих листовых пластин. Наилучшим участком для посадки резухи станет тот, что хорошо освещен и продувается ветром. Однако ее можно посадить и в затененном месте, но при этом следует учесть, что в данном случае цветение кустиков будет менее обильным, и разрастутся они не очень сильно.

Как правильно высадить

Подходящий для посадки грунт должен быть песчаным, рыхлым, не очень влажным, насыщенным минеральными и органическими веществами, очищенным от сорной травы и тщательно обработанным. Чтобы улучшить воздухо- и влагопроницаемость почвы, в нее рекомендуется внести небольшие камешки, песок и дерн. Однако если выращивать арабис в бедной кислой либо кальцинированной почве, то он не погибнет, но при этом и очень сильно не разрастется. Схема высадки рассады 0,4х0,4 м. В одну лунку можно посадить сразу 3 либо 4 растеньица. Высаженная резуха нуждается в обильном поливе. В том случае, если почва перед высадкой не была удобрена, то спустя 1–2 дня после данной процедуры обязательно подкормите растеньица комплексным минеральным удобрением. Первое цветение можно будет увидеть лишь на второй год жизни.

Уход за арабисом в саду

За резухой нужно ухаживать так же, как и за большинством обычных садовых растений. Ее требуется своевременно поливать, пропалывать, подкармливать, обрезать, а еще производить рыхление поверхности участка и следить за здоровьем. Такой цветок устойчив к засухе, и его лучше недолить, чем перелить. А это значит, что полив следует устраивать лишь тогда, когда наблюдается продолжительный засушливый период. Помните, что полив должен быть умеренным.

Арабису в начале его жизни необходимо обеспечить свободу от сорной травы, для этого требуется проводить частые прополки. Однако со временем цветок окрепнет, и будет сам «задавливать» сорняки. Быстрорастущие стебли необходимо подвергать систематической обрезке, чтобы сохранить форму растения опрятной. Своевременное удаление начавших увядать цветков, способствует более длительному цветению.

Размножение арабиса

Размножить резуху можно семенами, а еще такими вегетационными способами, как: отводки, черенкование и деление куста. О выращивании данного цветка из семян очень подробно описано выше. Черенками можно размножить махровые либо достаточно редкие сорта резухи. В этом случае черенок представляет собой листовую пластину с пяточкой, которая является частью камбиального слоя. Из данного слоя и отрастут корешки. Для получения «правильного» черенка следует оторвать листовую пластину с куста с оттяжкой таким образом, чтобы вместе с ним отделилась часть коры побега с подкорной мякотью. Заготовку черенков проводят по окончании цветения. При желании в качестве черенка можно взять верхнюю часть стебля, его длина должна быть 10 сантиметров, при этом у него нужно оборвать все листовые пластины, расположенные снизу. Высадку черенков производят в рыхлую почвосмесь под наклоном, затем емкость необходимо накрыть колпаком, который должен быть прозрачным. Получившуюся мини-тепличку следует поставить в хорошо освещенное место, которое должно быть защищено от прямых лучей солнца. Почва должна быть постоянно немного влажноватой. Черенки также нуждаются в систематических проветриваниях, а еще нужно удалять конденсат с поверхности укрытия. После того как произойдет восстановление тургора верхних листовых пластин, можно будет начать пересадку черенков в сад.

Для получения отводка следует выбрать крепкий стебель и пригнуть его к поверхности участка. Зафиксируйте данный стебель в таком положении в районе листового узла и не забудьте произвести прищипку верхушки. После того как из листового узла вырастут молодые корни, отводок можно будет отрезать от материнского куста и посадить на постоянное место.

Если вы выращиваете махровый либо редчайший сорт арабиса, то в этом случае его рекомендуется размножать делением куста. Извлеките из почвы куст, разделите его на несколько частей, которые рассадите на новые постоянные места. Размножать цветок таким образом, рекомендуется лишь по окончанию цветения.

Пересадка

Размножить резуху делением куста можно, и не извлекая ее из почвы. Для этого необходимо ее побеги пришпилить к поверхности участка и подождать, когда из листовых узлов отрастут корешки. Затем производят отделение отводков от родительского куста. Их нужно будет поделить на отрезки по количеству корневых пучков. Затем их рассаживают на постоянные места.

Заболевания и вредители

Резуха отличается высокой устойчивостью к различным болезням и вредителям. Однако очень редко она может заболеть вирусной мозаикой либо на ней может поселиться крестоцветная блошка. Если на поверхности листовых пластин появились небольшие пятнышки бурого окраса, которые со временем увеличиваются до тех пор, пока не сольются друг с другом, это говорит о том, что растение заражено вирусной мозаикой. Данный экземпляр вылечить нельзя, поэтому его следует извлечь из грунта и уничтожить. Участок, на котором рос зараженный цветок, необходимо пролить крепким раствором марганцевого калия. На этом месте нельзя растить ничего, по меньшей мере, 1 год.

Если на кустах поселилась крестоцветная блошка, то опудривание их древесной золой будет низкоэффективной и довольно трудозатратной процедурой. В таких случаях кусты рекомендуется опрыскать Актарой, Карбофосом, Актелликом, Биотлином либо Искрой.

Арабис после цветения

Сбор семян

Когда резуха будет цвести, нужно выбрать наиболее эффектные соцветия и наметить их. После первых заморозков можно будет приступить к сбору семян, для этого выбирается сухой солнечный денек. Дело в том, что если собрать семена в дождливый день, то они будут обладать сравнительно низкой всхожестью. Для начала надо обрезать соцветия с частью побега. Их подвешивают в хорошо вентилируемом помещении и дожидаются, пока они высохнут. Затем семена извлекаются из соцветий и помещаются в коробочку из картона, которую хранят в сухом затемненном месте.

Подготовка к зимовке

Без укрытия такой цветок может выдержать понижение температуры до минус 5–7 градусов. Если температура воздуха опустится еще ниже, то это приведет к гибели не укрытого арабиса. С началом морозов необходимо провести обрезку стеблей, при этом на поверхности должны остаться их отрезки длиной 20–40 мм. Затем участок засыпается слоем высохшей листвы, а можно укрыть его укрывным материалом либо лапником.

Виды и сорта арабиса с фото и названиями

Ниже будут описаны те виды и сорта, которые пользуются наибольшей популярностью у садоводов.

Арабис альпийский (Arabis alpina = Arabis flaviflora)

В природных условиях данный вид можно повстречать в северной части Скандинавии, в высокогорных районах Западной Европы и Северной Америки, а также на территории Дальнего Востока и Полярного Урала. Высота такого многолетнего растения может достигать 0,35 метров. Генеративные стебли являются восходящими, а петлеобразные вегетативные ― прижаты к почве, они сильно ветвятся, не отмирают в зимнее время и образуют подушковидные куртины. Форма стеблевых листовых пластин сердцевидно-стреловидная, а прикорневых ― овальная. Длина соцветий кистевидной формы около 50 мм, они состоят из душистых цветков диаметром 10 мм, которые могут быть окрашены в белый либо розовый цвет. Цветение начинается в апреле и длится примерно 4 недели. Садовые формы:

  1. Шнеесхаубе. Высота куста не превышает 0,25 м. Длина кистевидных соцветий около 15 сантиметров, они состоят из крупных (диаметр 20 мм) цветков белого цвета.
  2. Махровая. Соцветия имеют больший размер по сравнению с исходным видом, также они схожи с левкоями.
  3. Розовая. Высота кустика не превышает 0,2 метров. Длина соцветий около 12 сантиметров, в их состав входят цветки розового окраса, в диаметре достигающие 20 миллиметров.

Выше рассказывается о посадке и уходе именно арабиса альпийского.

Арабис бруовидный (Arabis bryoides)

Родиной такого растения является альпийский и субальпийский пояс горных областей Греции, Албании и Болгарии. Данное многолетнее растение, обладающее подушкообразной формой, в высоту достигает около 10 сантиметров. На поверхности небольших реснитчатых листовых пластин овальной формы имеется войлочное опушение, они собраны в розетки. Неплотные щитковидные соцветия состоят из 3–6 цветочков белого окраса.

Арабис кавказский (Arabis caucasica)

По мнению некоторых ученых данное растение является подвидом арабиса альпийского. В природных условиях его можно повстречать в Крыму, Малой и Средней Азии, на Кавказе и в Средиземноморье. В период цветения высота данного многолетнего растения может доходить до 0,3 м. Маленькие продолговатые листовые пластины с большими зубцами по кромке на поверхности имеют плотное опушение белого цвета, от чего их окрас выглядит как зеленовато-серый. Соцветия кистевидной формы в длину достигают 8 сантиметров, они состоят из цветков белого окраса, диаметр которых 15 мм. Цветение начинается в июне и длится 4 недели. Однако отдельные цветочки могут распускаться на кусте до самой осени. Плод представляет собой узенькую длинную шишечку. Культивируется с 1800 г. Садовые формы:

  1. Флоре-плено. Цветение пышное, махровые цветки белого окраса располагаются на длинных цветоносах.
  2. Вариегата. По кромке листовые пластины светло-желтые.
  3. Розабелла. Окрас цветков розовый.

Арабис выбегающий (Arabis procurrens)

В природе данный вид растет на Балканах. Высота такого почвопокровного растения около 12 сантиметров. Имеются небольшие листовые розетки и цветки бледного окраса. Зачастую такой вид применяют для закрепления оползающих склонов. Этот вид отличается своей неприхотливостью и морозоустойчивостью, но при этом его рекомендуется обязательно укрывать на зиму. Наиболее популярный сорт ― Вариегата: у зеленых листовых пластин имеется широкое окаймление белого цвета, фиолетовые цветки собраны в пучок, их окрас со временем сменяется на белый.

Арабис низкорослый (Arabis pumila)

В диких условиях такое растение можно повстречать в Альпах и Апеннинах. Высота куста около 15 сантиметров. Неприглядные цветки окрашены в белый цвет. Цветение начинается в мае либо июне. У такого вида декоративны не цветки, а плоды, благодаря которым садоводы его и выращивают.

Арабис проломниковый (Arabis androsacea)

В природе этот вид встречается на высоте 2300 метров над уровнем моря на каменистых склонах Турции. Высота данного многолетнего растения от 5 до 10 сантиметров. Небольшие заостренные листовые пластины овальной формы входят в состав розеток. Неплотные щитковидные соцветия состоят из белых цветков.

Арабис реснитчатолистный (Arabis blepharophylla)

В природе встречается этот вид в горах Калифорнии на высоте 500 метров над уровнем моря. Это почвопокровное многолетнее растение в высоту достигает 8 сантиметров, при этом диаметр куста примерно равен 0,25 м. Окрас листвы зеленовато-серый, а цветков ― темно-розовый. Популярные сорта:

  1. Роут Сенсейшн. Листовые пластины удлиненные, а окрас цветков насыщенно-розовый.
  2. Фрюлингшабер. У кустика имеются маленькие листочки и розовые цветки.

Арабис Фердинанда Кобургского Вариегата (Arabis ferdinandi-coburgii «Variegata»)

Высота такого полувечнозеленого растения не превышает 50 мм, а его диаметр может доходить до 0,3 м. Этот вид отличается длительным пышным цветением. Эффектные бледно-зеленые листовые пластины обладают окаймлением желтого, белого либо светло-розового цвета. Окрас цветков белый. Очень красиво смотрятся широкие подушки листовых розеток. Если имеется хороший дренаж, то такой вид сможет выдерживать минусовые температуры.

уход, обрезка, посадка этого милого белоцветкового куста

Арабис - это просто красивое травянистое растение, которое долго цветет весной, предлагая нежные белые цветы.

Факты об арабисе, сводка

Название - Arabis alpina
Семейство - Brassicaceaa или Cruciferae
Тип - многолетнее

Высота - 12 дюймов (30 см)
Экспозиция - полное солнце
Почва - светлая, хорошо дренированная

Листва - вечнозеленая
Цветение - Апрель-июнь

За ним легко ухаживать, а декоративные свойства этого растения делают его идеальным в качестве почвопокровного, для каменистого грунта или по краям.

Посадка и посев арабиса

Арабис любит хорошо дренированные почвы и очень хорошо растет на песчаных почвах.

Любит очень солнечные пятна, но переносит светлый оттенок.

Как сажать арабис

Сажать арабис лучше всего либо весной , либо осенью .

Не забывайте регулярно поливать вначале, если вы сажаете весной, а тем более летом.

  • Размножаются путем переноса молодых растений, которые появляются вдоль побегов.

Арабис посев

Посев Arabis лучше всего проводить весной.

Сейте в защищенном месте, избегая попадания прямых солнечных лучей.

Уход за арабами

Arabis очень прост в выращивании и уходе. Просто время от времени проверяйте его рост, чтобы избежать слишком большого распространения.

Если хотите, регулярно удаляйте увядшие цветы, но в этом нет необходимости.

Поскольку листва вечнозеленая, обрезать ее после цветения не очень полезно.

Вредители и болезни арабов

Что касается вредителей, то вы можете столкнуться с кошмаром овощеводов - гусеницей капусты. Однако на вашем арабисе он не сделает ничего, кроме пережевывания листьев.

Все, что нужно знать об арабском языке

Название « Arabis » придумал ботаник Карл фон Линне . Он видел соответствие между песками Аравийской пустыни и песками, в которых так хорошо росло это растение.

Это растение будет особенно привлекательно по краям клумбы, в садовом ящике, а также на каменистой почве и на земляной насыпи.

Он принимает радостные визиты наших друзей пчел и выгодно сочетается с колокольчиком и Aubretia.

Так же, как Iberis, иногда называют «серебряной корзиной» за обильное белое цветение.

Wall Rock Cress Семена цветов - Arabis - многолетнее почвопокровное растение

Arabis Snowcap Seed
Wall Rock Cress (Arabis Alpina Snow Peak) - Семена Arabis дают цветение ранней весной и не требуют особого ухода за почвенным покровом.Он морозоустойчив в зоне 4, хотя в самых холодных регионах ему потребуется защита корней от зимней мульчи. Почвопокровные растения каменного кресса, возможно, необходимо заменять каждые 3-4 года, или его можно обновить, выкопав и разделив растения. Arabis Alpina обладает сладким ароматом и привлекает пчел.
Кресс-салат Многолетний почвопокровный хорошо приживается из почвопокровных семян. Хорошо работает как почвопокровник для склонов. После укоренения он довольно устойчив к засухе.

Используйте каменный кресс на выступе камня или каменной стене. По мере созревания и растекания он будет струиться по камням. Rock Cress имеет привлекательные серебристо-зеленые вечнозеленые листья, которые обнимают землю, около 6-8 дюймов в высоту, иногда подпрыгивая до 10 дюймов. В климате с мягкой зимой листья этого цветущего почвопокровного растения сохраняют свой внешний вид до зимы. Обрежьте растение Arabis Alpina после цветения, чтобы оно оставалось аккуратным.

Сезон: Многолетник
Зоны USDA: 4 - 9
Высота: 4 дюйма
Ширина: 12 - 23 дюйма
Сезон цветения: С середины весны до начала лета
Цвет цветения: Белый
Скорость роста: Умеренная
Окружающая среда: от полного солнца до частичного оттенок
Устойчивость к оленям: Да
Указания по посадке
Температура: 68F
Среднее время прорастания: 14 - 21 день
Требуется свет: Да
Глубина: Семена должны быть покрыты тонким слоем
Тип почвы: Хорошо дренированная, pH 6.5 - 7,5
Норма высева: примерно 5000 семян на площади 100 квадратных футов
Влажность: Сохраняйте семена влажными до прорастания

Материалы: семена, цветы, семена цветов, многолетники, семена обриеты, каскадные семена красных цветов, устойчивые к оленям, рок-кресс, между каменные плиты, вдоль дорожек, сухие берега, почвопокровные, многолетние растения превосходного качества

Гравийные и каменные сады

Абелия

Abies - Firs

Абутилон

Акация

Акант - Медвежьи штаны

Acer - Клены

Ахиллея - Тысячелистник

Aconitum - Monkshoods

Акорус - Сладкие флаги

Актея - Банберри

Актинидия - Киви

Адиантум - Девичьи папоротники

Эониум

Эскулус

Агапантус - Африканские лилии

Агастах - Иссопс

Агавы

Агератум - Floss Flowers

Аджуга - Ковровые жучки

Альбиция - Mimosas

Алча - Холлихокс

Алхемилла - Дамская мантия

Лук

Алоказия - Слоновьи уши

Алоэ

Альстромерия - Перуанские лилии

Амарант - Amaranths

Амеланшер - Сервисберри

Амсония - Блюстар

Анафалис - Жемчужный вечный

Анемоны - Ветряные цветы

Ангелония - Летние львиные зевы

Анигозантос - Лапы кенгуру

Anthemis

Антрискус

Абрикосы

Аквилегия

Араукария - Деревья-пазлы с обезьянами

Земляничное дерево

Арктотис - Африканские ромашки

Arisaema - Джек на кафедре

Армерия - Сберегательный фонд

Черноплодная рябина - Черноплодная рябина

Полынь

Арум

Арункус - Козьи бороды

Asarum - дикие имбирь

Асклепиас

Асплениум - Папоротники

Астры

Астильбы

Астрантия - Мастерица

Атириум - Леди Папоротник

Азалии - Рододендроны

Бамбук

Баптизия - Ложный индиго

Бегонии

Берберис - Барбарис

Бергения

Betula - Береза ​​

Бугенвиллея

Бругмансия - Трубы ангела

Бруннера - Сибирский Буглосс

Буддлея - Куст бабочки

Самшит - Самшит

Каладиум - Крылья ангела

Calamagrostis - Тростниковая трава

Калибрахоа

Калликарпа - Beautyberries

Callistemon - Щетки для бутылочек

Каллуна - Вереск

Кальта - Бархатцы болотные

Каликант - Сладости

Камассия - Камас

Камелии

Колокольчик - Колокольчики

Campsis - Trumpet Vines

Канна - Канна Лилии

Осока - Осока

Кария - Гикорис

Кариоптерис - Синяя Борода

Castanea - Каштаны

Катальпа

Цеанот - Сирень Калифорния

Cedrus - Кедры

Центавр - Васильки

Ceratostigma - Плумбагос

Cercis - Редбудс

Chaenomeles - Айва цветущая

Chamaecyparis - Кипарисовик ложный

Chelone - черепаховые

Вишня

Химонантус - Wintersweets

Хионодокса - Снежная слава

Чойся - мексиканские апельсины

Хризантемы

Цирсиум - Чертополох

Ладанник - Рок Роуз

Цитрус

Клематис

Клеоме - Цветы паука

Клеродендрум

Клетра

Кливия

Колхикум - Осенние крокусы

Колоказия - Таро

Convallaria - Ландыш

Вьюнок - Вьюнок

Кордилайн

Кореопсис

Cornus - Кизил

Коридалис - Копытник

Корилопсис - Winterhazels

Космос

Котин - Дымовые деревья

Кизильник

Крассула

Боярышники - Боярышники

Кринум

Крокосмия

Крокус

Купея

Купресс - Кипарисы

Цикламен

Cyperus

Cypripedium - Лэдди Тапочки

Цитис - Метлы

Георгины

Дасилирион

Delosperma - Ледяные растения

Дельфиниумы

Deutzia

Диантус

Дицентра - Кровоточащие сердца

Dictamnus - Газовые заводы

Dietes

Наперстянка - Foxgloves

Диоспирос - Хурма

Диспорум - Колокольчики фей

Додекатеон - Падающие звезды

Драцена

Дриоптерис - Папоротники

Эхеверия

Эхинацея - Coneflowers

Эхинопс - Глобус Чертополох

Эджвортия - Paperbush

Энкиантус

Эпимедиум - Пустынник

Эрантис - Зимние акониты

Эремурус - Лилии лисохвост

Эрика и Каллуна

Эригерон - Флибейнс

Эрингиум - Морские Холли

Эризимум - Wallflowers

Erythronium - Фиалки для собачьих зубов

Эвкалипт

Eucomis - Ананасовые лилии

Бересклет

Евпаторий - Сорняки Джо-Пай

Молочай - Молочай

Fagus - Бук

Festuca - Fescues

Фикус

Форзиция

Фотергилла

Фрагария - Клубника

Fraxinus - Ясень

Фрезия

Фритиллярия

Пурпурный

Гайлардия - Одеяло цветы

Галантус - Подснежники

Гардения

Гаура

Газания

Gentiana - горечавки

Герань - Журавли

Герберы - Gerbera Daisies

Геум - Авенс

Гинкго - Девичьи деревья

Гладиолус - Меч Лилии

Глориоза

Гревиллея

Хаконечлоа - Хаконэ Трава

Гамамелис - Гамамелис -

Hebe - Кустарник Veronicas

Хедера - Плющ

Гедихиум - Имбирные лилии

Гелениум - Sneezeweeds

Гелиантемум - Каменные розы

Подсолнухи - Подсолнухи

Бессмертник

Гелиопсис - Подсолнухи Бычий глаз

Морозник - Морозник

Hemerocallis - Лилейники

Hepatica - Liverleaf

Гейчера - Коралловые колокола

Гейчерелла - Пенные колокольчики

Гибискус

Гиппеаструм - Амариллис

Хоста - Лилии подорожник

Humulus - Лозы хмеля

Гиацинтоид - Колокольчики

Гиацинт - Гиацинты

Гортензии

Гименокаллис

Зверобой - Зверобой

Илекс - Холлис

Иллиций - Анисовые деревья

Impatiens

Ифейон - Весенние звездные цветы

Ипомея - Ипомея

Ирис - Прочее

Ирис Энсата - Японские ирисы

Ирис Германика - Ирисы бородатые

Iris Hollandica - Голландские ирисы

Ирис ретикулата - Карликовые ирисы

Ирис Сибирика - Ирисы Сибирские

Ирис Спурия - Голубые ирисы

Жасмин - Жасмин

Юнк - Камни

Можжевельник - Можжевельники

Юстиция

Каланхоэ

Книпхофия - Red Hot Pokers

Лагерстремия - Crape Myrtles

Ламия - Мертвая крапива

Лантана

Ларикс - Лиственница

Lathyrus - душистый горошек

Лаванда - Лаванда

Лаватера - Мальва дерева

Леукадендрон - Кониные кусты

Левкантема - Маргаритки

Leucojum - Снежинки

Leucospermum - подушечки для иголок

Lewisia - горничные на скале

Лиатрис

Лигулярия

Лигуструм - Бирюза

Лилия - Лилии

Linum - Лен

Ликвидамбар - Сладкие камеди

Лириодендрон - Тюльпаны

Лириопе - Лили Терфс

Литодора - Громвельс

Лобелия

Лобулярия - Сладкий Алиссум

Lonicera - Жимолость

Лоропетал - Китайские цветы с бахромой

Люпин - Люпин

Лихнис - Кэмпионс

Ликорис - Паучьи лилии

Лисимахия - Вялый полосат

Магнолии

Магония

Майантема - Ландыш ландыша

Малус - Яблоки

Малус - яблоки

Мальва - Мальвы

Манга

Меконопсис - Гималайские маки

Мелалеука

Метасеквойя - Рассвет секвойи

Мимулус - цветы обезьяны

Мискантус - Девичьи травы

Монарда - Бальзамы пчелиные

Муса - Бананы

Мускари - Гиацинты виноградные

Myosotis - Незабудка

Нарцисс - Нарциссы

Непета - Кэтминтс

Нерин - Гернси Лилии

Нериум олеандр - олеандры

Чернушка

Кувшинки - Кувшинки

Осимум - Базилики

Энотера - Первоцветы - Солнечные капли

Офиопогон - Mondo Grass

Опунция

Ориганум - Орегано

Орнитогалум - Вифлеемская звезда

Османтус

Осмунда - Папоротники

Остеоспермум - Африканские ромашки

Oxalis

Пахисандра - Молочай

Paeonia - Пионы

Пальмы - Cycads

Panicum - Switch Grasses

Папавер - Маки

Парфеноцисс

Пассифлора - Цветы страсти

Персики

Пеларгония - Герань

Pennisetum - Фонтанные травы

Пенстемон - Бородатый язык

Перовския - Русские мудрецы

Персикария - Руноцветы

Петуния

Фацелия

Phalaris - Ленточные травы

Филадельфус - Мок-апельсин

Фломида

Флокс

Феникс - Финиковые пальмы

Формиум - лен

Фигелиус - мыс Фуксия

Физокарпус - Ninebark

Picea - Ель

Pieris

Сосна - сосна

Питтоспорум - Кохуху

Платикодон - Воздушные шары

Плумбаго

Плюмерия - Франжипанис

Сливы

Полемониум - Лестницы Иакова

Polygonatum - Печати Соломона

Полиподиум - Папоротники

Полистихум - Папоротники

Populus - Тополя

Portulaca

Potentilla - лапчатка

Примула - Примулы

Prunus - Цветущие деревья

Prunus - фруктовые деревья

Легочная болезнь - Медуницы

Пульсатилла - Pasque Flowers

Пуница - Гранаты

Пираканта - Огненные Шипы

Пайрус - Груши

Quercus - Дубы

Ранункулус - Лютики персидские

Rheum - Ревень

Рододендроны - Азалии

Rhus - Sumacs

Ребрышки - Смородина

Роза - Плетистые розы

Роза - Английские розы

Роза - Флорибунда Розес

Роза - Грандифлора Розес

Роза - Почвопокровные розы

Роза - Чайно-гибридные розы

Роза - Бродячие розы

Роза - Розы

Роза - Кустовые розы

Розмарин - Розмарин

Рубус - Брамблз

Рудбекяс

Руэллия

Salix - Ивы

Сальвия - Мудрецы

Самбук - Старейшина

Сангисорба - Бернетс

Сантолина

Саркококка - Коробки для сладостей

Саррацения - Кувшинные растения

Камнеломки - Камнеломки

Скабиоза - цветы-иголки

Сцилла - Сквиллы

Очиток - Очиток

Sempervivum - Куры и цыплята

Сенесио

Секвойя - секвойи

Секвойядендрон - секвойи

Силене - Кэмпионс

Сильфий

Сисиринхиум

Solanum

Соленостемон - Колеус

Солидаго - Золотарник

Рябина - Рябина

Спирея - Spirea

Stachys

Стахьюрус

Stipa - пернатые травы

Streptocarpus - Мыс Первоцветов

Стиракс

Симфорикарпос - Снежная ягода

Симфитум - Окопник

Сиринга - Сирень

Бархатцы - Бархатцы

Танацетум

Таксодиум - Кипарисы

Taxus - Тис

Teucrium - Germanders

Thalictrum - Meadow Rues

Туя

Тимус - Тимьян

Тиарелла - Пенные цветы

Тибучина

Тигридия - Цветок тигра

Тилия - Липы

Трахелоспермум - Жасмин

Традесканция - Паукообразные

Трициртис - Жабьи лилии

Триллиум - Уэйк Робинс

Трителей

Троллиус - Globe Flowers

Тропеол - Настурция

Tulipa - Тюльпаны

Ульмус - Вязы

Vaccinium - Черника

Вербаскум - Коровяк

Вербена

Вернония - Ironweeds

Вероника - Вероника

Вероникаструм - Корни Калвера

Калины

Винча - Барвинок

Альт - Фиалки

Витис - Виноградные лозы

Вейгела

Глициния

Юкка

Зантедеския - Калла Лилии

Зефирантес - Дождевые лилии

Цинния

Динамика корневой микробиоты многолетнего Arabis alpina зависит от времени пребывания в почве, но не зависит от времени цветения

Заметные сдвиги бактериального сообщества как у

A.alpina ризосфера и корневые компартменты

Растения выращивали в почвах, содержащих микробы, а также в корневых, ризосферных и почвенных компартментах, отобранных, как описано ранее (Рисунок 1; Bulgarelli et al., 2012; Schlaeppi et al., 2014). Вкратце, «почвенный отсек» относится к почве, собранной из незаращенных горшков, а «ризосферный отсек» определяет частицы почвы, плотно приставшие к корням, которые были собраны с помощью двух этапов промывки. Промытые корни дополнительно обрабатывали ультразвуком, чтобы уничтожить бактериальные эпифиты и обогатить корнеобитающие бактерии, обозначенные как «корневой отсек».Профили бактериального сообщества для каждого компартмента были созданы с помощью ПЦР-амплификации гена 16S рРНК путем нацеливания на область V5-V7 с использованием праймеров ПЦР 799F (Chelius and Triplett, 2001) и 1193R (Bodenhausen et al., 2013) с последующим секвенированием 454 или Illumina ( Таблица 1 и дополнительная информация). Мы сгенерировали в общей сложности 10 138 758 высококачественных последовательностей из 201 выборки (в среднем 50 342 и 2804–155 004 последовательностей на выборку, индивидуальные счетчики чтения представлены в дополнительных данных S1). Кроме того, 11 образцов эксперимента по «диверсификации», которые были секвенированы с 454, были повторно секвенированы с использованием методологии и протокола Illumina, чтобы оценить потенциальную методологическую погрешность (всего 533 801 считывание, таблица 1, дополнительный рисунок S1).Схема разделения между компартментами соответствовала методологиям 454 и Illumina (дополнительный рисунок S2), и мы не обнаружили заметных различий в таксономических присвоениях (дополнительный рисунок S3, подробности см. В дополнительных примечаниях). Это показывает, что две технологии секвенирования дают сопоставимые результаты. Для 201 образца, включенного в основной анализ этого исследования, мы определили 8969 OTU (≥97% сходства последовательностей последовательностей гена 16S рРНК), все принадлежащие царству бактерий.В ходе экспериментов тестируемый отсек (почва, ризосфера или корень) объяснял 18–36% вариаций сообществ между образцами (рис. 2а, табл. 2). На уровне филума в сообществах незасаженной почвы преобладали протеобактерии, актинобактерии и гемматимонадеты, относительная численность которых снижалась (дополнительные рисунки S4 – S7). По сравнению с незасаженной почвой, сообщества корневых микробов продемонстрировали значительно меньшее альфа-разнообразие (дополнительный рисунок S8, дополнительная таблица S1) и были в основном заселены Proteobacteria, Actinobacteria и Bacteroidetes во всех протестированных типах почвы.Такое совместное присутствие трех бактериальных типов хорошо согласуется с недавней оценкой микробиоты корней восьми видов цветковых растений (Hacquard et al., 2015). Взятые вместе, испытанные компартменты оказали заметное влияние на структуру сообщества, при этом ризосферное сообщество демонстрирует альфа-разнообразие, сопоставимое с незасаженной почвой, в то время как его таксономический состав имеет общие черты с почвой и ярко выраженной корневой микробиотой (рис. 2а, дополнительная информация). Рисунки S4 – S8).

Рисунок 2

Сдвиги бактериального сообщества в ризосфере и корневых компартментах A. alpina . ( a ) Неограниченная ординация, показывающая, что большая часть различий между всеми 201 образцами из 3 экспериментальных установок объясняется факторным отсеком (первая главная координатная ось) и типом почвы (вторая главная координатная ось) на основе расстояния Брея-Кертиса. метрическая. ( b ) Тернарный график, отображающий количество OTU, обогащенных почвой, ризосферой и корневыми компартментами, в 59 образцах эксперимента «тип почвы и окружающая среда» (SoilOTUs (черный), RhizoOTUs (коричневый), RootOTUs (зеленый), соответственно).Каждый кружок изображает одну отдельную OTU. Размер круга отражает относительную численность (RA). Положение каждого круга определяется вкладом указанных отсеков в RA. Число в скобках: обогащенные OTU на основе байесовского модерированного теста t ; P <0,05 (с поправкой на FDR). ( c ) Анализ основных ограниченных координат генотипов Paj, Gal60 и Gal5, выращенных на французской почве в теплице, с использованием несходства Брея-Кертиса и ограничения генотипом хозяина.В каждом случае процент вариации, объясняемый каждой осью, относится к доле общей вариации данных, объясняемой ограниченным фактором. CS-C, Кельнская почва, выращенная в контролируемых условиях окружающей среды; FS-C, французская почва, выращенная в контролируемых условиях окружающей среды; FS-N, французская почва, выращенная в естественных условиях окружающей среды.

Таблица 2 Определение движущих сил сборки бактериального сообщества с использованием CAP

Корневая микробиота

A. alpina зависит от типа почвы, но демонстрирует сходящуюся таксономическую структуру

Мы проанализировали 59 образцов из экспериментов «Тип почвы и окружающая среда» отдельно , что позволяет нам проанализировать относительный вклад факторов типа почвы, окружающей среды и генотипа хозяина на состав бактериального сообщества (Таблица 1).Мы сравнили таксономический состав бактериальных сообществ в корневом и ризосферном компартментах с почвенным биомом A. alpina , образец Gal60 в его естественной арктико-альпийской среде на Коль дю Галибье (Франция, рис. 1а). Кроме того, образец Gal60 был выращен на той же естественной почве, но в контролируемых условиях окружающей среды, вместе с образцами Gal5 и Paj, которые получены из другого участка в Коль дю Галибье и Кордильера Кантабрика в Испании, соответственно.В следующей подгруппе этого эксперимента образец Paj выращивали в контролируемых условиях окружающей среды в кельнской почве (рис. 1b, дополнительные таблицы S3 и S4).

Для количественной оценки вклада отдельных факторов в наблюдаемую вариацию профилей сообществ мы использовали Брея – Кертиса (с учетом численности OTU, но не филогенетических расстояний), невзвешенного (с учетом филогенетических расстояний, но не численности) и взвешенного (с учетом численности OTU и филогенетические расстояния). Метрики расстояния UniFrac как оценки β-разнообразия (межвыборочного разнообразия) (Lozupone and Knight, 2005).Ограниченный канонический анализ основных координат (CAP) с последующим дисперсионным анализом на основе перестановок (PERMANOVA, таблица 2, рисунок 2c, дополнительный рисунок S9) показал, что факторный тип почвы объясняет 11–15% наблюдаемой вариации, за которой следует окружающая среда. (8–11%) и генотип хозяина (5–12%). Как тип почвы, так и окружающая среда существенно повлияли на состав сообщества, и мы не обнаружили существенного взаимодействия между типом почвы и переменными окружающей среды (дополнительный рисунок S9a). Примечательно, что генотип хозяина повлиял на состав сообщества с более высокой значимостью при использовании взвешенного по сравнению с невзвешенным UniFrac, что позволяет предположить, что генотип хозяина преимущественно действует на многочисленных членов сообщества.Во время сбора урожая образец Gal5 цвел, в то время как Gal60 и Paj находились на вегетативной стадии (рис. 1b). Поскольку только Paj требует обработки яровизацией для цветения (Gal5 и Gal60 не нуждаются), различия в стадиях развития могут потенциально искажать наблюдаемые эффекты, зависимые от генотипа хозяина (см. Ниже). Кроме того, три генотипа выращивались только на одном типе почвы; следовательно, мы не можем делать выводы о потенциальных средо-специфических адаптациях отдельных генотипов.Влияние типа почвы на профили сообществ было очевидно на самом высоком таксономическом уровне. Например, дифференциальное обогащение типов Actinobacteria и Firmicutes было обнаружено во французских и кельнских почвах (дополнительная таблица S5 и дополнительный рисунок S4). Кроме того, различия бактериального почвенного биома в ранге филума, зависящие от типа почвы, постепенно сходились к более независимым от типа почвы профилям сообществ в ризосфере и корневых компартментах (дополнительная таблица S5), что указывает на то, что корни представляют собой нишу для сборки стабильной бактериальной консорциум, несмотря на контрастные типы почв и сред.

Затем мы количественно определили количество OTU, которые были обогащены в компартменте по типам почвы и средам (дополнительная информация; Bulgarelli et al., 2012). Мы называем ОТЕ, значительно обогащенные почвой, ризосферой и корневыми компартментами, как SoilOTU, RhizoOTU и RootOTU соответственно. Из общего числа 1676 OTU, обогащенные компартментами OTU постепенно уменьшались с 713 SoilOTU до 365 RhizoOTU и 135 RootOTU, а остальные 463 OTU распределялись между компартментами (рис. 2b).Примерно 30% RootOTU приходятся на все протестированные типы почв и условия окружающей среды (дополнительный рисунок S10). Взятые вместе, этот анализ показывает, что корня A. alpina вмещают таксономически конгруэнтное бактериальное сообщество в контрастных средах и производят заметный ризосферный эффект, о чем свидетельствует идентификация 365 RhizoOTUs.

Микробиота корней

A. alpina зависит от времени пребывания в почве и не зависит от времени цветения

Для оценки потенциальных изменений A.alpina состав микробиоты, связанной с корнями и ризосферой, с течением времени, образцов A. alpina были собраны через 6, 12 и 28 недель после посева в кельнскую почву в контролируемых условиях окружающей среды (таблица 1, дополнительная информация). В контексте этого «временного» эксперимента мы также исследовали, влияет ли стадия развития хозяина (отсутствие цветения и цветение) на структуру бактериального сообщества. Мы посадили WT A. alpina , образец Paj вместе с вечно цветущим мутантом pep1 (Wang et al., 2009). Этот мутант начал цвести через 12 недель, тогда как растения WT Paj оставались на вегетативной стадии до конца эксперимента.

В рамках этой экспериментальной установки момент времени фактора объяснил 7–12% наблюдаемой вариации (таблица 2, рисунок 3a). Рассматривая взаимодействие между временной точкой и компартментом, мы обнаружили сильное взаимодействие между этими двумя факторами, что объясняет 11% дисперсии данных (дополнительный рисунок S9b). Интересно, что только профили корневых и ризосферных сообществ были затронуты с течением времени, в то время как первоначальное бактериальное сообщество, присутствующее в незасаженной почве, оставалось в основном стабильным в течение испытанного периода времени от 6 до 28 недель для использованных партий почвы (Рисунок 3, Дополнительный Рисунок S5).Стабильность образцов почвы с течением времени была очевидна, поскольку эти образцы не разделялись в пределах PCoA, и большинство SoilOTU оставались в центре тройного участка, сообщая об их равной численности во все тестируемые моменты времени. Наблюдаемое сильное влияние времени пребывания растений в почве на бактериальные корневые и ризосферные сообщества проявлялось в высоком таксономическом ранге, например, по увеличению относительной численности Proteobacteria и уменьшению Bacteroidetes в корнях с течением времени (дополнительный рисунок S5 и дополнительный рисунок). Таблица S6).Чтобы идентифицировать OTU, которые объясняют эти зависящие от времени изменения, мы сначала определили все SoilOTU (745), RhizoOTU (271) и RootOTU (200). Около 62% RhizoOTU и 54% RootOTU значительно изменились в относительной численности с течением времени, тогда как это имело место только для ~ 10% SoilOTU (Рисунки 3b – d). Более тщательное изучение показало, что изменения в профилях ризосферы и корневой микробиоты характеризовались постоянным увеличением общего количества Rhizo- и RootOTU с течением времени (Рисунки 3c и d).Примечательно, что, несмотря на резкие различия в росте растений, мы не обнаружили значительных изменений между микробиотой корней и ризосферы WT и мутантных растений pep1 (Таблица 2, Рисунок 4). Ни один из Root- или RhizoOTU не накапливался по-разному в 6- или 12-недельных растениях WT и pep1 , когда 12-недельные растения pep1 цвели (фигуры 4d и e). Одиночный малонаселенный OTU (OTU927, порядок Myxococcales) был обогащен 28-недельными растениями WT, когда pep1 растений цвели, а растения WT оставались в вегетативной фазе (фиг.4f).Кроме того, мы обнаружили стабильное содержание питательных веществ и параметры почвы в незаращенной почве по сравнению с образцами почвы, взятыми из горшков, содержащих 28-недельные растения (дополнительные таблицы S3 и S4). Таким образом, наши результаты показывают заметные изменения, зависящие от времени пребывания A. alpina , ассоциированных с корнями и ризосферой бактериальных консорциумов, но стабильность корневой микробиоты в отношении начала и непрерывного цветения A. alpina и сопутствующих резких изменений. изменение роста растений.

Рисунок 3

Бактериальные сообщества, ассоциированные с корнями A. alpina , зависят от времени пребывания в почве. ( a ) Анализ основных координат образцов из эксперимента «временной ход» (106 образцов) с ограничением для временной точки фактора для почвы, ризосферы и корневых компартментов на 6, 12 и 28 неделях, соответственно. Процент отклонения, объясняемый каждой осью, относится к доле общей дисперсии данных, объясняемой ограниченным фактором. ( b - d ) OTU, обогащенные почвой, ризосферой и корнями (RootOTU, RhizoOTU, SoilOTU), включая OTU, наблюдаемые во всех тестируемых временных точках, и OTU, специфичные для отдельных временных точек.Зависящие от точки времени SoilOTU ( b ), RhizoOTU ( c ) и RootOTU ( d ). На график наносится среднее значение образцов почвы ( b ), ризосферы ( c ) или корня ( d ) в каждый момент времени. Число в скобках: общее количество OTU, обогащенных в соответствующем отсеке или в момент времени. Обогащенные OTU основаны на байесовском модерированном тесте t ; P <0,05 (с поправкой на FDR).

Рисунок 4

Корневая микробиота A. alpina не зависит от времени цветения.( a - c ) Морфология роста мутантных растений A. alpina дикого типа (Paj) и pep1 в ходе эксперимента «временной ход». ( d - f ) Трехкомпонентные графики OTU, обогащенных в эксперименте «временная зависимость», в почвенных и корневых компартментах мутантных растений A. alpina дикого типа (Paj) и pep1 через 6 недель ( a , d ), 12 недель ( b , e ) и 28 недель ( c , f ).Каждый кружок изображает одну отдельную OTU. Размер круга отражает относительную численность (RA). Положение каждого круга определяется вкладом указанных отсеков в RA. Число в скобках: общее количество OTU, обогащенных в соответствующей линии растений. OTU, обогащенные двумя линиями растений, основаны на тесте с замедлением по Байесу; P <0,05 (с поправкой на FDR).

Состав корневой микробиоты многолетника

A. alpina аналогичен по сравнению с однолетником A.thaliana и C. hirsuta

Затем мы посадили многолетник A. alpina бок о бок с однолетниками C. hirsuta и A. thaliana в почву Кельна в течение 6 недель, чтобы изучить потенциальную диверсификацию соответствующих микробиота корней (таблица 1, дополнительные рисунки S11a и b и дополнительная информация). Мы нашли доказательства профилей микробиоты корней, специфичных для конкретных видов хозяев, в которых виды-хозяева-факторы объясняли 7–10% наблюдаемых вариаций (Таблица 2).PCoA, ограниченный видами-хозяевами, показал, что образцы из корней A. alpina тесно сгруппированы вместе с образцами A. thaliana , хотя эти виды растений разошлись примерно 45 млн лет назад (Рисунок 5, дополнительный рисунок S11a; Beilstein et al., 2010). Образцы корней C. hirsuta сгруппированы отдельно от двух бывших хозяев, хотя A. alpina отклонились от C. hirsuta всего ~ 10 млн лет назад (рис. 5a). Таким образом, для тестируемых видов растений время дивергенции хозяев оказывается несовместимым с диверсификацией корневой микробиоты.Влияние видов-хозяев на бактериальные корневые сообщества было обнаружено на уровне филума по значительному снижению относительной численности Bacteroidetes в образцах корней A. alpina (дополнительный рисунок S7a). Кроме того, значительные различия были обнаружены для одного, трех и пяти семейств бактерий в A. thaliana , C. hirsuta и A. alpina , соответственно (дополнительный рисунок S7b, дополнительная таблица S7). Каждый тестируемый вид-хозяин был также обогащен несколькими типичными для вида OTU, которые демонстрировали количественные различия в относительной численности (обозначенные At OTU, Ch OTU и Aa OTU; Рисунок 5b).Тем не менее, большинство RootOTU (62) аналогичным образом были обнаружены в корнях всех трех видов хозяев (рис. 5b). Кроме того, в общей сложности 18 RootOTU были значительно обогащены корнями всех 3 видов растений в тестируемых партиях почвы (рисунок 5c, дополнительный рисунок S12a). Эти общие OTU были едва обнаружены в незаращенной почве и вместе составляли почти 50% консорциумов, связанных с корнями (дополнительный рисунок S12b). Общие OTU принадлежали 3 типам, из которых 12 OTU были назначены Proteobacteria, а по 3 - Actinobacteria и Bacteroidetes (рис. 5c).Таким образом, мы обнаружили несколько OTU, характерных для вида-хозяина, в то время как большая часть микробиоты корня была общей между тестируемыми видами-хозяевами.

Рисунок 5

Бактериальная микробиота корней A. alpina аналогична по сравнению с A. thaliana и Cardamine hirsuta . ( a ) Анализ основных координат с ограничениями (PCoA) на основе расстояний Брея – Кертиса на 36 образцах эксперимента «диверсификация», ограниченных группами образцов.( b ) OTU, обогащенные корнями A. alpina , C. hirsuta и A. thaliana . Черным цветом обозначены обогащенные корнем OTU (RootOTU). Все обогащенные OTU основаны на байесовском тесте t , P <0,05 (с поправкой на FDR). Число в скобках: общее количество OTU, обогащенных соответствующими видами растений. ( c ) Круговая диаграмма, показывающая семейное распределение 18 общих OTU на основе достоверной достоверной разницы в параметрах Тьюки, а также байесовской и непараметрической статистики Манна-Уитни.

Amazon.com: 50+ Семян цветов Arabis Caucasica Snow Cap / Каменный кресс / Многолетник / Растет на плохой почве, даже в твердой глине: сад и открытый грунт


В настоящее время недоступен.
Мы не знаем, когда и появится ли этот товар в наличии.
Марка Уникальные семена Шерил
Тип растительного или животного продукта Цветы
Тип почвы Глинистая почва

  • Убедитесь, что это подходит введя номер вашей модели.
  • Многолетние зоны 4-9
  • Свежие семена этого года
  • 4 дюйма в высоту
  • Крепкое растение, которое легко вырастить из семян / не разборчиво к типу почвы
  • Полное солнце или полутень

PERPETUAL FLOWERING2 координирует реакцию яровизации и многолетнее цветение Arabis alpina | Журнал экспериментальной ботаники

Абстрактные

Цветочный репрессор APETALA2 (AP2) у Arabidopsis регулирует цветение через возрастной путь.Ортолог AP2 у альпийского многолетника Arabis alpina , PERPETUAL FLOWERING 2 ( PEP2 ), как ранее сообщалось, контролирует цветение посредством пути яровизации посредством усиления экспрессии другого репрессора цветков PERPETUAL FLOWERING 1 ( PEP1 ), ортолог Arabidopsis FLOWERING LOCUS C ( FLC ). Однако PEP2 также регулирует цветение независимо от PEP1. Чтобы охарактеризовать функцию PEP2 , мы проанализировали транскриптомы мутантов pep2 и pep1 .Большинство дифференциально экспрессируемых генов было обнаружено между pep2 и диким типом или между pep2 и pep1 , что подчеркивает важность роли PEP2 , которая не зависит от PEP1 . Здесь мы демонстрируем, что активность PEP2 предотвращает повышающую регуляцию A. alpina генов идентичности цветочной меристемы FRUITFUL ( AaFUL ), LEAFY ( AaLFY ) и APETALA1 ( AaAP1). ), обеспечивая цветочную приверженность во время яровизации.Молодые проростки pep2 реагируют на яровизацию, подтверждая, что PEP2 регулирует возрастную реакцию на яровизацию независимо от PEP1. Основная роль PEP2 через PEP1 -зависимый путь имеет место после яровизации, когда он способствует активации PEP1 как в верхушке главного побега, так и в подмышечных ветвях. Эти множественные роли PEP2 в реакции яровизации вносят вклад в жизненный цикл A. alpina .

Введение

Адаптация растения к окружающей среде требует изменения признаков развития, среди которых время цветения является ключевым для обеспечения успешного производства потомства. В альпийских местообитаниях, в которых выживаемость молоди очень низкая, в основном преобладают многолетние виды (Billings and Mooney, 1968). В общем, привычка к многолетнему росту зависит от различного поведения меристем на одном и том же растении, так что одни останутся вегетативными, а другие начнут цветение (Amasino, 2009; Lazaro et al., 2018). Основным признаком окружающей среды, который способствует цветению у альпийских видов, является длительное воздействие холода - процесс, называемый яровизацией. Альпийская среда характеризуется коротким вегетационным периодом и длительными периодами снежного покрова. Таким образом, для обеспечения репродуктивного успеха альпийские растения закладывают цветочные почки в ответ на продолжительный холод за несколько месяцев или лет до цветения (Diggle, 1997; Meloche and Diggle, 2001). Однако длительные холода не всегда приводят к цветению.Это особенно верно для многолетних видов, так как большинство из них имеют длительную ювенильную фазу и не способны к цветению в молодом возрасте (Bergonzi and Albani, 2011).

Молекулярные механизмы, регулирующие цветение в ответ на яровизацию или возраст растения, в основном изучались на однолетнем модельном растении Arabidopsis thaliana . Фактор транскрипции MADS box FLOWERING LOCUS C (FLC) является основным регулятором цветения в ответ на яровизацию (Michaels and Amasino, 1999; Sheldon et al., 2000). FLC транскрипционно регулирует гены цветочных интеграторов, такие как SUPPRESSOR OF OVEREXPRESSION OF CONSTANS1 ( SOC1 ), и гены, участвующие в возрастном пути, что предполагает взаимодействие между этими двумя путями (Deng et al. , 2011; Mateos et al. др. , 2017). Сравнительные исследования арабидопсиса и альпийского многолетника Arabis alpina показали, что ортолог FLC у A. alpina , PERPETUAL FLOWERING1 ( PEP1 ) также контролирует цветение в ответ на яровизацию.Кроме того, PEP1 способствует многолетнему росту, подавляя цветение в подмножестве пазушных меристем после яровизации (Wang et al. , 2009; Lazaro et al. , 2018). Цветочные почки у A. alpina образуются при длительном воздействии яровизационных условий. Продолжительность яровизации определяет реактивацию PEP1 и в соцветии. После недостаточной яровизации мРНК PEP1 реактивируется, что приводит к появлению фенотипов реверсии цветков, таких как прицветники и ветви вегетативного соцветия (Lazaro et al., 2018). В подмышечных ветвях продолжительность яровизации не влияет на экспрессию PEP1 , а транскрипт PEP1 является высоким независимо от продолжительности яровизации (Lazaro et al. , 2018). Судьба этих подмышечных ветвей определяется комбинированным действием возрастного пути и PEP1 (Wang et al. , 2011; Park et al. , 2017).

У Arabidopsis возрастной путь регулируется двумя miRNA и их мишенями.В молодом возрасте высокие уровни miRNA 156 (miR156) препятствуют цветению. По мере того как растения стареют, накопление miR156 постепенно снижается, тогда как уровни miR172 следуют противоположному паттерну и постепенно увеличиваются во время развития (Wu et al. , 2009). Биологическая функция miR156 осуществляется его мишенями, которые кодируют членов семейства транскрипционных факторов SQUAMOSA PROMOTER BINDING PROTEIN-LIKEs (SPL) (Schwab et al. , 2005; Wu and Poethig, 2006; Wu et al. , 2009; Xu et al., 2016). Исходя из этого, SPL9 и SPL15, как сообщается, активируют транскрипцию miRNA172b , которая, в свою очередь, подавляет экспрессию небольшого подсемейства APETALA2-подобных факторов транскрипции с помощью механизма трансляции (Aukerman and Sakai, 2003; Chen, 2004; Mathieu и др., , 2009; Wu и др., , 2009; Hyun и др., , 2016). Это подсемейство включает шесть членов: AP2, ЦЕЛЬ РАННЕЙ АКТИВАЦИИ, ПОМЕЩЕННЫЙ от 1 до 3 (TOE1 – TOE3), SCHLAFMUTZE (SMZ) и SCHNARCHZAPFEN (SNZ) (Aukerman and Sakai, 2003; Schmid et al., 2003 г .; Mathieu et al. , 2009 г .; Янт и др. , 2010 г.). Arabis alpina имеет ярко выраженную ювенильную фазу, и образец Pajares должен расти не менее 5 недель в течение длинных дней (LD), прежде чем он сможет зацвести в ответ на яровизацию (Wang et al. , 2011; Bergonzi ). и др. , 2013). Роль miR156 сохраняется в A. alpina , поскольку линии с повышенной экспрессией miR156b блокируют цветение в ответ на яровизацию, тогда как линии мимикрии (MIM156), используемые для снижения активности miRNA, цветут при яровизации в возрасте 3 недель (Bergonzi et al., 2013). Однако комплементарное временное накопление miR156 и miR172 во время развития не связано в A. alpina (Bergonzi et al. , 2013). Подобно A. thaliana , накопление miR156 снижается в верхушке побега растений A. alpina , которые стареют и приобретают способность цвести в течение долгих дней, но экспрессия miR172 низкая (Bergonzi et al. , 2013). Чтобы наступило цветение и наблюдали повышение уровня miR172 на верхушке побега, необходима яровизация (Bergonzi et al., 2013). Однако яровизация эффективна только для зрелых (старых) растений, но не для ювенильных (молодых) растений, которые все еще имеют высокие уровни miR156 (Bergonzi et al. , 2013). Начало цветения во время холода у зрелых растений коррелирует с постепенным увеличением экспрессии генов идентификации органов цветка LEAFY ( AaLFY ), FRUITFUL ( AaFUL ) и APETALA1 ( AaAP1 ) ( Лазаро и др. , 2018).У многолетних растений, таких как яблоня и тополь, гомологи репрессора цветов TERMINAL FLOWER1 ( TFL1 ) регулируют ювенильный период. Трансгенные линии Malus domestica и Populus trichocarpa со сниженной экспрессией TFL1 имеют укороченную ювенильную фазу (Kotoda et al. , 2006; Mohamed et al. , 2010). Точно так же трансгенные растения A. alpina , в которых экспрессия AaTFL1 была снижена, могут цвести, даже если они яровизированы в молодом возрасте (Wang et al., 2011). Интересно, что эти линии могут зацвести после короткого (6 недель вместо 12 недель) периода яровизации. Эти результаты снова предполагают взаимодействие между возрастом и путями яровизации.

У Arabidopsis AP2 влияет на множество процессов развития, включая время цветения в зависимости от возраста и развитие цветков (Yant et al. , 2010). Сильные рецессивные мутантные аллели ap2 , такие как ap2-12 , рано зацветают как в LD, так и в короткие дни (SD) (Yant et al., 2010 г.). Сходным образом поражения в ортологе A. alpina AP2 , PEP2 , как сообщается, имеют фенотип времени цветения (Bergonzi et al. , 2013). pep2 мутанты цветут без яровизации и демонстрируют скомпрометированные многолетние признаки, подобные мутантным растениям pep1-1 (Bergonzi et al. , 2013). Эффект PEP2 на цветение сначала был связан с путем яровизации, поскольку он способствует экспрессии PEP1 (Bergonzi et al., 2013). В 2-недельных проростках pep2-1 уровни транскрипта PEP1 снижены по сравнению с растениями дикого типа (Bergonzi et al. , 2013). Однако PEP2 также играет независимую от PEP1 роль в регуляции времени цветения у A. alpina , поскольку цветение ускоряется у двойного мутанта pep1-1 pep2-1 по сравнению с одиночными мутантами (Bergonzi и др. , 2013).

Здесь мы показываем, что во время яровизации PEP2 репрессирует экспрессию генов идентичности меристемы цветков AaFUL , AaLFY и AaAP1 .Яровизация ускоряет цветение молодых растений pep2-1 , указывая на то, что PEP2 регулирует возрастную реакцию на яровизацию. Кроме того, мы сообщаем, что PEP1 -зависимая роль PEP2 имеет место после яровизации, потому что PEP2 требуется для активации PEP1 после возврата к теплым температурам. Участие PEP2 в двух различных аспектах реакции яровизации способствует многолетнему жизненному циклу A.Альпина .

Материалы и методы

Растительный материал, условия роста и фенотипирование

Генотипы A. alpina , использованные в этом исследовании, представляли собой Pajares (дикий тип), мутант pep2-1 и мутант pep1-1 . Образец Pajares был собран в горах Cordillera Cantábrica в Испании на высоте 1400 м (42 ° 59'32''N, 5 ° 45'32''W). Как мутант pep2-1 , так и мутант pep1-1 были выделены в результате мутагенеза EMS (этилметансульфонат) на фоне Pajares (Wang et al., 2009 г .; Бергонци и др. , 2013; Nordstrom et al ., 2013). Для фенотипического анализа растения выращивали в ЛД (16 часов света и 8 часов темноты) при температуре от 20 ° C днем ​​до 18 ° C ночью. Все яровизированные обработки проводили при 4 ° C в условиях стандартного отклонения (8 часов света и 16 часов темноты).

Время цветения молодых растений дикого типа, pep2-1 и pep1-1 оценивали как количество листьев при цветении и как количество дней до первого распустившегося цветка после яровизации.Растения выращивали в течение 3 недель в шкафах LD, яровизировали в течение 12 недель и возвращали в камеры LD после холода.

Характеристика времени цветения и признаков соцветия с различной продолжительностью яровизации у мутанта pep2-1 была проведена вместе с мутантом дикого типа и мутантом pep1-1 в ранее опубликованном эксперименте (рис. 6 в Lazaro et al. др. , 2018). Те же данные для контрольных растений дикого типа были использованы в Lazaro et al. (2018).Растения выращивали в течение 5 недель в теплице LD, яровизировали в течение 8, 12, 18 и 21 недель и возвращали в условия теплицы LD в тот же день. Время цветения измеряли, записывая дату раскрытия первого цветка после яровизации. Количество цветущих и вегетативных ветвей, а также количество прицветников в соцветии измеряли в конце цветения, за исключением растений, яровизированных в течение 8 недель, когда измерения проводились через 14 недель после яровизации.

Используемые здесь генотипы Arabidopsis были Columbia-0 (Col-0) дикого типа, ap2-7 и Col FRI San Feliu-2 (Sf-2) (Lee and Amasino, 1995).Мутант ap2-7 был скрещен с Col FRI Sf-2, и растения FRI ap2-7 были выделены из самоопыленного потомства F 2 , которое показало гомеотические дефекты ap2 и позднее цветение.

Для экспериментов по продолжительности цветения Arabidopsis общее количество листьев (розеточные и стеблевые листья) подсчитывали в момент раскрытия первого цветка.

Конструирование плазмид и трансформация растений

Чтобы получить трансгенное растение ap2-7 PEP2 –VENUS, a 7.Геномная область размером 4 т.п.н. PEP2 , охватывающая 4 т.п.н. выше начала трансляции и 1195 п.н. ниже остановки трансляции, была клонирована с помощью ПЦР (номер доступа NCBI LT669794.1). Впоследствии кодирующая последовательность VENUS: 9Ala была вставлена ​​либо после ATG, либо перед кодоном STOP PEP2 с использованием метода неполного удлинения праймера полимеразой (PIPE) (Klock et al. , 2008). Праймеры, используемые для клонирования PIPE, суммированы в дополнительной таблице S1 на сайте JXB онлайн.Сгенерированные фрагменты рекомбинантной ДНК были интегрированы в бинарный вектор pEarlyGate301 и трансформированы в Col с помощью опосредованного Agrobacterium цветочного дипа (Clough and Bent, 1998). Отобранные гомозиготные линии Col ProPEP2 :: VENUS :: PEP2 N6-1-3 и Col ProPEP2 :: PEP2 :: VENUS C2-1-9 скрещивались с ap2-7 .

Анализ экспрессии генов

Анализ экспрессии гена

проводили для генов дикого типа, pep1-1, и pep2-1. Для образцов pep2-1 гомозиготные растения были отобраны после генотипирования из сегрегационной популяции с использованием расщепленного амплифицированного полиморфного (CAP) маркера (прямой праймер, CAGCTGCACGGTATGTTTTTC; обратный праймер, GCTTTGTCATAAGCCCTGTG12) и Nde Nde.

Для анализа паттерна экспрессии PEP1 дикого типа и pep2-1 выращивали в течение 6 недель в LD и яровизировали в течение 12 недель. Верхушки основных побегов собирали перед яровизацией, во время яровизации и после яровизации (через 1, 2, 3 и 4 недели после возвращения растений к теплым температурам).Подмышечные вегетативные верхушки собирали с растений, растущих в ЛД через 2, 3 и 4 недели после яровизации. В каждом образце было объединено в среднем 10 вершин.

Экспрессия транскриптов PEP1 , AaSOC1 , AaFUL , AaTFL1 , AaLFY и AaAP1 у молодых и взрослых животных дикого типа, pep1-1 и pep2-1 был обнаружен в проростках, выращенных в течение 3 недель (молодые) или 6 недель (взрослые) в LD и яровизированных в течение 12 недель.Верхушки основных побегов собирали перед яровизацией и в холодное время года на 4, 8 и 12 неделях яровизации. Для анализа AaSPL5 , AaSPL9 , AaSPL15 и miR156 верхушка главного побега была собрана с 3-, 4- и 6-недельных растений дикого типа и pep2-1 растений, растущих в LD. . В каждом образце было объединено в среднем 14 вершин. Уровни экспрессии были нормализованы как для AaPP2A , так и для AaRAN3 , за исключением miR156, которая была нормализована до SnoR101.

Экспрессия транскрипта FLC была проанализирована в верхушке побега растений FRI и FRI ap2-7 , выращенных в течение 10 дней до яровизации, в течение 40 дней яровизации и 10 дней и 20 дней после возвращения к яровизации. Условия теплицы LD. Уровни экспрессии были нормализованы до UBC21 . Общую растительную РНК экстрагировали с помощью набора RNeasy Plant Mini (Qiagen), а обработку ДНКазой проводили с помощью набора Ambion, не содержащего ДНК (Invitrogen), для уменьшения любого загрязнения ДНК.Тотальную РНК (1,5 мкг) использовали для синтеза кДНК посредством обратной транскрипции с использованием обратной транскриптазы SuperScript II (Invitrogen) и oligo dT (18) в качестве праймера. Аликвоту 2 мкл разведения кДНК (1: 5) использовали в качестве матрицы для каждой количественной ПЦР (qPCR). Для анализа miR156 и SPL s общая РНК экстрагировалась с использованием miRNeasy ® Mini Kit (Qiagen), а обработка ДНКазой выполнялась с помощью набора Ambion DNA-Free (Invitrogen) для уменьшения загрязнения ДНК. Аликвоту РНК 200 нг использовали для обратной транскрипции miR156 и SnoR101 с использованием праймеров, специфичных для miR156 и SnoR101.кПЦР выполняли с использованием системы реального времени CFX96 и CFX384 (Bio-Rad) и системы детекции iQ SYBR Green Supermix. Каждая точка данных была получена из двух или трех независимых биологических повторов и показана как среднее ± стандартное отклонение.

Праймеры, используемые для кПЦР PEP1 , AaSOC1 , AaFUL , AaTFL1 , AaLFY , AaAP1 , AaSPL5 , AaSPL9 , AaSPL9 , AaSPL9 , AaSPA , miR156 и SnoR101 были описаны ранее (Wang et al., 2009, 2011; Bergonzi et al., 2013; Mateos et al. , 2017; Lazaro et al. , 2018). Праймеры, используемые для кПЦР для FLC и UBC21 , также были описаны в другом месте (Chechowski et al. , 2005; Crevillen et al. , 2013).

Статистический анализ

Статистический анализ проводился с использованием программного обеспечения R. Чтобы обнаружить значительные различия в экспрессии генов, мы установили коэффициент ложного обнаружения (FDR), равный 0.05 при проведении множественных попарных сравнений с использованием скорректированных по Бенджамини – Хохберга значений P . Процедуры со значительными различиями обозначаются буквами или звездочками. Для физиологического анализа pep2-1 мы провели несколько попарных тестов Бонферрони (α = 0,05) для выявления значительных различий между диким типом и pep2-1 . Здесь непараметрический тест не может быть проведен из-за связей, созданных во время присвоения ранга.

РНК-анализ

Для анализа дифференциальной экспрессии генов мы использовали метод секвенирования РНК (RNAseq) на верхушках 3-недельного дикого типа и мутантов pep2-1 и pep1-1 . pep2-1. гомозиготных растений генотипировали из сегрегационной популяции с использованием маркера CAP, описанного выше. РНК выделяли, как описано выше, и полную целостность РНК подтверждали на Agilent BioAnalyzer. Подготовка библиотеки и секвенирование были выполнены в Центре генома Макса Планка в Кельне, Германия (https://mpgc.mpipz.mpg.de/home/). RNAseq выполняли с тремя биологическими повторами на образец. Библиотеки готовили из 1 мг тотальной РНК с использованием набора TruSeq RNA (Illumina) и секвенировали односторонние чтения 100 пар оснований на HiSeq2500 (Illumina).Считывания из всех образцов были картированы на эталонном геноме A. alpina (Willing et al. , 2015) с использованием TopHat (Trapnell et al. , 2009) с параметрами по умолчанию. Впоследствии CuffDiff (Trapnell et al. , 2010) использовался для оценки уровня мРНК каждого гена путем вычисления фрагментов на килобазу модели экзона на миллион отображенных считываний (FPKM). Для расчета дифференциальной экспрессии генов среди образцов использовали значения FPKM. Log 2 -кратное изменение (L 2 FC) ≥1 для генов с повышенной регуляцией и L 2 FC ≤ –1 для генов с пониженной регуляцией, оба имеют значение q (скорректировано P - значение) ≤0.05, был использован для дальнейшего анализа.

Обогащение онтологии генов (GO)

было выполнено с помощью подключаемого модуля BiNGO (Maere et al. , 2005), реализованного в Cytoscape V3.5.1 (Cline et al. , 2007). Для определения обогащенных генов применялся гипергеометрический тест, а для ограничения количества ложноположительных результатов выполнялась коррекция FDR Бенджамини-Хохберга (Benjamini and Hochberg, 1995). FDR был установлен на 0,05.

Данные о секвенировании этого исследования были депонированы в Gene Expression Omnibus (GEO) под номером доступа GSE117977.Последовательности изучаемых генов можно найти в базах данных GenBank / EMBL под следующими номерами доступа: PEP2 (AALP_AA7G245300), кДНК PEP1 (FJ755930), кодирующая последовательность AaLFY (JF436956), кодирующая последовательность (JF436957), AaAP1 (KFK41337.1), кодирующая последовательность AaTFL1 (JF436953) и AaFUL (KFK27856.1).

Результаты

PEP2 влияет на экспрессию генов, участвующих во многих физиологических реакциях растений и ответах на развитие, включая цветение

Для обзора роли PEP2 в A.alpina мы провели анализ RNAseq. Мы сравнили транскриптомы верхушек 3-недельных мутантов pep2-1 и pep1-1 с диким типом (Pajares). Трехнедельные растения дикого типа и мутантные растения вегетативны и не претерпели перехода к цветению (Wang et al. , 2011; Bergonzi et al. , 2013; Park et al. , 2017; Lazaro и др. , 2018). Среди транскриптомов большинство дифференциально экспрессируемых генов было обнаружено в pep2-1 .В общей сложности 253 гена были активированы, а 223 гена были подавлены в pep2-1 по сравнению с диким типом (фиг. 1A, B; дополнительный набор данных S1). Напротив, только 47 генов были активированы, а 98 генов подавлены в pep1-1 по сравнению с диким типом (рис. 1A, B; дополнительный набор данных S2). На гены, по-разному экспрессируемые между pep1-1 и диким типом, влияет PEP1 , тогда как на гены, дифференциально экспрессируемые между pep2-1 и диким типом, влияет PEP2 через как PEP1, -зависимые, так и гены. PEP1 -независимый путь.Чтобы идентифицировать гены, на которые влияет PEP2 через PEP1 -независимый путь, мы сравнили транскриптомы pep2-1 с pep1-1 (рис. 1C, D; дополнительный набор данных S3). В общей сложности 504 гена были значительно активированы, а 251 ген был значительно подавлен в pep2-1 по сравнению с pep1-1 (фиг. 1C, D). Интересно, что количество дифференциально экспрессируемых генов, обнаруженных между pep2-1 и pep1-1 , было выше, чем количество обнаруженных при сравнении одиночных мутантов с диким типом.Анализ GO показал, что наиболее обогащенной категорией для активируемых генов в pep2-1 по сравнению с диким типом и в pep2-1 по сравнению с pep1-1 был биосинтез глюкозинолатов, которые участвуют в защите. против нападения травоядных и патогенов (дополнительный рисунок S1) (Keith and Mitchell-Olds, 2017). Перекрытие чрезмерно представленных категорий ГО в наборе генов, активируемых в pep2-1 по сравнению либо с диким типом, либо с мутантом pep1-1 , было очень высоким, чего и следовало ожидать, поскольку было больше генов. в pep2-1 активирована по сравнению с диким типом, чем в pep1-1 по сравнению с диким типом (рис.1А; Дополнительный рис. S1A, B). Среди обычно обогащенных категорий генов с пониженной регуляцией в pep2-1 мы обнаружили апоптоз и десумоилирование белка (дополнительный рисунок S1C, D).

Рис. 1.

Дифференциально экспрессируемые гены у мутантов pep2 и pep1 A. alpina . (A и B) Диаграмма Венна для значительно активированных (A) и подавленных (B) генов в pep2-1 по сравнению с диким типом (WT) и pep1-1 по сравнению с WT.(C и D) Диаграмма Венна для значительно активированных (C) и подавленных (D) генов в pep2-1 по сравнению с WT и в pep2-1 по сравнению с pep1-1. (E – G) Гены времени цветения по-разному экспрессируются в pep2-1 по сравнению с WT (E), pep1-1 по сравнению с WT (F) и pep2-1 по сравнению с pep1-1 (Г). Значения экспрессии основаны на RNAseq.

Рис. 1.

Дифференциально экспрессируемые гены в pep2, и pep1 A.alpina мутанты. (A и B) Диаграмма Венна для значительно активированных (A) и подавленных (B) генов в pep2-1 по сравнению с диким типом (WT) и pep1-1 по сравнению с WT. (C и D) Диаграмма Венна для значительно активированных (C) и подавленных (D) генов в pep2-1 по сравнению с WT и в pep2-1 по сравнению с pep1-1. (E – G) Гены времени цветения по-разному экспрессируются в pep2-1 по сравнению с WT (E), pep1-1 по сравнению с WT (F) и pep2-1 по сравнению с pep1-1 (Г).Значения экспрессии основаны на RNAseq.

Цветочные активаторы и репрессоры были идентифицированы среди дифференциально экспрессируемых генов в pep2-1 . Например, ортолог A. alpina для SOC1 ( AaSOC1 ) был активирован в pep2-1 по сравнению с диким типом (рис. 1E; дополнительный набор данных S1). Этот эффект PEP2 на AaSOC1 проявляется через PEP1 , поскольку AaSOC1 по-разному экспрессировался между pep1-1 и диким типом, но не в pep2-1 по сравнению с pep1-1 (рис.1F, G; Дополнительные наборы данных S2, S3; Mateos et al , 2017). Правила с AaSMZ с по PEP2 отличаются от правил с PEP1 . AaSMZ был активирован в pep2-1 по сравнению с диким типом и подавлен в pep1-1 по сравнению с диким типом (фиг. 1E, F; дополнительные наборы данных S1, S2). Напротив, AaSPL15 был активирован в мутанте pep1-1 по сравнению с диким типом, а не в pep2-1 по сравнению с диким типом, что указывает на то, что PEP2 не контролирует экспрессию AaSPL15 ( Инжир.1E, F; Дополнительные наборы данных S1, S2). Среди генов времени цветения, участвующих в PEP1 -независимой роли PEP2 , были цветочные репрессоры AaTFL1 и AGAMOUS-LIKE 19 ( AaAGL19 ). AaTFL1 подавлялся, когда мы сравнивали pep2-1 как с диким типом, так и с pep1-1 , предполагая, что эффект PEP2 на AaTFL1 не зависит от PEP1 (рис. 1E– G; Дополнительные наборы данных S1 – S3).Сходным образом транскрипты AGAMOUS-LIKE 19 ( AaAGL19 ) специфически подавлялись в мутанте pep2-1 (Fig. 1E-G; Supplementary Datasets S1-S3). Мы также обнаружили, что ортолог AaULP1c (убиквитин-подобная протеиназа), кодирующий протеазу SUMO, и CIS-CINNAMIC ACID-ENHANCED 1 ( AaZCE1 ) дифференциально специфично экспрессируется в pep2-1 (рис. 1C – E; дополнительные наборы данных S1, S2). Интересно, что как ULP1c , так и ZCE1 у Arabidopsis контролируют цветение посредством FLC .Мутации в ULP1c и его гомологе ULP1d у Arabidopsis вызывают фенотип раннего цветения, который, по крайней мере частично, может быть обусловлен понижающей регуляцией FLC (Conti et al. , 2008; Castro et al. ). , 2016). ZCE1 участвует в регуляции роста и развития растений с помощью цис -фенилпропаноидов, и было показано, что он контролирует время связывания посредством усиления экспрессии FLC (Guo et al. , 2011).

PEP2 может дополнять мутант Arabidopsis ap2

Как мутант pep2 в A. alpina , так и мутант ap2 у Arabidopsis демонстрируют раннее цветение и аналогичные дефекты цветков, включая отсутствие лепестков и трансформацию чашелистиков в плодолистики (Bowman et al. , 1991 ; Bergonzi et al., 2013; Nördstrom et al. , 2013). Чтобы проверить, имеют ли оба гена общие функции, мы экспрессировали PEP2 в мутантном фоне ap2-7 под контролем его собственного промотора.Мы слили геномную область PEP2 размером 7,4 т.п.н., охватывающую 4 т.п.н. выше начала трансляции и 1,2 т.п.н. ниже остановки трансляции, с флуоресцентным белком VENUS на N- или C-конце. Трансгенные линии были впервые получены на фоне Col. Гомозиготные линии, полученные для N-концевой VENUS (Col ProPEP2 :: VENUS :: PEP2 N6-1-3) и C-концевой VENUS (Col ProPEP2 :: PEP2 :: VENUS C2-1-9), были впоследствии перешел на ap2-7 . При выращивании в SD конструкции PEP2 дополняли фенотип раннего цветения мутанта ap2-7 (рис.2A – D). Более того, гомеотические дефекты мутанта ap2 были восстановлены с помощью PEP2 , что указывает на то, что ген A. alpina PEP2 контролирует время цветения и идентичность цветковых органов аналогично AP2 (рис. 2E – H). .

Рис. 2.

PEP2 может дополнять цветковый и цветочный фенотип мутанта Arabidopsis ap2-7 . (A и B) Фенотипы Col дикого типа, мутант ap2-7 , Col ProPEP2 :: VENUS :: PEP2 N6-1-3 и ap2-7 ProPEP2 :: VENUS :: PEP2 Линии N6-1-3, выращенные в SD (A), и количество цветущих листьев (B).(C и D) Col, мутант ap2-7 , Col ProPEP2 :: PEP2 :: VENUS C2-1-9 и ap2-7 ProPEP2 :: PEP2 :: VENUS C2-1- 9 линий, выращенных в SD (C) и количество цветущих листьев (D). (A и C) Фотографии всего растения были сделаны через 57 дней после прорастания (DAG). Масштабная линейка = 3 см. В (B) и (D) буквы обозначают значимые различия между генотипами, определенные путем множественных попарных сравнений с использованием скорректированных по Бенджамини – Хохберга значений P (значение a 0,05).Планки погрешностей указывают стандартное отклонение. (E и F) Соцветие Col дикого типа (E) ap2-7 (F), ap2-7 ProPEP2 :: VENUS :: PEP2 N6-1-3 (G) и ap2-7 ProPEP2: : PEP2 :: VENUS C2-1-9 (H) записано 73 DAG в SD.

Рис. 2.

PEP2 может дополнять цветущий и цветочный фенотип мутанта Arabidopsis ap2-7 . (A и B) Фенотипы Col дикого типа, мутант ap2-7 , Col ProPEP2 :: VENUS :: PEP2 N6-1-3 и ap2-7 ProPEP2 :: VENUS :: PEP2 Линии N6-1-3, выращенные в SD (A), и количество цветущих листьев (B).(C и D) Col, мутант ap2-7 , Col ProPEP2 :: PEP2 :: VENUS C2-1-9 и ap2-7 ProPEP2 :: PEP2 :: VENUS C2-1- 9 линий, выращенных в SD (C) и количество цветущих листьев (D). (A и C) Фотографии всего растения были сделаны через 57 дней после прорастания (DAG). Масштабная линейка = 3 см. В (B) и (D) буквы обозначают значимые различия между генотипами, определенные путем множественных попарных сравнений с использованием скорректированных по Бенджамини – Хохберга значений P (значение a 0,05).Планки погрешностей указывают стандартное отклонение. (E и F) Соцветие Col дикого типа (E) ap2-7 (F), ap2-7 ProPEP2 :: VENUS :: PEP2 N6-1-3 (G) и ap2-7 ProPEP2: : PEP2 :: VENUS C2-1-9 (H) записано 73 DAG в SD.

Чтобы проверить, сохраняется ли эффект PEP2 на экспрессию PEP1 в Arabidopsis для AP2 и FLC , мы объединили мутацию ap2-7 с сильным аллелем FRI из Сан-Фелиу- 2 (Sf-2), который усиливает экспрессию Col FLC .Хотя мутация ap2 ускоряла цветение на фоне FRI Sf-2, экспрессия FLC не изменялась в верхушках этих растений на разных стадиях развития (до, во время или после 40 дней яровизации) ( Дополнительный рис. S2). Эти результаты показывают, что, хотя роль AP2 и PEP2 в отношении регуляции времени цветения и идентичности цветковых органов сохраняется, AP2 не контролирует экспрессию FLC на фоне FRI Sf-2 (дополнительный рис.S2B).

PEP2 контролирует возрастную реакцию A. alpina на яровизацию

Затем мы исследовали, была ли PEP1 -независимая роль PEP2 аналогична роли AP2 у Arabidopsis и, следовательно, регулировала ли она цветение по возрастному пути. Сначала мы проанализировали накопление miR156 и уровень транскрипта A. alpina SPL5 , 9 и 15 ( AaSPL5, 9 и 15 ) в вершинах pep2-1 и проростки дикого типа, выращенные в течение 3, 4 и 6 недель в LD (дополнительный рис.S3). Накопление miR156 в верхушке побега снижалось у более старых проростков, но сходная картина наблюдалась у pep2-1 и дикого типа (дополнительный рисунок S3A). Уровни транскриптов AaSPL5 , 9 и 15 увеличиваются по мере старения растений (дополнительный рис. S3B – D). Для AaSPL5 и 15 мы не наблюдали значительных различий между pep2-1 и диким типом, тогда как уровни мРНК AaSPL9 различались между двумя генотипами только у 6-недельных проростков (дополнительный рис.S3B – D). Эти результаты согласуются с предыдущими исследованиями на Arabidopsis, демонстрирующими, что AP2 контролирует цветение по возрастному пути ниже генов miR156 и SPL . Поскольку ранее было показано, что возрастное влияние на цветение у A. alpina проявляется только после яровизации (Wang et al. , 2011; Bergonzi et al. , 2013), мы проверили, соответствует ли PEP2 играет возрастную роль у яровизированных растений. Для этого мы яровировали 3-недельные проростки дикого типа и pep2-1 в течение 12 недель и измерили время цветения после возвращения к теплым температурам.Мы также включили в этот эксперимент мутант pep1-1 , чтобы исключить PEP1 -зависимый эффект PEP2 на время цветения. Согласно предыдущим исследованиям, в этих условиях дикий тип не цвел после яровизации, а рос только вегетативно (рис. 3; Wang et al. , 2011; Bergonzi et al ., 2013). Интересно, что pep2-1 цвело, имея в среднем 18 листьев и 17 дней после яровизации, тогда как яровизированный pep1-1 цвел с 27 листьями, аналогично не яровизированным растениям pep1-1 , непрерывно выращиваемым в LD (рис.3; Дополнительный рис. S4; Wang et al. , 2009 г .; Bergonzi et al. , 2013). Эти данные позволяют предположить, что яровизация ускоряет цветение у молодых растений pep2-1 , но не у растений pep1-1 . Фенотип времени цветения у мутантов также отличается от фенотипа LDs, когда pep1-1 цветут раньше, чем pep2-1 (Bergonzi et al. , 2013). В целом, эти результаты подтверждают, что PEP2 регулирует зависимый от возраста ответ на яровизацию PEP1 -независимым образом.

Рис. 3.

PEP2 регулирует возрастную реакцию A. alpina на яровизацию. (A) Изображение 3-недельного дикого типа (WT), pep1-1 и pep2-1 , яровизированных в течение 12 недель с последующими 2 неделями в LD. Масштабная линейка = 5 см. (B) Время цветения показано как количество листьев при цветении 3-недельного WT, pep1-1 и pep2-1 , яровизированных в течение 12 недель. WT не цвести (NF).Звездочка означает значительную разницу в общем количестве листьев, определенном с помощью теста Стьюдента t (значение P <0,01). Планки погрешностей указывают стандартное отклонение.

Рис. 3.

PEP2 регулирует возрастную реакцию A. alpina на яровизацию. (A) Изображение 3-недельного дикого типа (WT), pep1-1 и pep2-1 , яровизированных в течение 12 недель с последующими 2 неделями в LD. Масштабная линейка = 5 см. (B) Время цветения показано как количество листьев при цветении 3-недельного WT, pep1-1 и pep2-1 , яровизированных в течение 12 недель.WT не цвести (NF). Звездочка означает значительную разницу в общем количестве листьев, определенном с помощью теста Стьюдента t (значение P <0,01). Планки погрешностей указывают стандартное отклонение.

Чтобы понять, как молодые растения pep2-1 ускоряют цветение в ответ на яровизацию, мы проанализировали экспрессию PEP1 , AaSOC1 , AaFUL , AaTFL1 , AaLFY и AaAP1 .Трехнедельные верхушки дикого типа pep2-1 и pep1-1 с главного побега собирали до и во время яровизации на 4, 8 и 12 неделях. В соответствии с предыдущими результатами, полученными на проростках, неяровизированные трехнедельные растения pep2-1 показали более низкие уровни мРНК PEP1 , чем у дикого типа (рис. 4A; Bergonzi et al. , 2013). Тем не менее, транскрипт PEP1 снижался аналогичным образом в pep2-1 и растениях дикого типа, а PEP1 заглушался через 4 недели на холоду (рис.4А). Эти данные свидетельствуют о том, что, несмотря на исходные различия в экспрессии PEP1 , отсутствие PEP2 не влияет на транскрипцию PEP1 в молодых верхушках во время яровизации. Экспрессия AaSOC1 постепенно повышалась во время яровизации, следуя той же схеме для трех генотипов (рис. 4B). Напротив, AaFUL , AaLFY и AaAP1 показали дифференциальное увеличение у дикого типа и мутантов через 8 и 12 недель яровизации (рис.4C, E, F). У молодых растений дикого типа уровни мРНК AaFUL , AaLFY и AaAP1 не повышались, что указывает на то, что цветение еще не началось (рис. 4C, E, F). Более того, мутант pep2-1 показал более высокие уровни AaLFY и AaAP1 , чем pep1-1 после 12 недель яровизации (фиг. 3, 4E, F). Интересно, что мутант pep2-1 также показал пониженную экспрессию AaTFL1 в конце обработки холодом по сравнению с pep1-1 (рис.4D). Взятые вместе, наши результаты показывают, что PEP2 активирует AaTFL1 и репрессирует AaFUL , AaLFY и AaAP1 в молодых вершинах во время яровизации (рис. 3). Эта роль PEP2 не зависит от PEP1 , учитывая, что растения pep1-1 , яровизированные в молодом возрасте, зацвели позже, чем pep2-1 , и что экспрессия PEP1 была снижена в такой же степени у растений дикого типа. и pep2-1 во время яровизации (фиг. 3, 4A).

Рис. 4.

PEP2 регулирует экспрессию AaFUL , AaTFL1 , AaLFY и AaAP1 во время яровизации. Относительная экспрессия PEP1 (A), AaSOC1 (B), AaFUL (C), AaTFL1 (D), AaLFY (E) и AaAP1 (F). Трехнедельные верхушки побегов дикого типа (WT) pep1-1 и pep2-1 собирали до и в течение 12 недель яровизации.Буквы обозначают значительные различия между WT, pep1-1 и pep2-1 в каждый момент времени, определяемый множественными попарными сравнениями с использованием скорректированных по Бенджамини – Хохберга значений P (α-значение 0,05). Графики без букв не показывают существенных различий. Планки погрешностей указывают стандартное отклонение.

Рис. 4.

PEP2 регулирует экспрессию AaFUL , AaTFL1 , AaLFY и AaAP1 во время яровизации.Относительная экспрессия PEP1 (A), AaSOC1 (B), AaFUL (C), AaTFL1 (D), AaLFY (E) и AaAP1 (F). Трехнедельные верхушки побегов дикого типа (WT) pep1-1 и pep2-1 собирали до и в течение 12 недель яровизации. Буквы обозначают значительные различия между WT, pep1-1 и pep2-1 в каждый момент времени, определяемый множественными попарными сравнениями с использованием скорректированных по Бенджамини-Хохберга значений P (α-значение 0.05). Графики без букв не показывают существенных различий. Планки погрешностей указывают стандартное отклонение.

Чтобы исследовать, сохраняется ли регуляция этих генов идентичности меристем цветков с помощью PEP2 у взрослых растений, мы проверили экспрессию AaFUL , AaLFY и AaAP1 во время яровизации. Шестинедельные растения дикого типа и растения pep2-1 были подвергнуты 12-недельному воздействию холода, и уровни мРНК AaLFY , AaAP1 и AaFUL были проанализированы в верхушке побега перед яровизацией и 1, Через 3, 5, 8 и 12 недель яровизации.Уровни мРНК AaFUL были выше у pep2-1 , чем у дикого типа уже после 8 недель яровизации (дополнительный рисунок S4A). Для экспрессии AaLFY и AaAP1 значительное увеличение наблюдалось у мутанта pep2-1 только в конце 12 недель холода (дополнительный рис. S4B, C). В целом, эти результаты предполагают, что PEP2 задерживает цветение за счет подавления AaFUL , AaLFY и AaAP1 в конце 12 недель яровизации, когда PEP1 уже подавлены в верхушках обоих молодых и взрослые растения.

PEP2 требуется для активации экспрессии PEP1 после яровизации

Чтобы проверить PEP1 -зависимую роль PEP2 , мы подвергли мутант pep2-1 и растения дикого типа разной продолжительности яровизации. Оба генотипа выращивали в течение 5 недель в LD, яровизировали в течение 8, 12, 18 и 21 недель и переносили обратно в тепличные условия LD (рис. 5A, B). Мутант pep2-1 показал сокращение количества дней до появления цветков по сравнению с диким типом при всех продолжительности холода (рис.5С). Кроме того, соцветия в pep2-1 показали снижение фенотипов реверсии цветков и усиление приверженности ветвей соцветий к цветению (рис. 5D-G). Эти результаты показывают, что PEP2 контролирует время цветения и архитектуру соцветий у A. alpina . Однако ответ pep2-1 все еще варьировался в зависимости от продолжительности яровизации, предполагая, что другие цветочные репрессоры могут вносить вклад в цветение в ответ на яровизацию.Кроме того, PEP2 требуется для поддержания пазушных отростков, которые расположены чуть ниже соцветия в вегетативном состоянии, поскольку все пазушные ветви мутанта pep2-1 участвуют в репродуктивном развитии (рис. 5; Bergonzi et al. , 2013).

Как было показано ранее для дикого типа, мРНК PEP1 активируется в апикальной меристеме побега главного побега после ненасыщающей яровизации (рис. 6; Wang et al. , 2009; Lazaro et al. al., 2018). Это нестабильное молчание мРНК PEP1 после холода было устранено у мутанта pep2-1 , что позволяет предположить, что PEP2 требуется для активации экспрессии PEP1 в апикальной меристеме побега после недостаточной яровизации (фиг. 6). Роль PEP2 в активации PEP1 после яровизации также наблюдается в подмышечных ветвях. Все пазушные ветви мутанта pep2-1 готовы к цветению (рис.5B) и показали очень низкую экспрессию PEP1 по сравнению с вегетативными ветвями дикого типа (фиг. 6). Эти результаты предполагают, что основной вклад PEP2 заключается в активации транскрипции PEP1 после яровизации как в апикальной меристеме побегов, так и в вегетативных подмышечных ветвях.

Рис. 5.

Мутантные растения pep2 зацветают раньше, чем растения дикого типа, и демонстрируют пониженные реверсивные фенотипы. (A) Растения дикого типа (WT), подвергнутые яровизации в течение нескольких периодов (8, 12, 18 и 21 неделя) с последующими 3 неделями в LD.(B) pep2-1 мутантные растения, подвергнутые яровизации в течение нескольких периодов (8, 12, 18 и 21 неделя) с последующими 3 неделями в LD. Масштабная линейка = 10 см. (C) Время до появления цветков растений WT и pep2-1 , подвергшихся разной продолжительности яровизации, измерялось как количество дней до появления первого распускающегося цветка. (D) Процент цветущих ветвей соцветий (FB) у WT и мутанта pep2-1 , подвергшихся 8, 12, 18 и 21 неделям яровизации в момент раскрытия последнего цветка в соцветии.(E) WT перевернутое соцветие у растений, яровизированных в течение 8 недель. (F) pep2-1 мутантное соцветие в растениях, яровизированных в течение 8 недель. Масштабная линейка = 2 см. (G) Количество прицветников в соцветии WT и мутанта pep2-1 , подвергшихся яровизации в течение 8, 12, 18 и 21 недель во время раскрытия последнего цветка в соцветии. Этот эксперимент был проведен вместе с мутантом pep1-1 в эксперименте, ранее опубликованном (рис. 6 в Lazaro et al., 2018). Данные для контроля WT в двух статьях аналогичны. Звездочки обозначают значительные различия между диким типом и мутантом pep2-1 в каждый момент времени, определенный с помощью множественных попарных тестов Бонферрони (α-значение 0,05). Планки погрешностей указывают стандартное отклонение.

Рис. 5.

Мутантные растения pep2 зацветают раньше, чем дикий тип, и демонстрируют пониженные реверсивные фенотипы. (A) Растения дикого типа (WT), подвергнутые яровизации в течение нескольких периодов (8, 12, 18 и 21 неделя) с последующими 3 неделями в LD.(B) pep2-1 мутантные растения, подвергнутые яровизации в течение нескольких периодов (8, 12, 18 и 21 неделя) с последующими 3 неделями в LD. Масштабная линейка = 10 см. (C) Время до появления цветков растений WT и pep2-1 , подвергшихся разной продолжительности яровизации, измерялось как количество дней до появления первого распускающегося цветка. (D) Процент цветущих ветвей соцветий (FB) у WT и мутанта pep2-1 , подвергшихся 8, 12, 18 и 21 неделям яровизации в момент раскрытия последнего цветка в соцветии.(E) WT перевернутое соцветие у растений, яровизированных в течение 8 недель. (F) pep2-1 мутантное соцветие в растениях, яровизированных в течение 8 недель. Масштабная линейка = 2 см. (G) Количество прицветников в соцветии WT и мутанта pep2-1 , подвергшихся яровизации в течение 8, 12, 18 и 21 недель во время раскрытия последнего цветка в соцветии. Этот эксперимент был проведен вместе с мутантом pep1-1 в эксперименте, ранее опубликованном (рис. 6 в Lazaro et al., 2018). Данные для контроля WT в двух статьях аналогичны. Звездочки обозначают значительные различия между диким типом и мутантом pep2-1 в каждый момент времени, определенный с помощью множественных попарных тестов Бонферрони (α-значение 0,05). Планки погрешностей указывают стандартное отклонение.

Рис. 6.

PEP2 требуется для активации экспрессии PEP1 после яровизации. Относительная экспрессия PEP1 в апикальной меристеме побега и в вегетативных подмышечных меристемах дикого типа (WT) и мутанта pep2-1 до, во время и после 12 недель яровизации.Буквы обозначают существенные различия между WT и pep2-1 в каждый момент времени, определенным путем множественных попарных сравнений с использованием скорректированных по Бенджамини – Хохберга значений P (α-значение 0,05). Подробную информацию о существенных различиях можно найти в дополнительной таблице S3. Планки погрешностей указывают стандартное отклонение.

Рис. 6.

PEP2 требуется для активации экспрессии PEP1 после яровизации. Относительная экспрессия PEP1 в апикальной меристеме побега и в вегетативных подмышечных меристемах дикого типа (WT) и мутанта pep2-1 до, во время и после 12 недель яровизации.Буквы обозначают существенные различия между WT и pep2-1 в каждый момент времени, определенным путем множественных попарных сравнений с использованием скорректированных по Бенджамини – Хохберга значений P (α-значение 0,05). Подробную информацию о существенных различиях можно найти в дополнительной таблице S3. Планки погрешностей указывают стандартное отклонение.

Обсуждение

Понимание роли длительного воздействия низких температур на цветение имеет особое значение для многолетних видов, которые перезимуют несколько раз в течение своего жизненного цикла.У многолетников умеренного климата длительное воздействие холода контролирует более поздние стадии цветения, такие как равномерное распускание почек весной, тогда как у альпийских видов оно обеспечивает формирование цветков до того, как растения попадут в благоприятные условия окружающей среды для цветения (Diggle, 1997; Meloche and Diggle, 2001; Lazaro и др. , 2018). Поддержание вегетативного развития после цветения, которое важно для стратегии многолетней жизни, регулируется сезонным циклом репрессоров цветов и дифференциальной реакцией меристем на индукционные стимулы цветка из-за возрастных факторов (Wang et al., 2009, 2011; Koskela et al. , 2012). Здесь мы охарактеризовали роль цветочного репрессора A. alpina PEP2 , ортолога Arabidopsis AP2. Предыдущие исследования показали, что PEP2 контролирует цветение посредством PEP1 -зависимого и PEP1 -независимого пути (Bergonzi et al ., 2013). Наш транскриптомный анализ показал, что PEP2 влияет на экспрессию генов, участвующих в нескольких процессах развития.Однако многие из идентифицированных генов могут регулироваться не напрямую с помощью PEP2, а посредством сложных последующих генетических взаимодействий (Fig. 1; Supplementary Fig. S1). Мы также обнаружили, что промоторы и репрессоры цветов по-разному экспрессируются в мутанте pep2 . В Arabidopsis белок AP2 был иммунопреципитирован из промоторной области SOC1 (Yant et al. , 2010). Однако в нашем исследовании эффект PEP2 на AaSOC1 , по-видимому, осуществляется через PEP1 (рис.1). Чтобы охарактеризовать роль PEP1 -зависимой и PEP1 -независимой роли PEP2 в цветении, мы также использовали физиологический анализ и проследили экспрессию генов времени цветения и идентичности меристемы в течение жизненного цикла A. alpina . Эти данные показали, что PEP2 контролирует (i) возрастную реакцию на яровизацию и (ii) временные циклы репрессора цветков PEP1 , обеспечивая активацию экспрессии PEP1 после яровизации.

PEP2 контролирует возрастную реакцию на яровизацию

PEP2 может спасти фенотип раннего цветения мутанта Arabidopsis ap2-7 , предполагая, что его роль во времени цветения может быть сохранена (рис. 2). У Arabidopsis AP2 посттранскрипционно регулируется miR172, а miR172b помещается в возрастной путь, поскольку он транскрипционно контролируется мишенями miR156 SPL9 и SPL15 (Wu et al., 2009 г .; Hyun et al. , 2016). AP2 также негативно регулирует свою собственную экспрессию путем прямого связывания со своим собственным геномным локусом, а также с локусами своих регуляторов miR156e , miR172b и FUL , предполагая, что AP2 транскрипционно регулируется множеством петель обратной связи (Schwab и др. , 2005; Янт и др. , 2010; Balanza и др. ., 2018). Белок AP2 был также иммунопреципитирован из хроматина цветочных интеграторов и генов, необходимых для развития цветочной меристемы, таких как SOC1 , AGAMOUS ( AG ) и AP1 (Yant et al., 2010 г.). Транскрипция генов, таких как SOC1 и FUL , также контролируется вышестоящими регуляторами пути возраста. Сообщалось, что SPL9 связывается с первым интроном SOC1 , а SPL15 - с FUL и miR172b (Wang et al. , 2009; Hyun et al. , 2016). В целом, эта сложная генетическая цепь, включающая AP2, может способствовать быстрому жизненному циклу Arabidopsis, в котором переход цветков происходит вскоре после приобретения репродуктивной способности.В отличие от Arabidopsis, у A. alpina репродуктивная способность не связана с началом цветения. Arabis alpina Растения становятся способными к цветению после выращивания в течение 5 недель в условиях LD, но начинают цветение только тогда, когда они подвергаются яровизации (Wang et al. , 2009). Это говорит о том, что цветение A. alpina регулируется тесным взаимодействием между возрастом и путями яровизации. Члены семейств SPL и AP2 (e.грамм. AaSPL15 и AaTOE2 ) транскрипционно репрессируются PEP1 в дополнение к посттранскрипционной и посттрансляционной регуляции с помощью miRNA (Chen, 2004; Bergonzi et al. ., 2013; Hyun et al. , 2016). ; Сюй и др. , 2016; Матеос и др. , 2017). Хотя FLC у Arabidopsis нацелен на аналогичный набор генов, сильное взаимодействие между возрастом и путем яровизации наиболее очевидно у A. alpina (Deng et al., 2011 г .; Mateos et al. , 2017). Яровизация у A. alpina обеспечивает условия, при которых влияние возраста на цветение становится очевидным, поскольку оно подавляет PEP1 . Постепенные изменения в накоплении miR156 и экспрессии генов SPL можно наблюдать в верхушке побега растений A. alpina , которые стареют в LDs (Bergonzi et al ., 2013). Однако накопление нижестоящих регуляторов в пути старения, таких как miR172, увеличивается только на верхушке побега во время яровизации и при переходе от цветков (Bergonzi et al ., 2013). Здесь мы показываем, что экспрессия miR156 и AaSPL5 и 15 не влияет на pep2 растения, выращенные в LDs (Fig. 1E-G; Supplementary Fig. S3). Учитывая, что PEP2 частично действует через PEP1 , отсутствие эффекта в pep2-1 на AaSPL15 может быть связано либо с остаточной экспрессией PEP1 в мутанте pep2-1 , либо с существованием компенсаторных генетических механизмов. Интересно, что уровни мРНК AaSPL9 были снижены у 6-недельных проростков pep2-1 по сравнению с проростками дикого типа (дополнительный рис.S3). Этот эффект PEP2 на AaSPL9 , однако, не может быть объяснен петлями обратной связи, описанными у Arabidopsis, поскольку уровни транскрипта AaSPL9 должны быть выше в pep2-1 , чем в диком типе (дополнительный рис. С3; Янт и др. , 2010).

Ранее сообщалось, что ортолог A. alpina для TFL1 ( AaTFL1 ) влияет на эффект яровизации в зависимости от возраста, хотя его характер экспрессии не различается между ювенильными и взрослыми верхушками до яровизации ( Wang et al., 2011). Здесь мы показываем, что яровизация ускоряла цветение у молодых проростков pep2-1 по сравнению с pep1-1 , предполагая, что PEP2 также регулирует возрастную реакцию на яровизацию в независимом от PEP1 пути пути (рис. 3). . Интересно, что в нашем анализе RNAseq количество транскриптов AaTFL1 было снижено в мутанте pep2-1 , что позволяет предположить, что PEP2 вместе или через AaTFL1 устанавливает возрастной порог для цветения в ответ на яровизацию.Однако одно из основных различий между AaTFL1 и PEP2 состоит в том, что линии с пониженной активностью AaTFL1 не зацветают без яровизации. Эти результаты предполагают, что PEP2 играет дополнительную роль в регуляции времени цветения у A. alpina . Транскриптомные эксперименты на Arabidopsis также показали, что мРНК TFL1 подавляется в соцветиях ap2 по сравнению с диким типом (Yant et al. , 2010).Однако ChIP-Seq не обнаружил прямого связывания AP2 с локусом TFL1 , и поэтому неясно, есть ли прямой или косвенный эффект AP2 на транскрипцию TFL1 (Yant et al. , 2010). .

PEP2 обеспечивает активацию PEP1 после яровизации

Предыдущие исследования на A. alpina показали, что PEP2 контролирует цветение в ответ на яровизацию посредством усиления экспрессии PEP1 (Bergonzi et al ., 2013). Здесь мы показываем, что основная роль PEP2 в активации PEP1 происходит после яровизации. Экспрессия PEP1 в A. alpina временно подавляется во время длительного воздействия холода, чтобы определить судьбу соцветий, в то время как она высоко экспрессируется в пазушных ветвях после яровизации для подавления цветения (Wang et al. , 2009; Lazaro et al. , 2018). Недавно мы показали, что продолжительность яровизации влияет на реактивацию PEP1 в верхушке побега после возвращения к теплым температурам (Lazaro et al., 2018). Фенотипы, коррелированные с высокими уровнями мРНК PEP1 после яровизации (например, реверсия цветков и наличие вегетативных пазушных ветвей), почти отсутствовали у мутанта pep2-1 (рис.5; Lazaro et al. , 2018). Соответственно, уровни мРНК PEP1 были снижены у яровизированных растений pep2-1 по сравнению с диким типом как в стебле соцветия, так и в пазушных ветвях (рис.6; Wang et al. , 2009; Lazaro et al. ., 2018). Эти результаты предполагают, что PEP2 вносит вклад в жизненный цикл многолетнего растения и контролирует характерные для многолетнего растения признаки путем активации PEP1 после яровизации. У Arabidopsis интрогрессия аллеля FRI из образца Sf-2 в Col увеличивает продолжительность низких температур, необходимых для замалчивания FLC (Searle et al. , 2006). Образцам северного арабидопсиса, таким как Lov-1, требуется несколько месяцев яровизации для достижения сайленсинга FLC и, как и для A.alpina Pajares, более короткая продолжительность низких температур вызывает реактивацию FLC (Shindo et al. , 2006). Связь между AP2 и FLC у Arabidopsis не ясна. AP2 не связывается с локусом FLC в экспериментах ChIP-Seq, и в нашем исследовании экспрессия FLC не была изменена в растениях, где мутантный аллель ap2-7 был интрогрессирован в фон Col FRI Sf-2. (Дополнительный рис. S3; Янт и др., 2010 г.). Однако, поскольку наиболее сильное различие в экспрессии PEP1 в мутанте pep2-1 наблюдалось после яровизации, следует проанализировать эффект AP2 в образце Lov-1, чтобы исключить роль AP2 на Реактивация FLC после недостаточной яровизации.

Нестабильное молчание FLC включает изменения в накоплении триметилирования h4 в Lys27 (h4K27me3) (Angel et al. , 2011; Coustham et al., 2012). Паттерн метки h4K27me3 в локусе PEP1 также коррелирует с изменениями уровней мРНК PEP1 в A. alpina (Wang et al. , 2009). PEP1 показывает гораздо большее и более широкое увеличение h4K27me3 во время холода, чем FLC , а уровни h4K27me3 быстро снижаются на PEP1 после коротких периодов яровизации (Wang et al. , 2009; Angel et al. , 2011; Лазаро и др. , 2018).Хотя белки, регулирующие модификации гистонов в локусе PEP1 , неизвестны, сброс эпигенетической памяти FLC у Arabidopsis зависит от присутствия компонентов TrxG и деметилаз, содержащих домен Jumonji C (JmjC) EARLY FLOWERING 6 ( ELF6) и РОДСТВЕННИК РАННЕГО ЦВЕТАНИЯ 6 (REF6) (Noh et al. , 2004; Yun et al. , 2011; Crevillen et al ., 2014). Было показано, что AP2 обладает способностью взаимодействовать с фактором ремоделирования хроматина HISTONE DEACETYLASE 19 (HDA19) для транскрипционной репрессии одной из своих мишеней (Krogan et al., 2012), но AP2 никогда не был связан с гистоновыми деметилазами.

Мы недавно продемонстрировали, что PEP1 стабильно замалчивается в апикальной меристеме побегов взрослых растений, которые начинают цветение при длительном воздействии холода (Lazaro et al. , 2018). У молодых растений аналогичная продолжительность яровизации не приводит к цветению, даже если PEP1 заглушается во время холода (Lazaro et al. , 2018). Обязанность цветков во время яровизации коррелирует с более высокой экспрессией генов идентичности цветочной меристемы, AaFUL , AaLFY и AaAP1 , которые репрессируются PEP2 (Lazaro et al., 2018). Это очевидно по преждевременной активации уровней мРНК AaFUL , AaLFY и AaAP1 у яровизированных растений pep2-1 по сравнению с диким типом (фиг. 4; дополнительный фиг. S4). Хотя связь между сбросом PEP2 и PEP1 не ясна, похоже, что достижение цветочной приверженности во время яровизации отрицательно коррелирует с повышением регуляции PEP1 после возврата к теплым температурам (Lazaro et al., 2018). У Arabidopsis не известно, что AP2 влияет на транскрипцию FLC . Однако сообщалось, что AP2 транскрипционно репрессируется с помощью FUL, а растения, сверхэкспрессирующие FUL , демонстрируют сниженную экспрессию FLC (Balanzà et al. , 2014, 2018). Эти результаты предполагают, что FUL может регулировать транскрипцию FLC независимо или через AP2 . Это также может указывать на то, что в A. alpina роль PEP2 в экспрессии PEP1 может вовлекать другие регуляторы времени цветения, гены, участвующие в возрастном пути, и гены, обеспечивающие приверженность цветков во время яровизации.Однако, поскольку PEP1 также транскрипционно регулирует гены в этих генетических путях, также могут иметь место механизмы обратной связи (Mateos et al. , 2017).

Заключение

Наше исследование демонстрирует, что PEP2 играет инструментальную роль в A. alpina , контролируя возрастную реакцию на яровизацию и способствуя активации PEP1 после яровизации. Поскольку обе роли PEP2 сосредоточены на том, было ли достигнуто обязательство цветения во время яровизации, это предполагает, что они не могут быть полностью независимыми.Вышестоящие регуляторы генов идентичности меристем цветков, такие как PEP2, могут контролировать реакцию на яровизацию отдельных меристем и вносить вклад в сложную архитектуру растений у многолетних растений.

Дополнительные данные

Дополнительные данные доступны на сайте JXB онлайн.

Набор данных S1. Транскрипты, идентифицированные как дифференциально экспрессируемые в pep2-1 по сравнению с диким типом.

Набор данных S2. Транскрипты, идентифицированные как дифференциально экспрессируемые в pep1-1 по сравнению с диким типом.

Набор данных S3. Транскрипты идентифицированы как дифференциально экспрессируемые в pep2-1 по сравнению с pep1-1 .

Рис. S1. GO-обогащенных категорий в эксперименте RNAseq.

Рис. S2. Активность AP2 не влияет на экспрессию FLC у Arabidopsis.

Фиг.S3. Уровни экспрессии miR156, AaSPL5 и AaSPL15 не различаются между растениями дикого типа и pep2-1 , растущими в длинные дни.

Рис. S4. PEP2 регулирует возрастную реакцию A. alpina на яровизацию.

Рис. S5. PEP2 контролирует экспрессию AaFUL , AaTFL1 , AaLFY и AaAP1 во время яровизации взрослых растений.

Таблица S1. Праймеры, используемые для PIPE-клонирования локуса PEP2 .

Таблица S2. Статистические различия на дополнительном рис. S2, определенные путем множественных попарных сравнений с использованием скорректированных по Бенджамини – Хохберга значений P , сравнивающих уровни мРНК FLC между FRI и FRI ap2-7 на разных стадиях развития.

Таблица S3. Статистические различия на фиг. 6 определены путем множественных попарных сравнений с использованием скорректированных по Бенджамини – Хохберга значений P , сравнивающих уровни мРНК PEP1 между pep2-1 и диким типом на разных стадиях развития.

Сокращения

    Сокращения

  • DAG

  • LD

  • SD

Благодарности

Мы хотели бы поблагодарить SPP1530 ​​и CEPLAS за финансирование MCA, SPP1529 за финансирование AP и KN, а также стипендию Purkyně от ASCR до AP. Мы также хотели бы поблагодарить Маргарет Кокс за критическое прочтение рукописи.

Список литературы

Амасино

R

.

2009

.

Цветочная индукция и монокарпическая и поликарпическая истории жизни

.

Биология генома

10

,

228

.

Angel

A

,

Song

J

,

Dean

C

,

Howard

M

.

2011

.

Переключатель на основе Polycomb, лежащий в основе количественной эпигенетической памяти

.

Природа

476

,

105

-

108

.

Аукерман

MJ

,

Сакаи

H

.

2003

.

Регулирование времени цветения и идентичности цветочных органов с помощью микроРНК и ее APETALA2 -подобных генов-мишеней

.

Заводская ячейка

15

,

2730

-

2741

.

Balanzà

V

,

Martínez-Fernández

I

,

Ferrándiz

C

.

2014

.

Последовательное действие FRUITFULL как модулятора активности регуляторов цветков SVP и SOC1

.

Журнал экспериментальной ботаники

65

,

1193

-

1203

.

Balanzà

V

,

Martínez-Fernández

I

,

Sato

S

,

Yanofsky

MF

,

Kaufmann

GC5

,

Ferrándiz

C

.

2018

.

Генетический контроль остановки меристемы и продолжительности жизни у Arabidopsis с помощью пути FRUITFULL – APETALA2

.

Nature Communications

9

,

565

.

Benjamini

Y

,

Hochberg

Y

.

1995

.

Контроль ложного обнаружения - практичный и эффективный подход к множественному тестированию

.

Журнал Королевского статистического общества B: Методологический

57

,

289

-

300

.

Bergonzi

S

,

Albani

MC

.

2011

.

Репродуктивная компетентность с ежегодной и постоянной точки зрения

.

Журнал экспериментальной ботаники

62

,

4415

-

4422

.

Bergonzi

S

,

Albani

MC

,

Ver Loren van Themaat

E

,

Nordström

KJ

,

Wang

R

e PD

,

Муфта

G

.

2013

.

Механизмы возрастной реакции на зимнюю температуру в многолетнем цветении Arabis alpina

.

Наука

340

,

1094

-

1097

.

Billings

WD

,

Mooney

HA

.

1968

.

Экология арктических и альпийских растений

.

Биологические обзоры Кембриджского философского общества

43

,

481

-

529

.

Bowman

JL

,

Smyth

DR

,

Meyerowitz

EM

.

1991

.

Генетические взаимодействия между цветочными гомеотическими генами Arabidopsis

.

Девелопмент

112

,

1

-

20

.

Castro

PH

,

Couto

D

,

Freitas

S

и др.

2016

.

SUMO протеазы ULP1c и ULP1d необходимы для развития и реакции на осмотический стресс у Arabidopsis thaliana

.

Молекулярная биология растений

92

,

143

-

159

.

Чен

X

.

2004

.

МикроРНК как репрессор трансляции APETALA2 в развитии цветка Arabidopsis

.

Наука

303

,

2022

-

2025

.

Cline

MS

,

Smoot

M

,

Cerami

E

и др.

2007

.

Интеграция данных биологических сетей и экспрессии генов с использованием Cytoscape

.

Протоколы природы

2

,

2366

-

2382

.

Зажим

SJ

,

Изогнутый

AF

.

1998

.

Цветочный дип: упрощенный метод опосредованной Agrobacterium трансформации Arabidopsis thaliana

.

Заводской журнал

16

,

735

-

743

.

Conti

L

,

Цена

G

,

O’Donnell

E

,

Schwessinger

B

,

Dominy

P

,

Sadanandom 9.

2008

.

Небольшие убиквитиноподобные протеазы-модификаторы, ЧРЕЗВЫЧАЙНО ДОПУСТИМЫЕ К SALT1 и -2, регулируют реакцию на солевой стресс у Arabidopsis

.

Заводская ячейка

20

,

2894

-

2908

.

Coustham

V

,

Li

P

,

Странно

A

,

Lister

C

,

Song

J

,

Dean

C

C

C

.

2012

.

Количественная модуляция сайленсинга поликомб лежит в основе естественной изменчивости яровизации

.

Наука

337

,

584

-

587

.

Crevillén

P

,

Sonmez

C

,

Wu

Z

,

Dean

C

.

2013

.

Генная петля, содержащая цветочный репрессор FLC, разрушена на ранней фазе яровизации

.

Журнал EMBO

32

,

140

-

148

.

Crevillén

P

,

Ян

H

,

Cui

X

,

Greeff

C

,

Уловка

M

,

Qiu

o

M

,

Qiu

o

Декан

С

.

2014

.

Эпигенетическое репрограммирование, предотвращающее наследование яровизированного состояния между поколениями

.

Природа

515

,

587

-

590

.

Czechwski

T

,

Stitt

M

,

Altmann

T

,

Udvardi

MK

,

Scheible

WR

.

2005

.

Идентификация и тестирование лучших референсных генов для нормализации транскриптов в геноме Arabidopsis

.

Физиология растений

139

,

5

-

17

.

Deng

WW

,

Ying

H

,

Helliwell

CA

,

Taylor

JM

,

Peacock

WJ

000

. Dennis ES

.

2011

.

FLOWERING LOCUS C (FLC) регулирует пути развития на протяжении жизненного цикла Arabidopsis

.

Proceedings of the National Academy of Sciences, USA

108

,

6680

-

6685

.

Diggle

P

.

1997

.

Экстремальная преформация в альпийских условиях Polygonum viviparum : архитектурный анализ и анализ развития

.

Американский журнал ботаники

84

,

154

.

Guo

D

,

Wong

WS

,

Xu

WZ

,

Sun

FF

,

Qing

DJ

,

Li

N

2011

.

Ген 1, усиленный цис-коричной кислотой, играет роль в регуляции Arabidopsis bolting

.

Молекулярная биология растений

75

,

481

-

495

.

Hyun

Y

,

Richter

R

,

Vincent

C

,

Martinez-Gallegos

R

,

Porri

A

,

9 Coupland 9.

2016

.

Многослойная регуляция SPL15 и сотрудничество с SOC1 интегрируют эндогенные пути цветения в меристеме побегов Arabidopsis

.

Клетка развития

37

,

254

-

266

.

Кейт

RA

,

Mitchell-Olds

T

.

2017

.

Проверка гипотезы оптимальной защиты в природе: вариации профилей глюкозинолатов в растениях

.

PLoS One

12

,

e0180971

.

Klock

HE

,

Koesema

EJ

,

Knuth

MW

,

Lesley

SA

.

2008

.

Сочетание метода неполного удлинения праймера полимеразой для клонирования и мутагенеза с микропроцессором для ускорения усилий в области структурной геномики

.

Белки

71

,

982

-

994

.

Koskela

EA

,

Mouhu

K

,

Albani

MC

,

Kurokura

T

,

Rantanen

M

000

Sargen

Coupland

G

,

Elomaa

P

,

Hytönen

T

.

2012

.

Мутация в TERMINAL FLOWER1 отменяет фотопериодические требования для цветения земляники. Fragaria vesca

.

Физиология растений

159

,

1043

-

1054

.

Kotoda

N

,

Iwanami

H

,

Takahashi

S

,

Abe

K

.

2006

.

Антисмысловая экспрессия MdTFL1 , гена, подобного TFL1 , снижает ювенильную фазу в яблоке

.

Журнал Американского общества садоводческих наук

131

,

74

-

81

.

Krogan

NT

,

Hogan

K

,

Long

JA

.

2012

.

APETALA2 негативно регулирует множественные гены идентичности органов цветка у Arabidopsis, рекрутируя корепрессор TOPLESS и гистондеацетилазу HDA19

.

Девелопмент

139

,

4180

-

4190

.

Lazaro

A

,

Obeng-Hinneh

E

,

Albani

MC

.

2018

.

Расширенная яровизация регулирует судьбу соцветий у Arabis alpina , стабильно подавляя молчание PERPETUAL FLOWERING1

.

Физиология растений

176

,

2819

-

2833

.

Ли

I

,

Амасино

RM

.

1995

.

Влияние яровизации, фотопериода и качества света на фенотип цветения растений Arabidopsis , содержащих ген FRIGIDA

.

Физиология растений

108

,

157

-

162

.

Maere

S

,

Heymans

K

,

Kuiper

M

.

2005

.

BiNGO: плагин Cytoscape для оценки чрезмерной представленности категорий генной онтологии в биологических сетях

.

Биоинформатика

21

,

3448

-

3449

.

Mateos

JL

,

Tilmes

V

,

Madrigal

P

,

Severing

E

,

Richter

R

,

000

000 Rijkenberg, C

Rijkenberg

Муфта

G

.

2017

.

Дивергенция регуляторных сетей, регулируемых ортологичными факторами транскрипции FLC и PEP1 у видов Brassicaceae

.

Proceedings of the National Academy of Sciences, USA

114

,

E11037

-

E11046

.

Mathieu

J

,

Yant

LJ

,

Mürdter

F

,

Küttner

F

,

Schmid

M

.

2009

.

Подавление цветения мишенью miR172 SMZ

.

PLoS Biology

7

,

e1000148

.

Meloche

CG

,

Diggle

PK

.

2001

.

Преформация, архитектурная сложность и гибкость развития в Acomastylis rossii (Rosaceae)

.

Американский журнал ботаники

88

,

980

-

991

.

Майклс

SD

,

Амасино

RM

.

1999

.

FLOWERING LOCUS C кодирует новый белок домена MADS, который действует как репрессор цветения

.

Заводская ячейка

11

,

949

-

956

.

Mohamed

R

,

Wang

CT

,

Ma

C

и др.

2010

.

Populus CEN / TFL1 регулирует первое начало цветения, идентичность пазушных меристем и высвобождение покоя у Populus

.

Заводской журнал

62

,

674

-

688

.

Noh

B

,

Lee

SH

,

Kim

HJ

,

Yi

G

,

Shin

EA

,

000 Lee

M

ung

Дойл

MR

,

Амасино

RM

,

Но

YS

.

2004

.

Дивергентные роли пары гомологичных белков фактора транскрипции класса jumonji / zinc-finger в регуляции времени цветения Arabidopsis

.

Заводская ячейка

16

,

2601

-

2613

.

Nordström

KJ

,

Albani

MC

,

Джеймс

GV

,

Gutjahr

C

,

Hartwig

B

U5000

,

0002

Муфта

G

,

Schneeberger

K

.

2013

.

Идентификация мутации путем прямого сравнения данных полногеномного секвенирования от мутантов и индивидов дикого типа с использованием k-мер

.

Nature Biotechnology

31

,

325

-

330

.

Парк

JY

,

Kim

H

,

Lee

I

.

2017

.

Сравнительный анализ молекулярных и физиологических признаков между многолетником Arabis alpina Pajares и однолетним Arabidopsis thaliana Sy-0

.

Научные отчеты

7

,

13348

.

Schmid

M

,

Uhlenhaut

NH

,

Godard

F

,

Demar

M

,

Bressan

R

,

000

000

000 JEIGEL

000 J2

2003

.

Рассечение путей индукции цветков с использованием анализа глобальной экспрессии

.

Девелопмент

130

,

6001

-

6012

.

Schwab

R

,

Palatnik

JF

,

Riester

M

,

Schommer

C

,

Schmid

M

,

Weigel

.

2005

.

Специфические эффекты микроРНК на транскриптом растений

.

Клетка развития

8

,

517

-

527

.

Searle

I

,

He

Y

,

Turck

F

,

Vincent

C

,

Fornara

F

,

Köber

RA

Муфта

G

.

2006

.

Фактор транскрипции FLC дает ответ цветения на яровизацию путем репрессии компетентности меристемы и системной передачи сигналов у Arabidopsis

.

Гены и развитие

20

,

898

-

912

.

Sheldon

CC

,

Rouse

DT

,

Finnegan

EJ

,

Peacock

WJ

,

Dennis

ES

.

2000

.

Молекулярная основа яровизации: центральная роль FLOWERING LOCUS C ( FLC )

.

Proceedings of the National Academy of Sciences, USA

97

,

3753

-

3758

.

Shindo

C

,

Lister

C

,

Crevillen

P

,

Nordborg

M

,

Dean

C

.

2006

.

Вариация эпигенетического молчания FLC вносит вклад в естественные вариации в ответе яровизации Arabidopsis

.

Гены и развитие

20

,

3079

-

3083

.

Trapnell

C

,

Pachter

L

,

Salzberg

SL

.

2009

.

TopHat: обнаружение сплайсинговых соединений с помощью RNA-Seq

.

Биоинформатика

25

,

1105

-

1111

.

Trapnell

C

,

Williams

BA

,

Pertea

G

,

Mortazavi

A

,

Kwan

G

,

9000 9000 9000 SL 9000 Salon M0005,

9000 Salon M0005,

9000 Salon M0005 ,

Wold

BJ

,

Pachter

L

.

2010

.

Сборка и количественное определение транскриптов с помощью RNA-Seq выявляет неаннотированные транскрипты и переключение изоформ во время дифференцировки клеток

.

Nature Biotechnology

28

,

511

-

515

.

Ван

R

,

Альбани

MC

,

Винсент

C

,

Бергонци

S

,

Луан

M

,

Cai

,

Kai

Castillo

R

,

Coupland

G

.

2011

.

Aa TFL1 дает возрастную реакцию на яровизацию у многолетнего растения Arabis alpina

.

Заводская ячейка

23

,

1307

-

1321

.

Wang

R

,

Farrona

S

,

Vincent

C

,

Joecker

A

,

Schoof

H

,

000 Blanco

Turck

000 Turck

,

Coupland

G

,

Albani

MC

.

2009

.

PEP1 регулирует многолетнее цветение у Arabis alpina

.

Природа

459

,

423

-

427

.

Willing

EM

,

Rawat

V

,

Maumus

F

и др.

2015

.

Отсутствие симметричного метилирования CG и длительная активность ретротранспозона сформировали геном Arabis alpina

.

Природные растения

1

,

14023

.

Wu

G

,

Park

MY

,

Conway

SR

,

Wang

JW

,

Weigel

D

,

Poethig

.

2009

.

Последовательное действие miR156 и miR172 регулирует время развития у Arabidopsis

.

Ячейка

138

,

750

-

759

.

Wu

G

,

Poethig

RS

.

2006

.

Временная регуляция развития побегов у Arabidopsis thaliana с помощью miR156 и его мишени SPL3

.

Девелопмент

133

,

3539

-

3547

.

Xu

M

,

Hu

T

,

Zhao

J

,

Park

MY

,

Earley

кВт

,

Wu

9000

G2

Поэтиг

RS

.

2016

.

Функции развития miR156-регулируемых генов SQUAMOSA PROMOTER BINDING PROTEIN-LIKE ( SPL ) в генах Arabidopsis thaliana

.

PLoS Genetics

12

,

e1006263

.

Янт

L

,

Матье

J

,

Dinh

TT

,

Ott

F

,

Lanz

C

,

000 Hollmann

Wollmann

Wollmann

Шмид

М

.

2010

.

Оркестровка перехода цветков и развития цветков у Arabidopsis с помощью бифункционального транскрипционного фактора APETALA2

.

Заводская ячейка

22

,

2156

-

2170

.

Yun

H

,

Hyun

Y

,

Kang

MJ

,

Noh

YS

,

Noh

B

,

Choi

2011

.

Идентификация регуляторов, необходимых для реактивации FLOWERING LOCUS C во время репродукции Arabidopsis

.

Планта

234

,

1237

-

1250

.

© Автор (ы) 2018. Опубликовано Oxford University Press от имени Общества экспериментальной биологии.

Это статья в открытом доступе, распространяемая в соответствии с условиями лицензии Creative Commons Attribution License (http: // creativecommons.org / licenses / by / 4.0 /), что разрешает неограниченное повторное использование, распространение и воспроизведение на любом носителе при условии правильного цитирования оригинальной работы.

PEP1 Arabis alpina кодируется двумя перекрывающимися генами, которые способствуют естественной генетической изменчивости в многолетнем цветении

Abstract

Высшие растения обладают разнообразной историей жизни. Однолетние растения живут менее года, а после цветения дают семена и стареют. Напротив, многолетние растения живут много лет, разделяя свой жизненный цикл на периоды вегетативного роста и цветения.Экологические сигналы контролируют ключевые контрольные точки в обеих историях жизни. Гены, контролирующие реакцию на эти сигналы, демонстрируют естественную генетическую изменчивость, которая наиболее изучена у короткоживущих однолетних растений. Мы охарактеризовали естественную генетическую изменчивость, придающую различиям в многолетнем жизненном цикле Arabis alpina . Ранее было показано, что образец Pajares цветет после длительного воздействия холода (яровизация) и только в течение ограниченного периода времени, прежде чем он вернется к вегетативному росту. Опишем пять образцов A.alpina , которые не требуют яровизации для непрерывного цветения и цветения. Генетическая комплементация показала, что эти образцы несут мутантные аллели по адресу PERPETUAL FLOWERING 1 ( PEP1 ), который кодирует фактор транскрипции MADS-бокса, ортологичный FLOWERING LOCUS C в однолетнем Arabidopsis thaliana . Каждый образец несет разные мутации в PEP1 , что позволяет предположить, что такие вариации возникали независимо много раз. Характеристика этих аллелей продемонстрировала, что в большинстве образцов, включая Pajares, локус PEP1 содержит тандемное расположение полной длины и частичную копию PEP1 , которые дают начало двум полноразмерным транскриптам, которые экспрессируются по-разному.Эта сложность контрастирует с единственным геном, присутствующим в A. thaliana , и может вносить вклад в более сложный паттерн экспрессии PEP1 , который связан с многолетним жизненным циклом. Наша работа демонстрирует, что природные образцы A. alpina демонстрируют различные жизненные истории, обусловленные различиями в активности PEP1, и что формы непрерывного цветения возникали многократно в результате инактивации репрессора цветков PEP1 . Сходные фенотипические вариации обнаруживаются у других травянистых многолетних видов, и наши результаты представляют собой парадигму того, как могут возникать характерные многолетние фенотипы.

Сведения об авторе

Многолетние растения живут много лет и колеблются между цветением и вегетативным ростом. Эти этапы жизненного цикла часто инициируются условиями окружающей среды и происходят сезонно. Однако многие многолетние травянистые виды, такие как клубника, роза или Arabis alpina , содержат сорта, которые цветут непрерывно независимо от времени года. Здесь мы охарактеризуем эту генетическую изменчивость в A. alpina и покажем, что пять непрерывно цветущих образцов несут независимые мутации в гене PERPETUAL FLOWERING 1 ( PEP1 ).Эти мутации нарушают активность цветочного репрессора PEP1, заставляя растения цвести без потребности в зимних холодах и непрерывно цвести. Этот результат имеет интересные параллели с клубникой и розой, где инактивация другого цветочного репрессора, контролирующего реакцию на длину дня, дает естественные формы вечного цветения. Мы также показываем, что PEP1 в A. alpina имеет сложную дублированную структуру, которая дает начало двум перекрывающимся транскриптам.Такое расположение отличается от простой структуры ортологов PEP1 у родственных однолетних видов, таких как FLC из Arabidopsis thaliana , предполагая, что дупликация PEP1 может вносить вклад в сложные транскрипционные паттерны, связанные с функцией PEP1 у многолетних растений. . Наша работа дает представление о генетических вариациях, влияющих на многолетнюю историю жизни растений.

Образец цитирования: Albani MC, Castaings L, Wötzel S, Mateos JL, Wunder J, Wang R, et al.(2012) PEP1 Arabis alpina кодируется двумя перекрывающимися генами, которые способствуют естественной генетической изменчивости в многолетнем цветении. PLoS Genet 8 (12): e1003130. https://doi.org/10.1371/journal.pgen.1003130

Редактор: Хао Ю, Национальный университет Сингапура и Лаборатория естественных наук Темасек, Сингапур

Поступила: 14.07.2012; Дата принятия: 15 октября 2012 г .; Опубликовано: 20 декабря 2012 г.

Авторские права: © 2012 Albani et al.Это статья в открытом доступе, распространяемая в соответствии с условиями лицензии Creative Commons Attribution License, которая разрешает неограниченное использование, распространение и воспроизведение на любом носителе при условии указания автора и источника.

Финансирование: Эта работа частично финансировалась Deutsche Forschungsgemeinshaft через SPP1529 и SFB680 для GC, основной грант от Общества Макса Планка SPP1530 ​​для MCA, Международной школы исследований Макса Планка (RW и SW) и Александра фон Фонд Гумбольдта в JLM.Финансирующие организации не играли никакой роли в дизайне исследования, сборе и анализе данных, принятии решения о публикации или подготовке рукописи.

Конкурирующие интересы: Авторы заявили, что никаких конкурирующих интересов не существует.

Введение

Ключевые этапы жизненного цикла завода регулируются в ответ на сигналы окружающей среды. Многие гены, контролирующие эти реакции, демонстрируют аллельные вариации внутри вида, что позволяет индивидуумам адаптироваться к окружающей среде. Короткоживущие однолетние растения демонстрируют естественную генетическую изменчивость сезонной реакции цветения, которая была тщательно изучена на Arabidopsis thaliana [1], [2] и нескольких сельскохозяйственных культурах [3].Переход от вегетативного к репродуктивному развитию однолетних растений знаменует конец их жизненного цикла. Напротив, многолетние растения живут много лет и проходят повторяющиеся циклы вегетативного роста и цветения. Большинство многолетних видов умеренного пояса цветут сезонно, и фазы цветения и вегетативного роста четко разделены. Интересно, что у многолетних растений экологические сигналы, которые регулируют начало цветения, также влияют на продолжительность периода цветения, либо регулируя рост цветочных почек [4], либо возвращаясь к вегетативному развитию [5], [6], [7]. .Для этих признаков также существует генетическая изменчивость, так что особи одного и того же вида цветут либо в течение ограниченного периода, либо в течение более продолжительного времени [4], [8], [9]. Кроме того, различия в активности генов цветения могут способствовать расхождению в истории жизни между видами растений, включая различие между годовыми и многолетними жизненными циклами [5], [10], [11], [12], [13], [14], [15]. Анализ видов в семействе Brassicaceae дает возможность расширить знания о механизмах контроля времени цветения у модельного однолетнего вида A.thaliana к близкородственным многолетним видам.

Эволюция адаптивных признаков, которые вносят вклад в однолетние или многолетние жизненные стратегии, может быть относительно быстрой и в небольшом количестве примеров была связана с генетическими изменениями, такими как инверсии, дупликации генов или модификации паттернов экспрессии генов [5], [10 ], [11], [14], [16], [17], [18], [19]. Ранее мы показали, что фактор транскрипции MADS-бокса PEP1 регулирует особенности цветения и многолетние растения у видов Brassicaceae A.alpina [5]. До сих пор цветение и многолетнее развитие A. alpina было охарактеризовано только у образца Pajares (Paj), который был собран в горном регионе Cardillera Cantábrica в Испании [5]. Этот образец демонстрирует обязательную потребность в продолжительном воздействии холода (яровизация) для цветения. PEP1 подавляет цветение до яровизации, так что мутанты pep1-1 , идентифицированные после мутагенеза, быстро цветут без яровизации [5].Кроме того, мутантные растения pep1-1 цветут в течение более длительного периода, чем растения дикого типа, что связывает потребность в яровизации с продолжительностью периода цветения.

PEP1 является ортологом A. thaliana FLOWERING LOCUS C ( FLC ), который также кодирует цветочный репрессор, который задерживает цветение до яровизации. В A. thaliana FLC задерживает цветение, подавляя транскрипцию генов, необходимых для перехода к репродуктивному развитию [20], [21], [22].Этот блок при цветении преодолевается яровизацией, которая снижает экспрессию FLC , позволяя цветению продолжаться [23], [24]. Уровни мРНК FLC в A. thaliana стабильно подавляются после яровизации, гарантируя, что все боковые ветви, которые образуются после инициации цветения, также цветут и дают семена. A. thaliana затем погибают, завершая годовой жизненный цикл. Таким образом, стабильная репрессия FLC после цветения важна для обеспечения того, чтобы все ветви подверглись цветению, максимизируя производство семян в течение одного года жизненного цикла.Стабильная репрессия FLC связана с эпигенетическими изменениями в локусе, которые включают триметилирование лизина 27 гистона 3 (h4K27me3) в гене FLC . Метка h4K27me3 распространяется после яровизации по локусу FLC [25] [26], стабильно репрессируя его транскрипцию.

Наиболее естественная генетическая изменчивость у A. thaliana по времени цветения в ответ на яровизацию обеспечивается аллельной изменчивостью в FLC или его вышестоящем регуляторе FRIGIDA ( FRI ) [27], [28], [29] , [30], [31], [32], [33].FRI способствует транскрипции FLC , так что потеря активности FRI приводит к низким уровням мРНК FLC [23], [24]. Раннее цветение A. thaliana . Цветущие без яровизации - летние однолетники. Большинство из них демонстрируют низкие уровни мРНК FLC либо потому, что они несут поражения в FRI , либо мутации в локусе FLC , которые предотвращают его активацию с помощью FRI [27], [28], [29], [31], [31], [ 34], [35]. Также сообщалось о раннецветущих образцах с высоким уровнем мРНК FLC , несущих мутации в локусе FLC [28], [36].Напротив, все зимние однолетние образцы, которые поздно цветут и проявляют сильную потребность в яровизации, экспрессируют мРНК FLC на высоких уровнях [23], [24], [27], [29], [30]. Естественная генетическая изменчивость среди зимних однолетних образцов A. thaliana описана в отношении продолжительности периода яровизации, необходимого для стимулирования цветения, а также связана с аллельной изменчивостью FLC [37], [38].

В A. alpina , PEP1 выполняет ту же роль, что и FLC , обеспечивая ответ на яровизацию, но, кроме того, он способствует многолетнему цветению, отсутствующему у A.Талиана . Уровни мРНК PEP1 в A. alpina нестабильно подавляются яровизацией даже после насыщающего периода яровизации, который инициирует цветение. Скорее, уровни мРНК PEP1 и снова повышаются, когда растения испытывают высокие температуры после зимы. Сходные паттерны экспрессии ортологов FLC были описаны у другого многолетнего вида Brassicaceae, Arabidopsis halleri [19]. Повышение уровня мРНК PEP1 после яровизации блокирует цветение любых побегов, которые еще не зацвели, заставляя растение вернуться к вегетативному росту.Накопление триметилирования лизина 27 гистона 3 (h4K27me3) увеличивается в локусе PEP1 во время яровизации и связано с репрессией транскрипции [25], [26]. Однако в отличие от FLC в A. thaliana, метка h4K27me3 не сохраняется после холода, и это коррелирует с реактивацией транскрипции PEP1 [5], [25], [26].

Здесь мы идентифицируем образцов A. alpina , которые цветут без яровизации, и демонстрируем, что они также являются естественными вечноцветущими образцами.Пять из этих образцов были охарактеризованы на генетическом и молекулярном уровнях, и в каждом случае естественные фенотипические вариации вызваны потерей функциональных аллелей на PEP1. Эти пять образцов несут различные повреждения в гене PEP1 , что позволяет предположить, что они возникли независимо в ходе эволюции. Анализ этой вариации также показал, что A. alpina содержит сегментарную частичную дупликацию PEP1 , которая создала два стартовых сайта транскрипции и два перекрывающихся транскрипта, более сложную структуру, чем обнаруживается в FLC в A.Талиана . Мы обсуждаем эту внутривидовую и межвидовую вариацию структуры и функции PEP1 с точки зрения эволюции особенностей жизненного цикла Brassicaceae.

Результаты

PEP1 способствует изменчивости цветения у образцов A. alpina

Образец Paj несет активный аллель PEP1 и требует обязательной яровизации для цветения (Рисунок 1A; [5]). EMS-индуцированные мутации в PEP1 отменяют требование обязательной яровизации, вызывая цветение Paj в течение 60 дней в течение долгих дней [5].Чтобы проверить, вносят ли аллельные различия PEP1 вклад в естественную изменчивость признаков многолетнего цветения, время цветения 24 образцов (Таблица S1) из разных мест было оценено в долгие дни. Пять образцов, которые зацвели без яровизации и в течение 3 месяцев после прорастания, были идентифицированы как кандидаты на несение естественных мутантных аллелей pep1 . Четыре из этих образцов, Dorfertal (Dor), Totes Gebirge (Tot), West Carpathians (Wca) и Czarna Gòra (Cza), зацвели даже раньше, чем мутант pep1-1 , тогда как образец Muggendorf (Mug) зацвел немного позже. чем pep1-1 (Рисунок 1B – 1G, Рисунок S1).Мутантные растения pep1-1 цветут постоянно, что указывает на то, что PEP1 также регулирует продолжительность цветения и возвращение к вегетативному развитию (Рисунок 1H; [5]). Чтобы проверить, коррелирует ли цветение без яровизации у образцов A. alpina с непрерывным цветением, образцы Dor, Tot, Cza и Wca выращивали в течение длинных дней, и их продолжительность цветения сравнивали с мутантом pep1-1 . Все образцы все еще цвели через 28 недель после начала цветения, демонстрируя, что цветение без яровизации коррелирует с признаком вечного цветения у природного A.alpina (рис. 1H – 1J).

Рис. 1. Цветение образцов A. alpina .

(A) Accession Paj выращивали вегетативно в течение четырех лет в теплице с длинным дневным светом. У Paj есть обязательные требования к яровизации для цветения. (B) - (I) Невыровнение требует образцов A. alpina при цветении в течение долгого дня. Присоединение Dor (B), Tot (C), Wca (D), Cza (E) и Mug (F). (G) Время цветения при невыровнении, требующее образцов A. alpina при длинных днях (16 часов света) по сравнению с мутантом pep1-1 и образцом Paj.Время цветения измеряется в днях до цветения (DTF). pep1-1 мутант (H) и образец Dor (I) цветут постоянно через 6 месяцев в долгие дни. (J) Продолжительность цветения при невыровнении, требующем образцов A. alpina .

https://doi.org/10.1371/journal.pgen.1003130.g001

В A. thaliana уровни мРНК FLC часто коррелируют со временем цветения [23]. Поэтому мы сравнили уровни мРНК PEP1 у раннецветущих образцов, которые не требуют яровизации для цветения, с уровнями мРНК образца Paj, который требует обязательной яровизации.Большинство образцов демонстрировали уровни мРНК PEP1 , по крайней мере, такие же высокие, как и у образца Paj, что позволяет предположить, что цветение без яровизации явно не коррелировало с уменьшением мРНК PEP1 (Рисунок 2A). Однако образцы Dor и Wca имели более низкие уровни мРНК PEP1 и , чем Paj. Следовательно, сниженные уровни мРНК PEP1 в этих образцах могут объяснять их фенотип цветения, но это не может быть основанием для раннего цветения у образцов Mug, Cza и Tot.

Рис. 2. Невыровнение, требующее образцов, не спасает фенотип раннего цветения мутанта pep1-1 .

(A) PEP1 Уровни мРНК в листьях, не требующих яровизации, по сравнению с Paj. (B) Время цветения гибридов F1 в результате скрещивания без яровизации, требующего присоединения с мутантом pep1-1 и Paj в долгие дни без яровизации. Мутант pep1-1 и Paj использовали в качестве контроля. Время цветения измеряется в днях до цветения (DTF).(C) Накопление PEP1 в разных образцах по сравнению с образцом Paj до яровизации. pep1-1, и Paj после 16 недель яровизации использовали в качестве отрицательного контроля. Перекрестно реагирующий белок действует как регулятор нагрузки.

https://doi.org/10.1371/journal.pgen.1003130.g002

Эти образцы, не требующие яровизации, были затем скрещены с pep1-1 , чтобы проверить, несут ли они аллель PEP1 , который может дополнять pep1. -1 мутация.В качестве контроля эти образцы также скрещивали с Paj и измеряли время цветения растений F1 (рис. 2В, рис. S2). Все растения F1, полученные от скрещивания с мутантом pep1-1 , зацвели без яровизации, что позволяет предположить, что эти образцы несут нефункциональные аллели PEP1 , которые не могут дополнять мутацию pep1-1 (рис. 2B). Напротив, все растения F1, полученные от скрещивания с Paj, не цвели в течение нескольких месяцев при выращивании в течение долгих дней, что указывает на то, что функциональный аллель PEP1 из Paj достаточен для задержки цветения растений F1.Взятые вместе, эти генетические эксперименты предполагают, что требующие неврнализации образцы несут неактивные аллели PEP1 .

Чтобы проверить, несут ли они мутации в открытой рамке считывания PEP1 , которые могут объяснять нефункциональные аллели PEP1 , мы секвенировали кДНК PEP1 каждого образца (Таблица 1, Таблица S2). Праймеры, которые отжигаются с -5 'и -3' UTR, использовали для амплификации 814 п.н. кодирующей последовательности из вершин перед яровизацией.Затем продукты амплификации из каждого образца клонировали в Escherichia coli и секвенировали несколько клонов. PEP1 мРНК из Paj, как было показано, подвергается альтернативному сплайсингу, генерируя формы, которые сохранили интроны или которые потеряли части или целые экзоны [5]. Большинство секвенированных клонов из образцов содержали полноразмерную ORF, что позволяет предположить, что это преобладающий транскрипт, хотя также были обнаружены варианты сплайсинга (таблица 1, таблица S2). Полноразмерные кДНК, выделенные из образцов Dor, Tot, Cza и Mug, содержали полиморфизмы, которые вызывали аминокислотные замены или делеции по сравнению с аллелем Paj (Таблица 1), предполагая, что эти полиморфизмы могут быть основой потери активности PEP1 и, следовательно, измененное цветение.В образце Wca преобладающая последовательность кДНК не содержала никаких аминокислотных замен или делеций по сравнению с Paj, и, таким образом, снижение активности PEP1, вероятно, связано с низким уровнем мРНК, описанным выше.

За исключением вариантов сплайсинга, полиморфизмы, обнаруженные в последовательностях кДНК PEP1 и , были разными для каждого из образцов, требующих не яровизации (Таблица 1). Из образца Dor амплифицировали кДНК, содержащие полиморфизмы в экзоне 1. Большинство кДНК содержали замену оснований G на A в экзоне 1, которая, как предполагается, вызывает замену аминокислот в высококонсервативном MADS-бокс-домене, ответственном за связывание ДНК, тогда как некоторые последовательности были идентичны последовательностям Paj (Рисунок S3).Происхождение этих различных последовательностей кДНК обсуждается ниже. КДНК PEP1 , выделенная из образца Tot, содержала две замены оснований в экзоне 4, который кодирует K-бокс, и было предсказано, что одна из них вызывает аминокислотную замену валин (Val) на изолейцин (Ile) по сравнению с Paj. Образец Cza содержал замену основания и делецию 3 п.н. в экзоне 3. По сравнению с Paj, замена основания, как ожидается, вызовет изменение лейцина (Leu) на аргинин (Arg), тогда как ожидается, что делеция вызовет потерю глицина (Gly ) и тирозиновых (Tyr) остатков и их замена аминокислотой цистеин (Cys).Наконец, образец Mug содержал замену синонимичного основания в экзоне 1 и делецию 27 п.н. в экзоне 3, что привело к предсказуемой потере 9 аминокислот в K-бокс-домене белка.

Чтобы проверить, коррелирует ли накопление белка PEP1 с характером цветения у образцов, были получены антитела против белка (методы). Затем белок PEP1 был протестирован с использованием вестерн-блоттинга апикальных образцов не яровизированных, требующих образцов, Paj и pep1-1 перед яровизацией и яровизированных растений Paj (рис. 2С).Белок PEP1 был обнаружен в Paj до яровизации, но не после 12 недель яровизации, и отсутствовал у мутанта pep1-1 . В образце Wca PEP1 не обнаружен, что коррелирует с низкими уровнями мРНК PEP1 и по сравнению с образцом Paj (рис. 2A, 2C). Белок PEP1 в образце Mug был меньше, что соответствовало делеции 27 п.н. в рамке экзона в экзоне 3 в этом образце (рисунок 2C, таблица 1). Накопление PEP1 в образцах Dor и Tot было аналогично образцу Paj до яровизации, хотя, как описано выше, формы PEP1 в Dor и Tot, как предполагается, будут содержать аминокислотные изменения по сравнению с Paj.

Взятые вместе эти данные показывают, что некоторые образцы, требующие неяровизации, несут PEP1 аллелей с полиморфизмом в кодирующей последовательности белка, которые, вероятно, нарушают функцию белка, в то время как Wca показывает пониженное накопление PEP1. Генетический и молекулярный анализ этих образцов позволяет предположить, что эти природные аллели способствуют потере потребности в яровизации и постоянному цветению за счет снижения уровня или активности белка PEP1.

Вариация последовательности в кДНК

PEP1 образца Dor выявляет сложную структуру локуса PEP1

кДНК PEP1 , выделенные из образца Dor, различались по последовательности экзона 1, будучи либо идентичными Paj, либо несли несинонимичные изменения (таблица 1, рисунок 3A).Эти разные кДНК нельзя объяснить гетерозиготностью Dor по PEP1 , потому что генетические эксперименты показали, что он несет один и тот же аллель на обеих хромосомах. Большинство кДНК Dor PEP1 содержали замену основания G на A по сравнению с Paj в начале первого экзона (таблица 1). Другой набор кДНК, кодирующих ORF, идентичный образцу Paj, также содержал вставку длиной 248 п.н. в 5'-UTR-области, которая отсутствовала в кДНК Paj и отсутствовала в преобладающем транскрипте, несущем замену G на A (Таблица 1).Присутствие обеих кДНК PEP1 и в Dor проверяли с использованием другого праймера в 5'-UTR и того же обратного праймера 3'-UTR. Снова были обнаружены оба типа кДНК, но неожиданно их соотношение изменилось, так что большинство клонов содержали последовательности, аналогичные образцу Paj, и только один содержал замену оснований G на A (фиг. 3E).

Рисунок 3. Анализ вариации последовательности в кДНК PEP1 и в геномном локусе образца Dor демонстрирует сложную структуру гена PEP1 .

(A) PEP1 кДНК в Dor представляет собой смесь транскриптов, которые содержат замену G на A в экзоне 1 по сравнению с Paj или имеют последовательность, аналогичную последовательности доступа Paj, но имеют вставку 248 п.н. в 5'-UTR. (B) Последовательность геномного локуса PEP1 в образце Paj показывает, что локус сильно дублирован. Экзоны обозначены черными прямоугольниками, UTR - белыми прямоугольниками, а сплошные линии - меж- и внутригенными областями. Гены, расположенные выше и ниже по течению от PEP1 , находятся на расстоянии 35 т.п.н.Цветные прямоугольники указывают относительное положение дублированных областей. Перекрывающиеся прямоугольники указывают на перекрывающиеся гомологичные последовательности. Цифры помимо дублированных прямоугольников показывают длину дублированного фрагмента и процент гомологии. Дублированные копии экзона 1 обозначены как 1a и 1b. Пунктирная рамка показывает область локуса PEP1 , секвенированную в образце Dor. (C) Последовательность геномного локуса PEP1 в образце Dor показывает, что замена основания G на A находится в экзоне 1a. Серые стрелки указывают на вставки, черные стрелки указывают на делеции, а вертикальные пунктирные линии указывают на SNP относительно локуса Paj PEP1 .Вставка длиной 248 п.н. выше в 5'-UTR находится выше экзона 1b. Цветные прямоугольники указывают относительное положение дублированных областей. (D) Структура локуса PEP1 и предсказанные события сплайсинга (E) Транскрипты PEP1 в образце Dor, обнаруженные с двумя разными праймерами в 5'-UTR с использованием одного и того же обратного праймера в 3'-UTR. Черные и серые стрелки указывают положение двух разных праймеров в 5'-UTR относительно вставки длиной 248 п.н. Когда использовали праймер PEP1_5UTRF1 (черный), большинство клонов содержали замену G на A в экзоне 1.Несколько клонов, которые не содержали замены основания G на A, также содержали вставку 248 п.н. в 5'-UTR. Когда использовали праймер PEP1_5UTRF2, большинство клонов не содержало замены основания G на A.

https://doi.org/10.1371/journal.pgen.1003130.g003

Локус PEP1 в образце Paj частично дублирован и расположен в области генома A. alpina , которая демонстрирует консервативную синтению с A. thaliana на хромосоме 5, где расположен FLC A. alpina Paj расстояние между ортологами генов, фланкирующих FLC в A. thaliana (At5g10130 и At5g10150), увеличено [5], и эта область включает несколько тандемно дублированных последовательностей, которые включают части PEP1 (Рисунок 3B). Самый длинный дуплицированный сегмент составляет приблизительно 2 т.п.н. и содержит копию экзона 1 PEP1 , а также части промотора PEP1 и интрона 1. Тандемные копии экзона 1, названные 1a и 1b, расположены 6.На расстоянии 3 т.п.н. (рис. 3В). Чтобы определить, кодируются ли два типа кДНК PEP1 , идентифицированные в образце Dor, этими разными копиями экзона 1, локус PEP1 был секвенирован в образце Dor с использованием ВАС, содержащего весь локус PEP1 . Смежная область от экзона 1b до экзона 7 обнаруживает структуру, аналогичную PEP1 из Paj. Кроме того, экзон 1b показал ту же последовательность, что и Paj, но содержал вставку 248 п.н. в 5'-UTR, обнаруженную в некоторых кДНК Dor, описанных выше (фиг. 3A, таблица 1).Следовательно, те кДНК Dor PEP1 , кодирующие ту же самую ORF, что и Paj, и вставка в 5'-UTR кодировались смежной областью от экзона 1b до экзона 7, но кДНК, кодирующие несинонимичный полиморфизм в экзоне 1, не были получены из этот регион. Затем была амплифицирована, клонирована и секвенирована область 10 т.п.н. перед экзоном 1b PEP1 под номером Dor. Вторая копия экзона 1 PEP1 , которая соответствовала экзону 1a в Paj, присутствовала в этой вышележащей области, и она содержала замену основания G на A в первом экзоне, которая была обнаружена во второй группе кДНК PEP1 . найден в образце Дор (рис. 3С).Этот результат показал, что экзон 1a также используется для получения полноразмерного транскрипта PEP1 , и как экзон 1a, так и экзон 1b сплайсируются с одной и той же копией экзона 2 для получения двух транскриптов, которые имеют общие экзоны 2-7 (рис. 3D). Какой транскрипт предпочтительно амплифицируется от присоединения Dor, зависит от используемого праймера в 5'-UTR, на который, вероятно, влияет вставка в 5'-UTR экзона 1b (рис. 3E).

Локус

PEP1 содержит тандемные дупликации в другом A.alpina образцы

Дублированные области, фланкирующие экзоны 1a и 1b PEP1 в образце Paj (прямоугольники от серого до синего на рис. 3B), очень похожи, за исключением последовательности длиной 246 п.н. после экзона 1a, которая была удалена из области экзона 1b (желтый прямоугольник на рис. 3B, рис. 4A и 4B). Эта делеция 246 п.н. после экзона 1b также существует в образце Dor, что указывает на то, что оно произошло до расхождения образцов Paj и Dor (рис. 3C). Более того, эта последовательность длиной 246 пар оснований в Paj PEP1a демонстрирует гомологию с первым интроном FLC в A.thaliana , предполагая, что в этом отношении экзон 1a PEP1 больше связан с FLC , чем экзон 1b PEP1 (фиг. 4B).

Рисунок 4. PEP1 Локус тандемно дублирован в нескольких образцах A. alpina .

(A) Структура локуса PEP1 и положение праймеров, специфичных для экзона 1a и экзона 1b. (B) Сравнение последовательностей FLC и тандемных дублированных копий 1a и 1b в образце Paj (серые и синие прямоугольники на рисунке 3A).График Vista с использованием Calc. окно 25, мин. ширина 25 и минус 70%. (C) Выравнивание с использованием части последовательности 416 п.н. (желтый прямоугольник), специфичной для экзона 1a из различных гомологов FLC . Праймер Intr1aR был сконструирован с консенсусной последовательностью. (D) ПЦР-тест с использованием праймеров, специфичных для PEP1a и (Ex1F и Intr1aR) в различных образцах. Используемый шаблон - Dor (1), Tot (2), Wca (3), Cza (4), Mug (5) Paj (6) и контроль воды (7). (E) Выравнивание с использованием части последовательности интрона ниже PEP1b.Праймер Intr1bR был сконструирован в дублированной области (розовая рамка на фиг. 3C, 3B, фиг. 4A), консервативной в других гомологах FLC . (F) ПЦР-тест с использованием праймеров, специфичных для PEP1b и (Ex1F и Intr1bR) в различных образцах. Используемый шаблон - Dor (1), Tot (2), Wca (3), Cza (4), Mug (5) Paj (6) и контроль воды (7). (G) PEP1 Структура образцов Paj, Dor, Cza и Tot, полученная секвенированием локуса PEP1 .

https: // doi.org / 10.1371 / journal.pgen.1003130.g004

Чтобы проверить, содержат ли другие образцы A. alpina тандемную дупликацию по локусу PEP1, были разработаны праймеры для копий PEP1a и PEP1b , отжигаемых на Сегмент длиной 246 п.н., специфичный для экзона 1a или консервативной последовательности в первом интроне после экзона 1b (рисунок 4C, рисунок 4E). Эти праймеры использовали в комбинации с общим прямым праймером в области бокса MADS, который отжигался как с PEP1a , так и с PEP1b (фигура 4A, фигура 4C, фигура 4E).Праймеры, специфичные для PEP1b , амплифицировали фрагмент во всех образцах, что указывает на то, что PEP1b , вероятно, является консервативным среди этих образцов (фиг. 4F). Однако эти фрагменты немного различались по размеру, что согласуется с делецией, присутствующей в образце Dor (описанном ниже) по сравнению с Paj. Напротив, праймеры, специфичные для PEP1a и , амплифицировали фрагмент в образцах Dor, Cza и Paj, но не в Tot, Wca или Mug (рис. 4D). Этот результат указывает на то, что область PEP1b более консервативна, чем PEP1a среди A.alpina образцы.

Геномные локусы PEP1 из образцов Cza и Tot были затем секвенированы для детального анализа их структуры. Аллель PEP1 в образце Cza имеет структуру, аналогичную образцам Dor и Paj, и содержит как экзон 1a, так и экзон 1b (рисунок 4G). Фрагмент, соответствующий экзону 1a, не амплифицировался из образца Tot. Чтобы предоставить геномную информацию для этой области, Illumina было выполнено секвенирование ДНК, выделенной из Tot.Считываемые последовательности собирали и проводили поиск гомологии с PEP1 с использованием BLAST. Эта информация о последовательности затем была использована для конструирования локус-специфичных праймеров для тестирования структуры PEP1 в Tot и для получения фрагментов для секвенирования по Сэнгеру. Этот анализ показал, что аллель Tot содержал только экзон 1b и имел делецию, которая включает экзон 1a и межгенную область между экзоном 1a и 1b. Следовательно, потеря функции PEP1 в этом аллеле коррелирует с отсутствием области PEP1a , а также с несинонимичной заменой в экзоне 4.

Транскрипты PEP1a и PEP1b нестабильно и дифференциально экспрессируются после яровизации в образце Dor .

Последовательности выше PEP1 экзона 1a и экзона 1b сильно различаются (рис. 3B), что позволяет предположить, что два гена PEP1 могут экспрессироваться с разных промоторов. Чтобы проверить, используют ли транскрипты PEP1 , кодирующие экзон 1a и экзон 1b, два разных сайта начала транскрипции, 5'-RACE выполняли на образце Dor, в котором две копии экзона 1 могут быть дифференцированы.Этот анализ показал, что экзон 1a и экзон 1b имеют разные сайты начала транскрипции, расположенные на 65–186 п.н. выше ATG для экзона 1a и 61–190 п.н. выше ATG экзона 1b (рис. 5A, 5B).

Рисунок 5. Гены PEP1a, и PEP1b в образце Dor транскрибируются независимо и имеют разные стартовые сайты транскрипции.

(A, B) Количество клонов, содержащих полиморфизм G в A на экзоне 1 (A) или нет (B) после 5 'RACE с использованием верхушек растений Dor, растущих в течение 3 недель в длинные дни.Схематическое изображение областей экзона 1 и 5 'UTR (вверху), экзона 1a и экзона 1b (черные ящики), последовательности, присутствующей в 5'UTR перед экзоном 1a и 1b (белый ящик), последовательности, специфичной для 5' UTR перед экзоном 1a (красный прямоугольник), последовательность, специфичная для 5'-UTR восходящего экзона 1b на вставке 248 п.н. (серый прямоугольник). Горизонтальные линии представляют отдельные клоны. Цифры вверху обозначают битрейты перед ATG. (B, C) Процент клонов с полиморфизмом A или G после 5 'RACE в верхушках и листьях до (3 недели долгих дней) и после яровизации (5 недель в длинные дни после 12 недель яровизации).(D) - (F) PEP1 Уровни мРНК на трехнедельных растениях Дор, яровизированных в течение 12 недель и впоследствии выращенных в течение нескольких недель в течение долгих дней. (D) Экспрессия PEP1, (a + b), праймеры использовали аналогично [5] для обнаружения обоих транскриптов. (E) PEP1a, экспрессию, праймеры использовали для обнаружения только транскриптов PEP1a . (F) Экспрессия PEP1b , праймеры, используемые для обнаружения только транскриптов PEP1b .

https://doi.org/10.1371/journal.pgen.1003130.g005

Чтобы определить, экспрессируются ли эти разные транскрипты по-разному, была проведена 5'-RACE в образце Dor в верхушках и листьях до и после яровизации (рис. 5C). PEP1a Полиморфизм в образце Dor был обнаружен в основном в транскриптах от вегетативных верхушек до яровизации, что составляет 26% от общего пула мРНК PEP1 . В листьях до и после яровизации Dor PEP1a был обнаружен только в 3% транскриптов, представляющих лишь небольшую часть от общего количества транскриптов PEP1 , тогда как практически не обнаруживался в цветках через пять недель после яровизации.Напротив, Dor PEP1b сильно экспрессировался в верхушках, цветках и листьях на всех стадиях.

Для более тщательного сравнения уровней транскриптов PEP1a и PEP1b после яровизации наблюдали за моделями их экспрессии в течение времени в трехнедельных проростках Дор, яровизированных в течение 12 недель, а затем возвращенных к нормальной температуре еще на 1, 3 или 5 недель. Оба транскрипта были репрессированы во время яровизации и увеличились в экспрессии после яровизации (рис. 5D, 5E, 5F).Уровень мРНК Dor PEP1b оставался на высоком уровне в течение нескольких недель после яровизации, тогда как уровни мРНК Dor PEP1a снова упали через 1 неделю в теплых условиях.

Эти эксперименты показывают, что гены PEP1a и PEP1b независимо транскрибируются с разных сайтов начала транскрипции. Оба транскрипта демонстрируют очень похожие паттерны регуляции транскрипции до, во время и сразу после яровизации, но экспрессия PEP1b сильнее сохраняется в цветках и листьях позже после яровизации, чем транскрипт PEP1a .

Обсуждение

A. alpina - альпийское многолетнее растение и единственный ранее охарактеризованный образец, Paj, цветет в течение ограниченного периода весной после длительного воздействия низких зимних температур. У этого испанского образца были подробно изучены особенности цветения и многолетние растения, и было показано, что они находятся под контролем PEP1 , который является ортологом гена A. thaliana FLC [5]. Здесь мы идентифицировали несколько A.Образцы alpina , которые несут неактивные аллели PEP1 и, следовательно, не требуют яровизации для цветения. Эти образцы также постоянно цветут подобно мутантным растениям pep1-1 [5]. Следовательно, среди образцов A. alpina аллельная вариация на PEP1 вносит вклад в фенотипические различия в продолжительности цветения, а также в различия в реакции яровизации. Это контрастирует с потерей функции FLC у образцов A. thaliana , которая не связана с непрерывным цветением из-за его однолетнего монокарпического жизненного цикла.Все неактивные аллели PEP1 различны, что указывает на то, что это фенотипическое расхождение происходило много раз у A. alpina . Мы обнаружили, что локус PEP1 частично дублирован, включая две копии первого экзона, а также части проксимального промотора и интрона 1. Эти последовательности расположены в виде тандемной дупликации, создавая два сайта начала транскрипции, которые генерируют два перекрывающихся транскрипта, которые являются дифференциально выражен. Эта повышенная сложность в локусе PEP1 может способствовать контрастирующей регуляции транскрипции PEP1 и FLC , наблюдаемой у многолетних растений A.alpina и однолетний A. thaliana соответственно.

Внутривидовая вариация сезонного цветения травянистых многолетников

В A. alpina корреляция между непрерывным цветением и отсутствием потребности в яровизации для индукции цветения была продемонстрирована путем характеристики pep1-1 , который является индуцированным EMS мутантом, полученным в результате мутагенеза образца Paj. Здесь мы показываем, что природные образцы A. alpina , которые не требуют яровизации для начала цветения, также цветут постоянно.Это говорит о том, что в природе A. alpina демонстрирует две жизненные истории: форма, требующая яровизации, которая цветет в течение ограниченного периода времени, и форма, не требующая яровизации, которая цветет непрерывно. Аналогичные колебания продолжительности сезона цветения наблюдаются и у других травянистых многолетников, таких как клубника и роза [8], [9], [39]. Культурная клубника и ее дикие сородичи демонстрируют две различные особенности цветения и классифицируются как сезонно цветущие (июньское плодоношение), приносящие один урожай в год, или как вечноцветущие (всегда плодоносящие), которые дают два урожая в год [8], [39] .Интересно, что у этих видов Rosaceae с вечным цветением предъявляются другие требования к окружающей среде для индукции цветения по сравнению с типами сезонного цветения. Клубнике, которая придерживается сезонной привычки цветения, требуются короткие дни и низкие температуры, чтобы вызвать цветение, тогда как вечно цветущая клубника потеряла фотопериодический и температурный контроль цветения или превратилась в растения длинного дня [7], [40], [41]. Эти типы отличаются от A. alpina , где образцы, которые цветут постоянно, потому что они утратили потребность в яровизации для цветения.Интересно, что непрерывное цветение также связано с субальпийскими лесами по сравнению с низинными лесами [42], а земляника ( Fragaria vesca ), которая следует вечному цветению, также называется альпийской клубникой, поскольку считается, что она возникла в Альпах [43] ].

Продолжительность сезона цветения у F. vesca контролируется одним геном SEASONAL FLOWERING LOCUS ( SFL ) [44]. В последнее время изменчивость последовательности розовых и F.Было показано, что гомологи vesca гена A. thaliana TERMINAL FLOWER 1 ( TFL1 ) коррелируют с различиями в продолжительности цветения, наблюдаемыми у сезонных и вечных типов цветения [6], [8], [45]. Образцы F. vesca , которые постоянно цветут, несут делецию в F. vesca TFL1 ( FvTFL1 ), которая вызывает преждевременный стоп-кодон, тогда как постоянное цветение у розы коррелирует с присутствием ретротранспозона во втором интроне розы Гомолог TFL1 ( KSN ) [6], [45]. TFL1 кодирует белок, родственный фосфатидилэтаноламин-связывающим белкам, и является цветочным репрессором, который специфически экспрессируется в апикальной меристеме побега [46], [47], [48], [49]. Трансгенные эксперименты на F. vesca продемонстрировали, что FvTFL1 не только регулирует продолжительность периода цветения, но также и индукцию цветения в ответ на фотопериод, при этом короткие осенние дни подавляют уровни мРНК FvTFL1 , чтобы инициировать цветение [ 6].В A. alpina снижение функции TFL1 не влияет на продолжительность сезона цветения, а скорее заставляет растения цвести в ответ на яровизацию на более раннем этапе их жизненного цикла [10]. Таким образом, хотя он не определяет продолжительность периода цветения, как у видов Rosaceae, TFL1 сохраняет важную функцию в многолетнем цикле A. alpina . Напротив, наша работа, описанная здесь, демонстрирует, что естественные фенотипические различия между сезонными и вечными формами A.alpina вызывается потерей функции аллелей PEP1 . Следовательно, генетическая изменчивость генов, кодирующих различные классы репрессоров растений, по-видимому, ответственна за различия в продолжительности сезона цветения среди образцов многолетних видов из разных семейств растений. Привлечение различных репрессоров цветения к этой функции, по-видимому, объясняет, как фенотипы сезонного цветения, сходные с наблюдаемыми у A. alpina Pajares, могут возникать у многолетних видов, которые не содержат гомологов FLC , таких как PEP1 .

Тесты на аллелизм

показали, что все проанализированные образцы A. alpina , которые цветут постоянно и без яровизации, несут неактивные аллели PEP1 . Образцы с вечным цветением несут независимые мутации в PEP1 , которые либо вызывают замены аминокислот, изменяют структуру локуса, либо предотвращают накопление белка и демонстрируют, что активность PEP1 была потеряна независимо несколько раз. В A. thaliana наиболее естественная фенотипическая изменчивость цветения в ответ на яровизацию может быть объяснена аллельной изменчивостью в FRI [28], [29], [31], [34], [36].Большинство летних однолетних образцов, которые цветут без яровизации, несут повреждения на FRI и, следовательно, цветут рано, потому что они не накапливают мРНК FLC до высоких уровней [27], [29], [31]. Точно так же у Arabidopsis lyrata были идентифицированы два аллеля в ортологе FRI , которые предположительно были связаны с различиями во времени цветения, хотя они, по-видимому, не объясняли большие различия во времени цветения между популяциями [50]. FRI - независимое изменение требований к яровизации также встречается среди A.thaliana летних однолетних образцов и в значительной степени коррелирует с аллельной изменчивостью FLC. Однако потеря функции FLC аллелей происходит в меньшей степени, чем у FRI [28], [35], [37], [38]. Некоторые раннецветущие летние однолетние образцы несут активные аллели FRI , но все же демонстрируют пониженные уровни мРНК FLC , что в некоторых случаях связано со вставками в первый интрон FLC [34], [35]. Другие образцы, которые экспрессируют мРНК FLC на высоком уровне, несут мутации в кодирующей последовательности белка FLC, нарушая его активность [28], [31], [36].Наши результаты не подтверждают наличие естественных вариаций у A. alpina FRI , играющих роль в многолетнем цветении или необходимости яровизации. Вместо этого все протестированные образцы A. alpina с ранним цветением несли мутации в ортологе FLC PEP1, , что позволяет предположить, что естественные вариации в PEP1 являются основным источником вариаций в ответе цветения на яровизацию и сезонное многолетнее цветение. Даже в образце Wca, где накопление PEP1 было низким, что согласуется со сниженной активностью FRI, анализ генетической комплементации показал, что раннее цветение этого образца было связано с мутацией PEP1 , аналогичной A.thaliana , несущие слабые аллели FLC [34], [35].

В соответствии с нашими данными, QTL, влияющие на время цветения у видов сельскохозяйственных культур Brassica, совмещаются с областями, содержащими гомологов FLC [51], [52], [53], [54], [55], [56], хотя есть также свидетельства вариации на FRI [57]. Исследования по избранному паралогу s в Brassica. rapa, Brassica napus и Brassica oleraceae подтверждают идею о том, что некоторые гены FLC у этих видов могут функционировать аналогично FLC в A.thaliana и внедрение некоторых из них, таких как BrFLC1-3 и BnFLC1-5 , в A. thaliana с задержкой цветения [58], [59]. Более того, уровни мРНК некоторых паралогов FLC коррелируют с необходимостью цветения и яровизации [56], [59].

Естественная потеря функции аллелей PEP1 возникла независимо в нескольких проанализированных популяциях A. alpina . Это может указывать на то, что цветение без яровизации и / или вечное цветение дает селективное преимущество в некоторых средах, возможно, потому, что они позволяют производить больше семян в течение более длительного вегетационного периода.Альтернативно, потеря функции аллелей PEP1 и может не обеспечивать селективного преимущества, но происходит как нейтральная вариация, когда выбор на PEP1 ослаблен на определенных высотах или в определенных местах обитания. Понимание эволюционных сил, определяющих преобладание активных и неактивных аллелей PEP1 , потребует в будущем более подробного экологического анализа.

Структура локуса

PEP1

PEP1 в A. alpina имеет неожиданно сложную структуру, включающую частичную тандемную дупликацию, приводящую к двум перекрывающимся мРНК.Дублированные тандемные сегменты включают первый экзон и соседние последовательности. Обе копии экзона 1 (экзон 1a и экзон 1b) сплайсируются с одной и той же копией экзона 2, и предполагается, что в образце Paj кодируют идентичные белки. Также описан альтернативный сплайсинг единственной копии FLC в A. thaliana [60]. Большинство образцов A. alpina , которые несут неактивные аллели PEP1 , имеют мутации в экзонах 2-7, которые вносят вклад в оба белка, и, следовательно, мутации инактивируют обе формы гена.Сообщалось, что родственные перекрывающиеся конфигурации генов растений образуют тканеспецифические изоформы белков на основе использования альтернативных промоторов и / или альтернативного сплайсинга экзонов [61], [62], [63], [64], [65]. Исследования тропомиозинов, например, показали, что события внутригенной дупликации генерируют новые экзоны, которые комбинируются различными способами с использованием альтернативных промоторов, сайтов инициации трансляции или сайтов полиаденилирования для получения тканеспецифичных изоформ белков [62], [63], [66], [ 67], [68].Тем не менее, в образце Paj два перекрывающихся гена PEP1 , как предполагается, кодируют идентичные белки, и поэтому эта структура не эволюционировала для кодирования различных изоформ белков. Однако последовательности перед каждой копией экзона 1 имеют небольшую гомологию, что позволяет предположить, что две перекрывающиеся копии экспрессируются с разных промоторов, и в соответствии с этой интерпретацией они имеют независимые стартовые сайты транскрипции. Более того, паттерны экспрессии двух транскриптов PEP1 и различаются, что позволяет предположить, что эта сложная структура может обеспечивать активность PEP1 в более широком диапазоне тканей или стадий развития.В A. thaliana функция FLC регулирует цветение листьев и верхушек [20], а др. Факторы транскрипции MADS box, как было показано, вносят вклад в различные транскрипционные комплексы на разных стадиях развития [69]. Более широкий паттерн экспрессии PEP1 может позволить ему вносить вклад в более широкий диапазон регуляторных путей.

Тандемные дупликации паралогов FLC обнаружены у A. thaliana и описаны для ортологов FLC у других представителей рода Arabidopsis [70].Кластер из четырех генов, кодирующих факторы транскрипции MADS-бокса, относящиеся к FLC , встречается в A. thaliana . Эти гены, от MADS AFFECTING FLOWERING 2 ( MAF2 ) до MAF5 , задерживают время цветения, но в значительно меньшей степени, чем FLC [71]. Тандемная дупликация этих четырех генов охватывает около 24 т.п.н., и аллельные вариации происходят среди образцов A. thaliana , включая слияние MAF2 и MAF3 с образованием химерного гена [72].Частичная дупликация гена PEP1 , обнаруженная в A. alpina , могла возникнуть в результате такой перестройки внутри предковой структуры, которая включает тандемный массив полноразмерных генов. Интересно, что в A. lyrata и Arabidopsis arenosa тандемные массивы полноразмерных ортологов FLC были подробно описаны [70], а в B. oleracea сообщалось о тандемной дупликации BoFLC1 [73], предполагая, что единственный экземпляр FLC присутствует в A.thaliana может происходить в ходе эволюции от предкового локуса FLC , который содержал две или три тандемных копии. A. lyrata содержит два полноразмерных гена FLC , тогда как A. arenosa содержит две копии и частичную копию. Было высказано предположение, что они возникли в пределах рода Arabidopsis и, следовательно, будут представлять собой независимое событие дупликации по сравнению с тем, которое мы описываем в A. alpina . Тем не менее, как A. arenosa , A.lyrata и A. alpina - все многолетние растения, а PEP1 / FLC показывает более сложный паттерн экспрессии у многолетних растений, чем однолетние, тандемное дублирование FLC может быть одним из механизмов, который способствует сложным паттернам транскрипции, связанным с многолетний цикл. Увеличение числа копий генов за счет дупликации тандемных генов и функциональной дивергенции, опосредованной накоплением мутаций в регуляторных областях cis , как предполагается, вносит вклад в эволюцию сложных признаков как у растений, так и у млекопитающих [74], [75], [76].В Brassicacae приобретение гипераккумуляции металлов в A. halleri по сравнению с A. thaliana было приписано амплификации HEAVY METAL ATPASE 4 ( HMA4 ) [77]. В этом случае амплификация гена увеличивает уровень экспрессии металлической помпы, кодируемой HMA4 , как из-за более высокого числа копий гена, так и из-за -цис--действующих изменений в промоторных последовательностях. Вероятно, увеличенное количество копий PEP1 также может быть связано с повышенным уровнем экспрессии, и это может частично отвечать за более сильное подавление цветения, обнаруженное при облигатной яровизации, требующей A.alpina , такие как Pajares.

Материалы и методы

Растительный материал и условия роста

Отобранные образцы A. alpina перечислены в таблице S1. Образец Pajares (Paj) был первоначально собран в горах Cordillera Cantábrica в Испании, самоопылен в течение шести поколений путем происхождения одного семени и охарактеризован в [5]. Мутант pep1-1 ранее был охарактеризован в [5]. Образцы Dor, Tot и Wca были самоопылены методом односемянного происхождения в течение шести поколений.Присоединение Cza было самоидентифицировано в течение двух поколений, а присоединение Mug - один раз. F1 для тестов на аллелизм с pep1-1, и Paj были получены с использованием pep1-1 и Paj в качестве материнских растений.

Время цветения измерялось при открытии первого цветка и выражалось как количество дней до цветения (с момента посадки семян на почву) или количество листьев при цветении. Для всех экспериментов по времени цветения растения выращивали в шкафах для длинного дня (16 часов света при 20 ° C и 8 часов темноты при 18 ° C).Продолжительность сезона цветения измеряли в теплице с контролируемой средой с длинным днем ​​(16 часов света).

Анализ экспрессии генов

Для исследований экспрессии генов РНК экстрагировали из верхушек и листьев с помощью набора RNeasy Plant Mini (Qiagen) и очищали набором без ДНК- (Applied Biosystems). Для исследований экспрессии кДНК первой цепи синтезировали из 1 мкг РНК с использованием различных праймеров в зависимости от цели эксперимента (таблица 2). 5 'RACE выполняли с использованием набора Invitrogen на 2.5 мкг РНК в соответствии с инструкциями производителя. Продукты ПЦР после 5'-RACE клонировали в векторе pGEM-T easy, и несколько клонов секвенировали с использованием праймеров M13.

Белковая работа

Для получения антитела PEP1 меченный гистидином длинный C-концевой сегмент PEP1 из 127 аминокислот экспрессировали в бактериях, и рекомбинантный белок очищали с использованием системы очистки Ni-NTA (Qiagen). Кроличьи поликлональные антитела были произведены Eurogentec (Eurogentec, Бельгия) с использованием очищенного белка в качестве антигена.Для вестерн-анализа верхушки 3-недельных растений A. alpina измельчали ​​в жидком азоте, гомогенизировали в буфере Лэммли и нерастворимый материал осаждали центрифугированием. Общий белок количественно определяли с помощью Amido-black, и 70 мкг общего белка отделяли на денатурирующем 10% полиакриламидном геле и наносили на PVDF-мембрану. Мембрану блокировали 5% молочным TBS в течение 1 ч и инкубировали в течение ночи с сывороткой поликлональных антител PEP1, разведенной 1-5000 в 5% молоке. Анти-кроличий IgG- (Abcam Ab97064) использовали в качестве вторичных антител в разведении 1-5000, и химиолюминесценцию визуализировали с помощью системы визуализации LAS4000 (Fujifilm).

Клонирование и секвенирование

PEP1 аллелей

Локус PEP1 из образца Paj был ранее секвенирован в [5]. Для секвенирования локуса PEP1 из образца Dor библиотека ВАС была подвергнута скринингу, и геномная область, охватывающая экзон 1b до экзона 7, была секвенирована прямым секвенированием. 10 т.п.н. между экзоном 1a и экзоном 1b отдельно амплифицировали из геномной ДНК с использованием полимеразы Taq Roche High Fidelity, клонировали в вектор pGEM-T easy и секвенировали.Затем последовательности выравнивали, чтобы получить консенсусную последовательность Dor PEP1 . Локус PEP1 из образца Cza амплифицировали до перекрывающихся фрагментов размером 1-2 т.п.н., клонировали в вектор pGEM-T easy и секвенировали. Для получения аллеля PEP1 из образца Tot геном Tot был секвенирован с использованием секвенирования следующего поколения. Геномную ДНК из Tot выделяли с помощью набора Maxi (Qiagen). Подготовка библиотеки и секвенирование следующего поколения 2x-100 п.н. выполняли в Центре генома Макса Планка (Кельн, Германия) с использованием Illumina HighSeq 2000, загруженного в проточную кювету для секвенирования с одной дорожкой.Праймеры, используемые для секвенирования аллелей PEP1 , доступны по запросу. Для скрининга на присутствие exon1a и exon1b среди образцов геномную ДНК каждого образца амплифицировали с использованием Ex1F, который является общим прямым праймером exon1a и exon1b (5'-CCGTAGCTCTCCTTGTCGTC-3 ') со специфическим для интрона 1a обратным праймером Intr1aR (5' -ACAACATCAAKTATGCATCAC-3 ', K: G / T) или специфический к интрону 1b обратный праймер Intr1bR (5'-ATTTCCMAGAGGCACCAAAG-3', M: T / A). Использованные условия ПЦР 94 ° C 1 мин; 60 ° C, 40 сек; 72 ° С 1.5 мин (35 циклов) и 72 ° C, 5 мин.

Регистрационный номер

Данные о последовательностях, представленные в этой статье, были отправлены в GeneBank (http://www.ncbi.nlm.nih.gov/Genbank/) со следующими номерами доступа: JX310558, JX310559, JX878519 и KC123236-KC123241.

Дополнительная информация

Рисунок S2.

Количество листьев при цветении гибридов F1, полученных в результате скрещивания без яровизации, требующего присоединения с мутантом pep1-1 и Paj.Растения выращивают долгие дни без яровизации. Мутант pep1-1 и Paj использовали в качестве контроля.

https://doi.org/10.1371/journal.pgen.1003130.s002

(PDF)

Таблица S2.

PEP1 сплайсинговых форм в раннеспелых образцах A. alpina . Множественные кДНК, проанализированные в таблице 1 для образцов Dor, Tot, Wca, Cza и Mug, также содержали сплайсинговые формы PEP1 . Количество клонов, извлеченных из каждого образца, показано в столбце «Клоны». PEP1 в образце Paj также дифференциально сплайсирован, но формы сплайсинга редки по сравнению с канонической ORF Pajares [5]. Полноразмерная последовательность кДНК PEP1 требующего яровизации образца Paj используется в качестве эталона (строка выделена серым цветом). Представлены нуклеотидные полиморфизмы по сравнению с последовательностью кДНК Paj PEP1 , полученной для каждого образца. Изменения нуклеотидного (нуклеотидного) положения и аминокислот (а.о.) по сравнению с Paj указаны в строках над серой строкой.* указывает последовательности, содержащие стоп-кодон.

https://doi.org/10.1371/journal.pgen.1003130.s005

(PDF)

Благодарности

Мы благодарим Wim Soppe и Maarten Koornneef за ценные обсуждения и комментарии к рукописи.

Вклад авторов

Задумал и спроектировал эксперименты: MCA GC. Проведены эксперименты: MCA LC SW JLM RW. Проанализированы данные: MCA LC SW JLM MR. Предоставленные реагенты / материалы / инструменты анализа: MCA JW.Написал статью: MCA GC.

Ссылки

  1. 1. Вейгель Д. (2012) Естественная изменчивость арабидопсиса: от молекулярной генетики к экологической геномике. Физиология растений 158: 2–22.
  2. 2. Алонсо-Бланко К., Аартс МГМ, Бенцинк Л., Керентес Дж.Б., Реймонд М. и др. (2009) Чему нас научили естественные вариации в развитии, физиологии и адаптации растений? Растительная клетка 21: 1877–1896.
  3. 3. Юнг С., Мюллер А.Е. (2009) Контроль времени цветения и применение в селекции растений.Тенденции в растениеводстве 14: 563–573.
  4. 4. Nave N, Katz E, Chayut N, Gazit S, Samach A (2010) Для развития цветков маракуйи Passiflora edulis требуется индуцированный фотопериодом системный сигнал, передаваемый трансплантатом. Растительная клетка и окружающая среда 33: 2065–2083.
  5. 5. Ван РХ, Фаррона С., Винсент С., Джокер А., Шуф Х и др. (2009) PEP1 регулирует многолетнее цветение Arabis alpina. Природа 459: 423 – U138.
  6. 6. Koskela EA, Mouhu M, Albani MC, Kurokura T., Rantanen M, et al.(2012) TERMINAL FLOWER1 - это переключатель между коротким и длинным цветением у дикой земляники, Fragaria vesca . Физиология растений 159: 1043–1054.
  7. 7. Battey NH, Le Miere P, Tehranifar A, Cekic C, Taylor S, et al .. (1998) Генетический и экологический контроль цветения клубники. Генетика и экологические манипуляции с садовыми культурами: 111–131.
  8. 8. Brown T, Wareing PF (1965) Генетический контроль вечной привычки и 3 других признаков у разновидностей Fragaria Vesca.Euphytica 14: 97–112.
  9. 9. Зислин Н., Мо Р. (1985) Роза. В: Халеви А.Х., редактор. Справочник CRC по цветению: CRC press. С. 214–225.
  10. 10. Ван РХ, Албани М.К., Винсент С., Бергонзи С., Луан М. и др. (2011) Aa TFL1 дает возрастной ответ на яровизацию у многолетнего Arabis alpina. Растительная клетка 23: 1307–1321.
  11. 11. Hsu CY, Adams JP, Kim HJ, No K, Ma CP и др. (2011) FLOWERING LOCUS Дупликация T координирует репродуктивный и вегетативный рост многолетнего тополя.Слушания Национальной академии наук Соединенных Штатов Америки 108: 10756–10761.
  12. 12. Mohamed R, Wang CT, Ma C, Shevchenko O, Dye SJ, et al. (2010) Populus CEN / TFL1 регулирует первое начало цветения, идентичность пазушных меристем и высвобождение покоя у Populus. Журнал растений 62: 674–688.
  13. 13. Kotoda N, Iwanami H, Takahashi S, Abe K (2006) Антисмысловая экспрессия MdTFL1 , TFL1-подобного гена, снижает ювенильную фазу у яблока.Журнал Американского общества садоводческих наук 131: 74–81.
  14. 14. Hsu CY, Liu YX, Luthe DS, Yuceer C (2006) Тополь FT2 укорачивает фазу молоди и способствует сезонному цветению. Растительная клетка 18: 1846–1861.
  15. 15. Болениус Х., Хуанг Т., Шарбоннель-Кампаа Л., Бруннер А.М., Янссон С. и др. (2006) Регулирующий модуль CO / FT контролирует сроки цветения и прекращения сезонного роста деревьев. Наука 312: 1040–1043.
  16. 16. Лоури ДБ, Уиллис Дж. Х. (2010) Широко распространенный полиморфизм хромосомной инверсии способствует значительному изменению жизненного цикла, локальной адаптации и репродуктивной изоляции.PLoS Biol 8: e1000500.
  17. 17. Хаяма Р., Йокои С., Тамаки С., Яно М., Шимамото К. (2003) Адаптация путей фотопериодического контроля приводит к короткодневному цветению риса. Природа 422: 719–722.
  18. 18. Hayama R, Agashe B, Luley E, King R, Coupland G (2007) Циркадный ритм, устанавливаемый с наступлением сумерек, определяет экспрессию гомологов FT и короткодневную фотопериодическую реакцию цветения у Pharbitis. Растительная клетка 19: 2988–3000.
  19. 19. Aikawa S, Kobayashi MJ, Satake A, Shimizu KK, Kudoh H (2010) Надежный контроль сезонной экспрессии гена FLC арабидопсиса в меняющейся среде.Труды Национальной академии наук Соединенных Штатов Америки 107: 11632–11637.
  20. 20. Серл I, Хе YH, Терк Ф., Винсент С., Форнара Ф. и др. (2006) Фактор транскрипции FLC дает ответ цветения на яровизацию, подавляя компетентность меристемы и системную передачу сигналов у Arabidopsis. Гены и развитие 20: 898–912.
  21. 21. Дэн У.В., Ин Х., Хеллиуэлл Калифорния, Тейлор Дж. М., Пикок В. Дж. И др. (2011) FLOWERING LOCUS C (FLC) регулирует пути развития на протяжении жизненного цикла Arabidopsis.Слушания Национальной академии наук Соединенных Штатов Америки 108: 6680–6685.
  22. 22. Helliwell CA, Wood CC, Robertson M, Peacock WJ, Dennis ES (2006) Белок FLC арабидопсиса взаимодействует непосредственно in vivo с хроматином SOC1 и FT и является частью высокомолекулярного белкового комплекса. Журнал растений 46: 183–192.
  23. 23. Майклс С.Д., Амасино Р.М. (1999) FLOWERING LOCUS C кодирует новый белок домена MADS, который действует как репрессор цветения.Растительная клетка 11: 949–956.
  24. 24. Шелдон С.С., Берн Дж. Э., Перес П. П., Мецгер Дж., Эдвардс Дж. А. и др. (1999) Ген FLF MADS box: репрессор цветения Arabidopsis, регулируемый яровизацией и метилированием. Растительная клетка 11: 445–458.
  25. 25. Finnegan EJ, Dennis ES (2007) Вызванное вернализацией триметилирование гистона h4 лизина 27 при FLC не поддерживается в митотически покоящихся клетках. Текущая биология 17: 1978–1983.
  26. 26. Angel A, Song J, Dean C, Howard M (2011) Переключатель на основе Polycomb, лежащий в основе количественной эпигенетической памяти.Природа 476: 105–108.
  27. 27. Le Corre V, Roux F, Reboud X (2002) Полиморфизм ДНК в гене FRIGIDA у Arabidopsis thaliana: обширная несинонимичная изменчивость согласуется с местным отбором по времени цветения. Молекулярная биология и эволюция 19: 1261–1271.
  28. 28. Лемпе Дж., Баласубраманиан С., Сурешкумар С., Сингх А., Шмид М. и др. (2005) Разнообразие реакций цветения у диких штаммов Arabidopsis thaliana. PLoS Genet 1: e6.
  29. 29. Йохансон Ю., Вест Дж., Листер С., Майклс С., Амасино Р. и др.(2000) Молекулярный анализ FRIGIDA, основного фактора, определяющего естественную изменчивость времени цветения арабидопсиса. Наука 290: 344–347.
  30. 30. Стинчкомб Дж. Р., Вайниг С., Унгерер М., Олсен К. М., Мейс С. и др. (2004) Широтная линия времени цветения у Arabidopsis thaliana, модулируемая геном времени цветения FRIGIDA. Слушания Национальной академии наук Соединенных Штатов Америки 101: 4712–4717.
  31. 31. Mendez-Vigo B, Pico FX, Ramiro M, Martinez-Zapater JM, Alonso-Blanco C (2011) Высотная и климатическая адаптация опосредована признаками цветения и генами FRI, FLC и PHYC у Arabidopsis.Физиология растений 157: 1942–1955.
  32. 32. Стрэндж А., Ли П., Листер С., Андерсон Дж., Вартманн Н. и др. (2011) Основные эффекты аллелей в относительно небольшом количестве локусов лежат в основе отчетливой яровизации и изменчивости цветения у образцов Arabidopsis. PLoS ONE 6: e19949.
  33. 33. Саломея П.А., Бомблис К., Лайтинен РАЭ, Янт Л., Мотт Р. и др. (2011) Генетическая архитектура изменения времени цветения у Arabidopsis thaliana. Генетика 188: 421 – U313.
  34. 34. Gazzani S, Gendall AR, Lister C, Dean C (2003) Анализ молекулярной основы изменения времени цветения у образцов Arabidopsis.Физиология растений 132: 1107–1114.
  35. 35. Майклс С.Д., Хе Ю.Х., Скоречи К.С., Амасино Р.М. (2003) Ослабление активности ЦВЕТУЩИХ ЛОКУСОВ C как механизм эволюции летне-ежегодного цветения арабидопсиса. Труды Национальной академии наук Соединенных Штатов Америки 100: 10102–10107.
  36. 36. Вернер Дж. Д., Боревиц Дж. О., Уленхаут Н. Х., Эккер Дж. Р., Чори Дж. И др. (2005) Не зависящие от FRIGIDA изменения времени цветения природных образцов Arabidopsis thaliana.Генетика 170: 1197–1207.
  37. 37. Shindo C, Lister C, Crevillen P, Nordborg M, Dean C (2006) Вариация эпигенетического молчания FLC вносит вклад в естественные вариации в реакции яровизации Arabidopsis. Гены и развитие 20: 3079–3083.
  38. 38. Sánchez-Bermejo E, Méndez-Vigo B, Picó FX, Martínez-Zapater JM, Alonso-Blanco C (2012) Новые естественные аллели в локусах FLC и LVR объясняют усиленные ответы яровизации в Arabidopsis thaliana .Растения, клетки и окружающая среда.
  39. 39. Guttridge CG (1985) Fragaria x ananassa. В: Х. Х.А., редактор. Справочник CRC по цветению: CRC Press, Inc. Бока-Ратон, Флорида. С. 16–33.
  40. 40. Sonsteby A, Heide OM (2008) Долгосрочный, а не автономный контроль цветения у диплоидной вечнозеленой земляники Fragaria vesca ssp semperflorens. Журнал садоводства и биотехнологии 83: 360–366.
  41. 41. Guttridge CG (1969) Fragaria.В: Т. Е.Л., редактор. Индукция цветения: Отдел растениеводства, CSIRO, Канберра. С. 247–267.
  42. 42. Кудо Г., Сузуки С. (2004) Фенология цветения тропических альпийских карликовых деревьев на горе Кинабалу, Борнео. Журнал тропической экологии 20: 563–571.
  43. 43. Дэрроу GM (1966) Клубника. История, разведение и физиология; Холт, Рейнхарт, Уинстон, редакторы. Нью-Йорк.
  44. 44. Albani MC, Battey NH, Wilkinson MJ (2004) Разработка маркеров SCAR, полученных из ISSR, вокруг СЕЗОННОГО ЦВЕТАНИЯ (SFL) в Fragaria vesca.Теоретическая и прикладная генетика 109: 571–579.
  45. 45. Ивата Х., Гастон А., Ремей А., Туруд Т., Джеоффр Дж. И др. (2012) Гомолог TFL1 KSN является регулятором непрерывного цветения розы и клубники. Журнал растений 69: 116–125.
  46. 46. Шеннон С., Миксвагнер Д.Р. (1991) Мутация в гене Tfl1 Arabidopsis влияет на развитие меристемы соцветий. Растительная клетка 3: 877–892.
  47. 47. Альварес Дж., Гули С.Л., Ю XH, Смит Д.Р. (1992) Терминальный цветок - ген, влияющий на развитие соцветий у Arabidopsis-Thaliana.Журнал растений 2: 103–116.
  48. 48. Брэдли Д., Рэтклифф О., Винсент С., Карпентер Р., Коэн Е. (1997) Приверженность соцветию и архитектура в арабидопсисе. Наука 275: 80–83.
  49. 49. Пнуэли Л., Гутфингер Т., Хэревен Д., Бен-Наим О., Рон Н. и др. (2001) SP-взаимодействующие белки томатов определяют консервативную сигнальную систему, которая регулирует архитектуру и цветение побегов. Растительная клетка 13: 2687–2702.
  50. 50. Kuittinen H, Niittyvuopio A, Rinne P, Savolainen O (2008) Естественная вариация яровности Arabidopsis lyrata, обусловленная полиморфизмом FRIGIDA indel.Молекулярная биология и эволюция 25: 319–329.
  51. 51. Osborn TC, Kole C, Parkin IAP, Sharpe AG, Kuiper M, et al. (1997) Сравнение генов времени цветения у Brassica rapa, B-napus и Arabidopsis thaliana. Генетика 146: 1123–1129.
  52. 52. Kole C, Quijada P, Michaels SD, Amasino RM, Osborn TC (2001) Доказательства гомологии генов времени цветения VFR2 из Brassica rapa и FLC из Arabidopsis thaliana. Теоретическая и прикладная генетика 102: 425–430.
  53. 53.Шранц М.Э., Кихада П., Сунг С.Б., Люкенс Л., Амасино Р. и др. (2002) Характеристика и эффекты реплицированного гена времени цветения FLC у Brassica rapa. Генетика 162: 1457–1468.
  54. 54. Лу П, Чжао Дж. Дж., Ким Дж. С., Шен С. X., Дель Карпио Д. П. и др. (2007) Локусы количественных признаков для времени цветения и морфологических признаков в нескольких популяциях Brassica rapa. Журнал экспериментальной ботаники 58: 4005–4016.
  55. 55. Окадзаки К., Сакамото К., Кикучи Р., Сайто А., Тогаши Е. и др.(2007) Картирование и характеристика гомологов FLC и QTL-анализ времени цветения Brassica oleracea. Теоретическая и прикладная генетика 114: 595–608.
  56. 56. Чжао Дж. Дж., Кулкарни В., Лю Н. Н., Дель Карпио Д. П., Бухер Дж. И др. (2010) BrFLC2 (FLOWERING LOCUS C) в качестве гена-кандидата для QTL яровизированного ответа у Brassica rapa. Журнал экспериментальной ботаники 61: 1817–1825.
  57. 57. Ван Н.А., Цянь В., Суппанц И., Вей Л.Дж., Мао Б.З. и др. (2011) Изменение времени цветения масличного рапса (Brassica napus L.) ассоциирована с аллельной изменчивостью в гомологе FRIGIDA BnaA.FRI.a. Журнал экспериментальной ботаники 62: 5641–5658.
  58. 58. Ким С.И., Пак Б.С., Квон С.Дж., Ким Дж., Лим М.Х. и др. (2007) Задержка времени цветения у Arabidopsis и Brassica rapa из-за сверхэкспрессии гомологов FLOWERING LOCUS C (FLC), выделенных из китайской капусты (Brassica rapa L. ssp pekinensis). Отчеты о растительных клетках 26: 327–336.
  59. 59. Tadege M, Sheldon CC, Helliwell CA, Stoutjesdijk P, Dennis ES и др.(2001) Контроль времени цветения ортологами FLC у Brassica napus. Журнал растений 28: 545–553.
  60. 60. Caicedo AL, Stinchcombe JR, Olsen KM, Schmitt J, Purugganan MD (2004) Эпистатическое взаимодействие между генами FRI арабидопсиса и генами времени цветения FLC порождает широтный клин в признаке жизненного цикла. Слушания Национальной академии наук Соединенных Штатов Америки 101: 15670–15675.
  61. 61. Parsley K, Hibberd JM (2006) Ген PPDK Arabidopsis транскрибируется с двух промоторов для получения дифференциально экспрессируемых транскриптов, ответственных за цитозольные и пластидные белки.Молекулярная биология растений 62: 339–349.
  62. 62. Leesmiller JP, Goodwin LO, Helfman DM (1990) 3 Новые изоформы тропомиозина мозга экспрессируются из гена альфа-тропомиозина крысы с использованием альтернативных промоторов и альтернативной обработки РНК. Молекулярная и клеточная биология 10: 1729–1742.
  63. 63. Forryschaudies S, Maihle NJ, Hughes SH (1990) Создание скелетных, гладких и низкомолекулярных немышечных изоформ тропомиозина из гена куриного тропомиозина-1.Журнал молекулярной биологии 211: 321–330.
  64. 64. Sullivan JA, Gray JC (2000) Светонезависимый мутант гороха по фотоморфогенезу 1 возникает в результате частичной дупликации COP1, генерирующей внутренний промотор и продуцирующей два различных транскрипта. Растительная клетка 12: 1927–1937.
  65. 65. Zhang PF, Chopra S, Peterson T (2000) Сегментарная дупликация гена генерировала дифференциально экспрессируемые гены, гомологичные myb в кукурузе. Растительная клетка 12: 2311–2322.
  66. 66. Wieczorek DF, Smith CWJ, Nadal-Ginard B (1988) Крысиный a-тропомиозин генерирует минимум шесть различных мРНК, кодирующих поперечно-полосатые, гладкие и немышечные изоформы путем альтернативного сплайсинга.Молекулярная и клеточная биология 8: 679–694.
  67. 67. Ruiz-Opado N, Nadal-Ginard B (1987) Организация гена a-тропомиозина. Журнал биологической химии 262: 4755–4765.
  68. 68. Hanke PD, Storti RV (1988) Ген тропомиозина-Ii Drosophila-Melanogaster продуцирует множественные белки за счет использования альтернативных тканеспецифичных промоторов и альтернативного сплайсинга. Молекулярная и клеточная биология 8: 3591–3602.
  69. 69. Kaufmann K, Pajoro A, Angenent GC (2010) Регулирование транскрипции в растениях: механизмы, контролирующие переключатели развития.Nature Reviews Genetics 11: 830–842.
  70. 70. Nah G, Chen ZJ (2010) Тандемная дупликация локуса FLC и происхождение нового гена у видов, родственных Arabidopsis, и их функциональное значение для аллополиплоидов. Новый фитолог 186: 228–238.
  71. 71. Ratcliffe OJ, Kumimoto RW, Wong BJ, Riechmann JL (2003) Анализ семейства генов Arabidopsis MADS, ВЛИЯЮЩИЙ НА ЦВЕТЕНИЕ: MAF2 предотвращает яровизацию короткими периодами холода. Растительная клетка 15: 1159–1169.
  72. 72.Caicedo AL, Richards C, Ehrenreich IM, Purugganan MD (2009) Комплексные перестройки приводят к новым химерным полиморфизмам слияния генов в кластере генов времени цветения MAF2-5 Arabidopsis thaliana. Mol Biol Evol 26: 699–711.
  73. 73. Razi H, Howell EC, Newbury HJ, Kearsey MJ (2008) Лежит ли полиморфизм последовательностей паралогов FLC в основе QTL времени цветения у Brassica oleracea? Теоретическая и прикладная генетика 116: 179–192.
  74. 74. Принц В. Э., Пикетт Ф. Б. (2002) Разделение пар: расходящиеся судьбы дублированных генов.Nature Reviews Genetics 3: 827–837.
  75. 75. Beckmann JS, Estivill X, Antonarakis SE (2007) Варианты числа копий и генетические признаки: ближе к разрешению фенотипической вариабельности генотипа.

Добавить комментарий

Ваш адрес email не будет опубликован. Обязательные поля помечены *