Примули: догляд в домашніх умовах і в саду. Секрети довгого цвітіння Первоцвітів.

Содержание

догляд в домашніх умовах і в саду. Секрети довгого цвітіння Первоцвітів.

Примула або Первоцвіт – одна з найпопулярніших декоративноквітучіх рослин. Її вирощують і у відкритому грунті, і в домашніх умовах. Примула радує квітникарів ранніми квітами, які з’являються ще взимку або ранньою весною, коли інші рослини перебувають у спокої.

У квіткових магазинах Примула (іноді її називають Примула кімнатна) з’являється саме до свят Дня Святого Валентина та Міжнародного Жіночого дня. Багато чоловіків дарують своїм жінкам цю прекрасну ніжну рослину замість букета. І, дійсно, вона набагато довше, ніж букет, залишається живою і яскравою. Але, незабаром втрачає свою декоративність, а то й зовсім вмирає. Відповідно, доводиться розлучатися з нею.

Чи є можливість продовжити цвітіння і життя Примули в домашніх умовах, чи можлива висадка рослини в сад? Як доглядати за Примулою в домашніх умовах, в умовах саду?

Примула. Догляд в домашніх умовах.

Примула звичайна – одна з найпопулярніших весняних рослин в кімнатному квітникарстві. Її люблять за яскраві численні квіти, які з’являються в лютому – березні. Якщо Вам подарували цю рослину і є бажання максимально подовжити її життя і цвітіння в домашніх умовах, дотримуйтесь наступних правил. Первоцвіту потрібні:

  • висока вологість повітря,
  • розсіяне сонячне світло,
  • порівняно низька температура – близько +15°С.

Вологість і полив. Сухе і гаряче повітря викликає пожовтіння листя, як і пересушування земляного кому. Рослину не слід переливати, проте грунт слід тримати вологим. Домогтися цього можна, використовуючи систему дренажу, яка не дозволить накопичуватися зайвій волозі і забезпечить хороший обмін повітря. Влітку рослину можна помістити на північне вікно. Незважаючи на те, що Примула кімнатна любить вологу, обприскувати її не рекомендується.

Добриво. У період цвітіння Первоцвітів необхідні добрива, переважно рідкі, проте їх використовують в обмеженій кількості, в основному, в період цвітіння.

Розмноження. Розмножується Первоцвіт двома способами: насінням і діленням куща. Висадка насіння проводиться в кінці літа або восени. Насіння Примули швидко втрачає всхожість, тому його висівають відразу після дозрівання. Розсаду квітів утримують в закритих тепличках при температурі +20°С. Такі рослини здатні зацвісти на другий, рідше на третій рік. Поділ куща також проводять в осінній період, щоб до початку весни отримати молоду квітучу рослину.

Шкідники та хвороби. Як і багато рослин з опушеним листям, Примула кімнатна нерідко уражається павутинним кліщем і попелицею. Найчастіше це супроводжується утриманням у сухому і спекотному приміщенні. Необхідно перенести рослину в прохолодне місце і збільшити вологість повітря. Можна обробити Первоцвіт мильним розчином або настоянкою часнику, більш ефективно – інсектицидними препаратами.

Надмірний полив також призводить до погіршення самопочуття рослини. Сіра гниль і борошниста роса, загнивання коріння – все це наслідки переливу. Необхідно різко скоротити полив, обробити квітку фунгіцидними препаратами. Уражені гниллю та шкідниками частини рослин необхідно обрізати. Для боротьби з борошнистою росою і іржею можна використовувати слабкий розчин бордоської рідини.

Висадка Примули в сад.

Найкрасивіші сорти Примули, які продаються у нас, дуже рідко виживають довго в умовах квартири. Тому якщо у Вас є сад, Ви краще освіжіть його яскравими квітами Примули. Для цього потрібно, щоб рослина збереглася максимально здоровою до середини – кінця весни, коли вулична температура дозволить висадити рослину в грунт. Простий догляд за Примулою допоможе в цьому:

  • Потрібно пересадити рослину в контейнер з більшою кількістю грунту і обов’язковим дренажем.
  • Забезпечити Первоцвіт невисокою температурою повітря (12-15°С).
  • Необхідно також сонячне вікно, але без прямих променів (зазвичай добре підходить притінений балкон).
  • Було б непогано створити додаткову вологість, влаштувавши невелику тепличку над рослиною.

Якщо Ви все зробили правильно, і Ваша Примула залишається здоровою до травня – сміливо висаджуйте її на постійне місце в сад. Якщо рослина цвіте, це не перешкода.

Догляд за Примулою в саду.

Примула, догляд за якою в саду нескладний, порадує Вас цвітінням ще довго.
Як доглядати за Первоцвітами в саду?

Грунт. Бажано, щоб грунт, в якому буде рости Первоцвіт, був родючим, зробіть суміш з додаванням листової землі і невеликої кількості якої-небудь органіки (гній або послід). В ідеалі перед посадкою на дні ями зробити дренаж з піску – це не дасть воді застоюватися, якщо не вийде – додайте пісок в суміш для посадки.

Полив. Добриво. Первоцвіт любить дуже хороший полив, рясно, але не часто – один-два рази на тиждень, в природних умовах ця рослина росте на вологих ґрунтах. Обов’язково потрібно використовувати фосфорно-калійне добриво три рази за період вегетації: два рази – навесні, один – влітку.

Освітлення. Температура. Ця рослина віддає перевагу відсутності прямого світла, було б непогано притінене освітлення вдень, а вранці і ввечері можливі сонячні промені. Сильно висока температура також не до вподоби Примулі.

Зимівля. Низькі температури Первоцвіт також складно переживає, тому по можливості накрийте рослину гілками або сухою соломою. При цьому обрізати старе листя не потрібно, навесні обережно зріжте його після появи молодих листочків.

В саду дуже добре виглядають бордюри з невисоких яскравих Примул, відмінно приживається Первоцвіт і на альпійських горках. Бажано висаджувати ці квіти щільними групами, щоб під ними не було видно землі.

Примула (75 фото): види, догляд та вирощування

Одного погляду на святкові відтінки примул достатньо, щоб назавжди зачаруватися їх променистою красою. Більше фото примул — в нашій галереї.

На пагорбах і узліссях яскраві пелюстки примули розпускаються раніше багатьох інших квітів. Навіть її найменування – Primulaveris – походить від латинського «primus» – перший. Стародавні германці і слов’яни називали сонячні дзвіночки первоцвітів «ключами весни», адже один з дикорослих видів цієї рослини дійсно нагадує в’язку золотих відмичок. Культурні сорти примули радують флористів барвистим розмаїттям відтінків і тривалим цвітінням. Протягом всього сезону ці чарівні букетики є справжньою окрасою підвіконь, балконів, клумб, терас і садів, життєрадісно вітаючи відродження сонця і тепла.

Опис та види

Примула, або первоцвіт – поширена рослина в помірних широтах Євразії і Північної Америки. У природі ці красивоцветущие трави зустрічаються на схилах гір, луках і околицях лісів. Примулу легко дізнатися по густій розетки щільних, рельєфних листя – по текстурі вони нагадують вовна молодих овець, каракуль, через що в народі первоцвіт ще іменують «баранчиками». З приходом весни з центру листової кошики піднімаються стебла з зонтиковидным або колосковым квітконосом (у високих видів) або розкривається безліч великих квіток на коротких стеблинках, утворюючи над зеленим підставою яскраву «шапочку».

Високорослі примули можуть досягати в довжину до 30-35 см, діаметр квітів – 2-4 див. Вони добре почуваються у відкритому грунті, невибагливі до догляду. Низькі, у яких пелюстки помітніше і ширше, користуються популярністю в якості кімнатних рослин, їх часто дарують на весняні свята. Особлива гордість селекціонерів – махрові сорти з пишними багатошаровими квітами, що нагадують розпустилися троянди.

Палітра відтінків у первоцвітів неймовірно багата: однотонні чергуються з виразними контрастами, ніжні градієнти – з візерунками, незвичайної окантовкою, мазками, прожилками. Центральна частина правильних пятилепестковых квіток найчастіше яскраво-жовта, навколо якої всілякі комбінації тонів виглядають ще більш насиченими.

До роду Примула зараховують понад 550 видів рослин, але для зручності їх можна умовно розділити на кілька секцій.

Зубчатолистная примула

Зубчатолистные примули відрізняються листям з дрібними щербинами по краях, а також красивим кулястим суцвіттям на довгому стеблі. Його висота може досягати 60-70 див.

Примула головчаста

Володіє подібним будовою, але, оскільки верхня частина суцвіття розпускається повільніше нижніх дзвіночків, форма квітки в цей час залишається плескатої. Стебло і розкрилися міні-бутони в голівчатих різновидів покриті білим нальотом, з якого рослина здається «припудреними».

Примула звичайна

Це низьке (15-25 см) безстебельна рослина з великою кількістю квіток. Представники цієї секції ідеально підходять для вирощування в кімнатних умовах, так і під відкритим небом. Вони можуть застосовуватися для створення живих бордюрів, доріжок, композицій на клумбах і рабатках.

Примула висока

Вона цвіте раніше всіх інших видів і стійко переносить зиму в природних умовах. Її довжина стебел досягає 30 см, а ось самі квіти невеликі – до 2 див. Забарвлення дикорослих високих первоцвітів досить скромна – зазвичай це рівномірний лимонний, білий або малиновий тон з жовтою серцевиною.

Полиантовая примула

Це гібрид на базі високих сортів. Діаметр квітів у неї більше, а забарвлення цікавіше – тут вже зустрічаються червоні, помаранчеві, фіолетові, пурпурні і навіть коричневі тони.

Посадка і розмноження примули

Більшість видів примули є багаторічниками, так що одна рослина може жити в горщику чи на вулиці більше десяти років. Розмноження здійснюється переважно насінням або поділом куща, дуже рідко – живцями.

Посів насіння бажано проводити не пізніше 6 місяців після збору, оскільки вони швидко втрачають схожість. Ідеальний час для початку процесу – грудень-січень, щоб до моменту появи паростків сонячний день був довгим.

Насіння висівають у легкий садовий грунт з поверхні і зверху не засипаються. Перші 3-4 тижні закритий кришкою контейнер з зволоженої землею і посівами зберігають у холодильнику – на самій теплій полиці або в дверцятах, при температурі близько +5C. Важливо, щоб субстрат не пересихав.

Після такої «штучної зими» ємність переносять на підвіконня (східний або західний) і відкривають кришку для доступу повітря до паросткам. Молоді сходи примули повинні завжди знаходитися в півтіні, також їм потрібна висока вологість і мінімум тепла (не більше +12…+15C).Влітку сіянці потрібно берегти від прямих променів сонця і пересихання грунту. В цілому, до пересадки розсади у відкритий грунт потрібно півтора року, а вона почне цвісти тільки на третій.

Поділ куща – самий зручний і доступний спосіб розмноження первоцвітів. Для цього доросле 3-5-літній рослину викопують і ділять на частини так, щоб у кожній було хоча б по одній нирці з корінням. Робити це краще всього відразу після закінчення періоду цвітіння, попередньо подкормив материнський кущ азотними добривами. Відокремлені паростки садять на постійне місце в лунки або нові горщики, поглиблюючи до колишнього рівня, після чого трамбують і регулярно поливають землю.

Живцювання примули проводиться, якщо немає коренів для поділу. У цьому випадку на рівні грунту зрізається пагін, який висаджують в увлаженную суміш садової землі та річкового піску. Росток залишають у світлому місці при +18C до появи листків, після чого він готовий до посадки.



Догляд за примулою

Враховуючи, що клімат середньої смуги для примул цілком звичний, ця рослина не можна вважати примхливим. Виняток становлять деякі позднецветущие сорти, які погано переносять заморозки. Так, низькорослим і крупноквіткових видами потрібно приділити більше уваги, ніж «диким» з високими стеблами – наприклад, на зиму ці кущі рекомендується вкривати великим шаром мульчі. В цілому ж первоцвіти невибагливі, і виростити їх може будь-хто.

Грунт

Грунт для примул повинна бути пухкою, добре пропускати вологу і повітря. У кімнатних умовах можна взяти суміш листової землі, торфу і річкового піску в рівних пропорціях. На дно горщика обов’язково покласти хороший дренажний шар. При посадці на вулиці в ґрунт варто внести перегній, пісок, перепріли листя, хвою. Слід уникати важких глинистих і кам’янистих грунтів – застій вологи, як і пересихання, згубно для цих рослин.

Освітлення

Первоцвіти люблять злегка затінені ділянки, але в ранкові та вечірні години сонце повинне добре освітлювати клумбу. Кімнатні примули не можна залишати на південних підвіконнях – краще перемістити їх углиб приміщення.


Зволоження

Поливати примули необхідно часто, щоб субстрат постійно залишався помірно вологим. Обприскування знадобиться тільки при надмірно або сухому жаркому повітрі, хоча досить просто прибрати горщик з рослиною в прохолодне місце. Садові первоцвіти досить зволожувати тільки на етапі укорінення розсади. Якщо місце прохолодне і тінисте, надалі примул буде достатньо дощу.

Підгодівля

Щоб кущі виглядали здоровими, ранньою весною їх поливають слабким розчином мінеральних добрив для красивоцветущих рослин, дотримуючись інструкції. На початку літа під корінь можна внести органіку, наприклад, перегній. У серпні примули удобрюють невеликою кількістю аміачної селітри або ж калієм (15 г на 10 л води) і суперфосфатом (20 г на 10 л води).


Боротьба з шкідниками і хворобами

Дотримання перелічених умов – запорука того, що рослини будуть міцними і квітучими, але іноді навіть правильна агротехніка не рятує від атаки комах або хвороб. У боротьбі з ними допоможуть спеціальні препарати – инсектециды і фунгіциди. Іноді вельми корисні і звичайні аптечні розчини, які є в кожному будинку, або ж народні засоби: попіл, настоянки часнику, цибулиння, махорки, сік алое і т. д.

Основні шкідники примули:

Нематоди – видають себе здуттями і викривленнями стебел. Щоб позбавитися від них, грунт обробляють сіркою. На клумбах хорошим профілактичним засобом послужать чорнобривці, що ростуть по сусідству.

Попелиця – з’являється при нестачі фосфорної кислоти, а помітити її можна з липким білим або чорним точкам на стеблі і з внутрішньої сторони листків. Для усунення можна використовувати інсектициди або біоактивні кошти, настій часнику, цибулі або тютюнових листків, мильний розчин (100 г дегтярного мила на 10 л води), настій попелу (1 склянка золи на 5 л води, витримувати 12 годин).

Слимаки – можуть шкодити примул в тому випадку, якщо вона росте на вологому ділянці або якщо тривалий час ідуть дощі. Доведеться збирати равликів вручну або пересадити кущі на сухе місце.

Хвороби первоцвітів, в основному, провокують грибки. Вони можуть проявлятися у вигляді іржі на листках, сірих і бурих плям, гнилей на коренях та стеблах. Знищити шкідливі спори допомагає обприскування бордоською рідиною або Фитоспорином, але головне – не допускати перезволоження рослин, правильно регулюючи полив.


Примула — фото

У нашій фотогалереї Ви знайдете багато зображень з первоцвітами. Тут зібрані фото різноманітних видів і сортів примули, які можуть стати яскравим весняним прикрасою для інтер’єру або садової ділянки.

В композиціях з іншими рослинами або навіть самі по собі первоцвіти створюють привабливий візерунок на клумбах, кам’янистих гірках, навколо водойм, вздовж стежок і доріжок. Одного погляду на святкові відтінки примул достатньо, щоб назавжди зачаруватися їх променистою красою і з розчуленням насолоджуватися цими квітами у себе в квартирі або на дачі.
































Вирощування примул з насіння, зберігання, висаджування розсади

Принадність полягає примули, в першу чергу, в її ранньому цвітінні. На відміну від багатьох інших первоцвітів, вона не прагне до яскравим сонячним променям і з задоволенням зростає в пристовбурних колах садових дерев або чагарників. Зате тут, у відсутність конкуренції з боку інших квітучих рослин, вона в повній мірі демонструє свої декоративні якості.

Квіти примули у всій своїй природній красі і насиченості кольору.

Найпоширенішим способом розмноження примул є насіннєве. Вирощування примул з насіння дозволяє не тільки заощадити кошти, але і одержати більш різноманітні і стійкі до конкретних умов життя рослини. Однак це заняття трудомістке і непередбачуване: навіть при дотриманні всіх правил завжди існує ймовірність не дочекатися сходів. Причин цьому може бути кілька, починаючи з якісного насіння.

Я живу в Україні, особисто мені зручно вибирати і купувати різні насіння овочів, трав, захисних засобів, в тому числі і якісне насіння квітів, у агромагазина ФлораСад – https://florasad-agro.com.ua. Зручно вибрати всі потрібні насіння і отримати у відділенні Нової Пошти.

Зберігання Насіння примули

Якщо ви не хочете сіяти насіння в грунт, для пророщування кольорів, відразу ж після отримання, помістіть пакети в банку з кришкою, що загвинчується та зберігайте їх у холодильнику, а не в морозильній камері, поки вони не знадобляться. Такий спосіб зберігання насіння, дозволить їм залишатися життєздатними протягом кількох років перебування, в холоді холодильника.

Якість насіння квітів примули

Купуючи насіння, обов’язково потрібно звертати увагу на термін придатності, точніше, на дату розфасовки. Насіння примул швидко втрачають схожість, вже через рік шанси на успішне пророщування починають стрімко танути.

Фото приклад, як виглядають насіння примули вечірньої, сушені і цілі зерна насіння.

Якщо на ділянці вже ростуть дані квіти, можна зібрати насіння з них. У цьому випадку схожість буде значно вище. При виростанні на ділянці декількох сортів квітів примули, можливо перезапилення, тоді можуть з’явитися гібриди, відрізняються від батьківської рослини.

Умови пророщування насіння примули

Практично всі примули, за винятком дрібнозубчастою і обконики, потребують стратифікації. Її можна проводити декількома способами.

  1. Намочити 2 ватних диска, помістити насіння між ними і залишити на 2-3 дня в ємності з кришкою. Потім переставити контейнер в холодильник і регулярно перевіряти. По мірі проростання висаджувати насіння в ящики з ґрунтом.
  2. Посіяти насіння в ящики під плівку і помістити в холодильник на пару тижнів.
  3. Природна стратифікація: контейнер з посадженими насінням вкопати на ділянці врівень із землею, на зиму вкрити.

Використовувати компост

Розсада примули дуже чутлива до вмісту мінеральних солей, містяться в добривах. Якщо суміш занадто сильна, саджанці можуть не зростати взагалі, або молоді корені можуть бути пригнобленими. Завжди використовуйте компост для посадки насіння і шукайте піщаний ґрунт, з волокнистими добавками, по можливості. Коріння примули дуже потрібен повітря, щоб рости і розвиватися. Якщо компост занадто гарний, кілька поливів заженуть весь повітря.

Правила посіву і змісту

Сіяти насіння примули в потрібний час

Підготовка землі і скриньки-горщика, для пророщування насіння наших квітів.

Найкращий час для сівби насіння квітів примули в землю – це з лютого по квітень місяць. Невеликий мороз може допомогти проростання, але в дуже суворих районах слід відкласти посів до березня або квітня. Ви все одно отримаєте квіти до наступної весни, якщо ви посієте до кінця травня. Посіви можна виробляти в червні або до кінця липня, якщо це дійсно необхідно, до тих пір, поки ви тримаєте їх прохолодними і вологими. Чим пізніше ви залишите його, тим складніше буде привезти невеликі рослини, які не встановлені протягом зимового сезону. Примули найкраще сіяти землю з листопада по січень і залишати насіння зовні. Їх можна перемістити в затінену рамку в лютому.

Сходи примули потребують світлі та повітрі для проростання. Вегетативний період триває у примул близько півроку, тому на розсаду їх починають садити на початку лютого. Посів проводять поверхнево, так як проростання відбувається на світлі. При цьому насіння треба вдавити в грунт, щоб з’явилися корінці могли проникнути в грунт і не засохнути. Для збереження вологості і підтримання постійної температури ящик накривають плівкою або склом.

Фото приклад початківців проростати насіння примули, у попередньо засіяному землею ящику-ємності.

Високі температури перешкоджають проростанню. Висихання – особливо в момент проростання-зазвичай є фатальним . Не садіть насіння під скло, так як в сонячні дні температура повітря підвищується, навіть взимку!! Ідеальна температура проростання становить від 12 до 15 градусів за Цельсієм. Більш низькі температури не заподіюють шкоди,але все, що вище 18 градусів за Цельсієм, смертельно. Ніколи не використовуйте нагріваючий пропагандатор. Оптимальна температура – приблизно 15° тепла. Невелике зниження навіть корисно, а при більш високій температурі проростання сповільниться.

Пророслі насіння квітів примули, на фото прикладі, у невеличкій теплиці, по окремим секціям, для зручності висадки у відкритий грунт.

Надалі молоді рослинки містять в прохолоді і при достатній вологості, уникаючи переливів і скупчення конденсату. У відкритий грунт переносять, висаджують пророслу розсаду квітів примули, коли мине загроза заморозків.

Ваша праця з лишком окупиться, тією чудовою красою гри кольору квітів примули, в декорі вашої ділянки, саду, городу.

Красиві, різнокольорові, з вибраним конкретним кольором квіти примули.

Ще одне фото приклад засадженої клумби квітами примули вечірньої.

Сподобалася стаття? Легко поділитися закладкою з друзями, в соц. мережах:

Примула кімнатна: догляд, розмножування, сорти фото

Яскрава примула є одною з найпопулярніших однорічних і багаторічних трав’янистих рослин. весняних первоцвітів. Загальна назва роду походить від латинського слова «primus», що означає ранній, перший, вказуючи на раннє цвітіння культури.

Батьківщиною її є Північна Америка та Азія, поширена в горах Криму і Кавказу, в країнах Європи з помірним кліматом.

Всього налічується близько 500 представників роду, але тільки кілька видів азійського походження вирощуються як кімнатні рослини.

Зусиллями селекціонерів було виведено велику різноманітність досить витривалих сортів і гібридів, які відрізняються величезною різноманітністю колірної гамми.

Довге овальне листя, що зібране в прикореневу розетку, обрамляє букетик яскравих великих квітів усіх відтінків веселки: жовті, помаранчеві, коричневі, рожеві, фіолетові, сині або білі. Висота кущика не більше 25-30 см.

Як правило, в домашніх умовах рослина розглядається як однорічна, але якщо забезпечити кімнатній примулі правильний догляд, то тим самим можна надовго продовжити не тільки цвітіння, але і життя цього чудового первоцвіту.

Популярні види

Примула звичайна (Primula acaulis) є гібридом і найчастіше її культивують у відкритому ґрунті, але є кілька ефектних кімнатних мініатюрних сортових форм.

Цвітіння дуже тривале. Головним недоліком виду є висока чутливість до більш високих температур – кущик швидко в’яне.

«Арлекін біколор»

Відомі сорти: «Арлекін біколор» з особливо великими квітками, «Джекпот», абрикосовий «Ѕрһіпх Apricot», «Belarina series», бордові квіти якого схожі на троянди, червоно-помаранчевий «Notso Prim»

Багаторічна примула (Primula obconica) родом з Китаю. Найпоширеніший кімнатний вид первоцвіту. Квітки діаметром до 8 см можуть бути білі, червоні або всіх відтінків рожевого та фіолетового з характерним зеленим вічком посередині зібрані в пишний букет.

Primula obconica настільки популярна в Німеччині, що її там називають «Німецька весняна троянда». Цвітіння у неї дуже тривале і часто повторне. Один з найпопулярніших сортів «Twilly Touch Me».

Primula obconica

Одно-дворічна примула м’яколиста або мальвоподібна (Primula malacoides).

Цей вид, мабуть, найцікавіший та гарний, з-за неймовірно великої кількості ефектних ароматних квітів, зібраних в кільчасте суцвіття.

Primula malacoides

Численні квітки розкриваються поступово, прикрашаючи рослину протягом 3 і більше місяців. Деякі з численних сортів: «Марс», «Снігова королева», «Beauty Mix» з махровими квітками, «Білі перли», рожева «Fair Lady».

Як доглядати за кімнатною примулою після покупки

Температура

Первоцвіти з’являються в березні – на початку квітня, коли повітря ще прохолодне, а ґрунт насичений вологою, тому ключовими факторами у вирощуванні кімнатної примули є температура і вологість.

Як тільки рослина почне цвісти, видаляйте старі квітконоси, це стимулює формування нових бутонів та забезпечить рясне цвітіння примули

Оптимальний температурний режим, що надовго продовжує цвітіння, становить 10-16 °C, а взимку в період спокою можна знизити до 7-10 °C. В теплому приміщенні листя і квіти швидко в’януть.

Прохолодні умови утримання можна створити, помістивши горщик на утеплений балкон. Добре знижує температуру тарілка з колотим льодом, що поставлена недалеко від рослини.

Первоцвіт любить свіже повітря, тому горщик в середині квітня бажано винести на балкон або терасу.

Полив

Примула потребує підвищеної вологості повітря і ґрунту в період бутонізації та цвітіння. Полив проводять, як правило, 2 рази в тиждень, коли верхній шар ґрунту підсохне на 1 см.

Ґрунт має бути весь час помірно вологим. На недолік і надлишок вологи кущик реагує пониклим листям.

При поливі уникайте попадання вологи в центр листяної розетки, тому що це може призвести до розвитку гнилі, а зайву воду з піддона виливайте.

Для процедури використовують прохолодну, але м’яку воду. Ідеальним варіантом буде дощова. Взимку в період спокою полив скорочують.

Керамзит для рослин, властивості та застосування

Підвищити вологість повітря можна за допомогою місткості, що наповнена водою з керамзитом і мохом або розбризкуючи воду недалеко від квітки.

Освітлення

Найкращим місцем для примули в домашніх умовах буде яскраве розсіяне світло. Прямі промені призводять до опіків і в’янення листя і скорочують період цвітіння. Оптимальним варіантом розміщення будуть східні або західні вікна.

Як виростити ананас в домашніх умовах

Догляд за кімнатною примулою після покупки полягає також у своєчасному видаленні зів’ялих квіток, в іншому випадку можливий розвиток грибкової інфекції.

Підживлення

Підгодовують рідким комплексним добривом для квітучих кімнатних рослин в період цвітіння і бутонізації один раз у два тижні, використовуючи половину дози від рекомендованої на упакуванні.

Як пересаджують

Багаторічні примули пересаджують один раз на рік у вересні. Вибирайте горщик широкий і неглибокий, тому що корені у рослини короткі.

5 найкорисніших декоративних кімнатних рослин

Інструкція з пересадки примули кімнатної:

  • на дно нового горщика укладають дренаж. Його повинно вийти близько ⅓ обсягу;
  • потім насипають частину суміші;
  • за кілька годин до пересадки примулу поливають, щоб було легше виймати;
  • постукуючи по корпусу, потрібно домогтися відділення кореневої кулі від стінок. Але в керамічному горщику такий спосіб не працює. Тоді рослину відокремлюють, провівши тильною стороною ножа уздовж борту горщика;
  • тепер потрібно трохи розпушити коріння по краях і поставити примулу в новий горщик;
  • досипати ґрунт;
  • полити рослину;
  • переконатися, що коренева шийка знаходиться вище поверхні ґрунту;
  • у разі потреби трохи ущільнити землю біля розетки.

Розмноження

Існує 3 способи розмноження примули.

Перший – шляхом відділення від листяної розетки бічних відростків ранньою весною. Їх поміщають в окремі горщики й накривають банкою. Ґрунт має бути весь час вологим. Після вкорінення банку прибирають.

Другий спосіб – живцюванням довгих кореневищ з точками зростання, які розташовані дуже близько до ґрунтової поверхні.

І третій – вирощування примули з насіння.

Для посіву беруть неглибокий контейнер з дренажним шаром, наповнений торфо-піщаною сумішшю. Ґрунт добре полийте і на поверхні розподіліть насіння, збризкайте їх кип’яченою водою кімнатної температури та накрийте плівкою.

Для проростання насіння примули необхідні низькі температури (2-3 °C), тому контейнер ставлять у холодильник.

Щотижня провітрюйте насіння, піднімаючи плівку на кілька хвилин. Тільки після появи паростків місткість можна вийняти з холодильника і поставити в тепле місце з яскравим розсіяним світлом.

Щодня на 10-15 хвилин знімайте накриття для провітрювання, через тиждень збільште час і потім зовсім приберіть плівку. Коли з’являться перші два-три листочки, проводять пікірування розсади в окремі горщики.

Молоді саджанці після пересадки підгодовують комплексним добривом. Через 2-3 місяці можна чекати цвітіння.

Цікавий момент – насіння настільки дрібне, що його можна пророщувати в мокрій ваті, губці та навіть на мокрому ватяному диску.

Корисні властивості

  • У листі рослини містяться вітаміни, каротин, полісахариди, амінокислоти.
  • Свіжими їх додають у весняні салати.
  • З висушених частин роблять відвари, що допомагають при бронхіті та інших захворюваннях органів дихання. Засіб допомагає відводити мокроту, діє як заспокійливе.
  • У коренях первоцвітів міститься ефірна олія.

Догляд за кімнатною примулою в період спокою

Щоб примула радувала вас пишним і тривалим цвітінням, потрібно забезпечити їй гідний догляд в період спокою. Деякі новачки викидають примулу відразу після цвітіння, але не треба цього робити, дайте примулі другий шанс.

Після того, як примула відцвіла, помістіть квітку в добре провітрюване, прохолодне та затемнене приміщення з температурою в межах 10-16 градусів. Поливають в цей період рідше.

Хвороби й шкідники

Примула страждає від павутинного кліща. Симптоми ураження шкідником – пожовтіння, а потім і опадання листя. Міра боротьби – застосування інсектицидних препаратів.

Рослина може піддаватися нападу попелиці, що викликає деформацію листя. Якщо попелиці мало, обробляють квітку настоянкою з тютюну або мильним розчином. При сильному ураженні використовують для боротьби з попелицею препарат «Актелік» або карбофос.

Комахоїдна росичка – рослина хижак в домашніх умовах

Часто примула уражується такими захворюваннями, як коренева і стеблова гниль. Викликає хвороба через неправильний полив. Необхідно знайти золоту середину, тому що субстрат при вирощуванні кімнатної примули мусить бути постійно вологий і є ризик закисання ґрунту.

Листя примули жовтіє, обпадають бутони

Із-за надлишку вологи можливо гниття кореневої системи та стебел. Проведіть екстрену пересадку. Видаліть уражені ділянки, обробіть фунгіцидом. Полив відрегулюйте.

Листя жовтіє

Відбувається це з ряду причин: підвищена температура або сухість повітря, ґрунт перезволожений, полив жорсткою, холодною водою, надмірні підживлення;

Скидання бутонів, квіти швидко в’януть

Сухість повітря, підвищена температура повітря, нестача вологи в ґрунті.

Що робити, якщо кімнатна примула вражена сірою гниллю

Ви бачите, що ваша рослина захворіла на сіру гниль і відразу замислюєтеся, через що це сталося. Причиною цієї хвороби може стати неправильний полив, якщо при поливі примули вода потрапила на листя, також причина в підвищеній вологості повітря.

В результаті чого на листі примули з’являється сірий наліт. Цим захворюванням зазвичай хворіють примули у весняний і осінній час, коли після заморозків настає тепла, сира погода.

Щоб цього не відбувалося, земля між поливами повинна просихати. При цій хворобі видаляють старе листя. З хімічних засобів використовують препарати Фітоспорін-М, Алірін-Б, Гамаір.

Автор: Юлія Закревська

Як розмножити примули в серпні

Примула відноситься до тих квітів, які не вимагають від нас особливої уваги. Головне — посадити її вчасно і на правильне місце, і вона буде радувати всіх своїми яскравими фарбами довгий час, інформує Ukr.Media.

Ці невисокі рясноквітучі рослини давно стали для квітникарів справжньою паличкою-виручалочкою. Їх садять на альпійських гірках і в рокарії. Примули прикрашають собою тінисті куточки саду. Вони — на передньому плані в будь-якому міксбордері. Яскраві, невибагливі, посипані квітами протягом декількох тижнів — що може бути краще?

Як можна розмножити примулу

Примула — одна з найпоширеніших на землі квітів: відомо близько півтисячі видів. Багатьом садівникам вона більше відома як “первоцвіт “. Ця назва точно передає головну достойність квітки: вона розпускається навесні одною з перших. Коли навколо все ще сіре і похмуре, жовті, червоні, малинові, фіолетові квіти примули нагадують усім про швидку весну і піднімають настрій.

Щоб ранньою весною первоцвіти порадували вас своїм цвітінням, треба в кінці липня — середині серпня зайнятися їх розмноженням. Розмножувати примули можна наступними способами:

  • діленням куща;
  • листовими живцями;
  • насінням.

Розмноження діленням куща примули

Примули, завдяки своїй невибагливості, можуть рости на одному місці багато років. Проте досвідчені квітникарі рекомендують кожні 3-4 роки їх пересаджувати. Причини дві:

  1. Без пересадки квітки примул дрібнішають, а цвітіння стає не таким рясним, як в перші роки.
  2. Придаткові корені відростають і починають виступати з землі; опинившись вище рівня ґрунту, вони швидко висихають.

Пересадку примул часто поєднують з поділом куща, бо для розмноження годяться саме такі — старше трирічного віку — кущі. Як правильно розмножувати примулу діленням куща?

  1. Щоб кущ було легше викопувати, рясно полийте його водою.
  2. Дістаньте рослину з землі і звільніть від ґрунту, щоб всі корені були добре видні.
  3. Акуратно розділіть кущ на частини. Частка може складатися з однієї листової розетки з корінням. Цього достатньо, щоб примула прижилася.
  4. Щоб коріння рослини не встигли підсохнути, відразу пересадіть її в підготовлені заздалегідь лунки. Не забувайте про правильну відстань між кущами. Для низькорослих примул вона повинна складати 10-15 см, для більш високих рослин — 25-30 см. Такі інтервали невипадкові. Коли кущики підростуть, між ними не повинно бути відкритих ділянок землі. Тінь від листя допоможе захистити коріння і ґрунт від висихання. Для вологолюбних примул це дуже важливо.

Пересаджені примули перші 14 днів потрібно поливати щодня. Це буде сприяти їх швидкому укоріненню.

Якщо пересаджувати кущ ви не плануєте, а хочете тільки отримати кілька часток для розмноження, скористайтесь хитрістю досвідчених квітникарів. Викапувати всю квітку з землі не варто. Підкопайте ґрунт тільки з тієї сторони, де збираєтеся взяти відросток. Гострим ножем відріжте держак і відразу засипте лунку землею. Так кущ буде менше травмуватися.

Як розмножити живцями примулу

Примула легко переносить також розмноження листовими живцями.

Відокремте гострим ножем листовий відросток і посадіть його в парничок. Якщо у вас немає такого укриття, можна скористатися скляною банкою або поліетиленовим пакетом, які створять потрібний мікроклімат. Ґрунт усередині необхідно постійно підтримувати у вологому стані. Росток також повинен бути захищений від прямих сонячних променів, бо примули — тіньолюбні рослини. В таких умовах держак вкорениться за 2-3 тижні.

Щоб незміцнілі рослини взимку не вимерзли, їх краще залишити зимувати в парничку, а на постійне місце висадити тільки навесні. Якщо такої можливості немає, то обов’язково укрийте молоді рослини в холодний період сухим листям шаром 10-15 см

Для деяких видів примули, наприклад примули аурикула, можна домогтися збільшення числа живців дуже простим способом. Прищіпайте у рослини точку зростання — це призведе до пробудження бічних бруньок. Коли вони підростуть, у вас буде багато живців для розмноження.

Деякі первоцвіти, наприклад примула мілкозубчаста, можна розводити також і кореневими живцями.

Виберіть великий кущ і відокремте від нього кілька сильних, товстих коренів. Щоб бруньки утворювалися швидше, у верхній частині кожного кореневого черешка зробіть невеликий поздовжній надріз — 1-1,5 см. В парничок додайте пухкий ґрунт і висадіть туди підготовлене коріння на глибину 3 см. Подальші дії з ними схожі з розведенням примул листовими живцями.

Як розмножити примулу насінням

Самим довгим і трудомістким вважається процес розмноження примул насінням. Вони дуже швидко втрачають схожість, тому висівати їх краще відразу після збору, в кінці серпня — вересні.

У підготовлену землю (листовий перегній, річковий пісок і торф у співвідношенні 2:1:1) посійте насіння і накрийте їх плівкою. Сходи при осінньому посіві з’являться нескоро. Після проростання насіння сіянці потрібно поступово привчати до свіжого повітря. Для цього щодня на деякий час відкривайте укриття. Через 2 тижні повністю зніміть плівку. Після появи двох справжніх листочків розсадіть сіянці. Якщо дозволяють погодні умови, то висаджувати їх можна відразу у відкритий ґрунт. Обов’язкова умова — укриття на зиму.

При насіннєвому способі розмноження цвітінням примул ви зможете помилуватися лише на третій рік.

Примула махровая. Статьи компании «Семейный Сад»

Примула махровая. Сорта. Уход. Размножение.

Мы уже писали о махровой примуле , но по многочисленным просьбам решили более подробно еще раз написать о примуле махровой, так как с каждым годом ее разнообразие сортов и оттенков стало в 2 раза больше. 
На сегодняшний день многие страны взялись выводить все новые сорта примулы махровой, Франция, Нидерланды, Норвегия, Италия, Англия, Германия.  Это основные страны которые стали специалистами по выведению садовой махровой примулы. Честно сказать мы не успеваем за разнообразием сортовой гибридной примулы , ведь на сегодняшний день появилось более 120 сортов .
Но не все сорта подходят для высадки в саду, 
есть сорта махровой примулы , которые пригодны для домашнего применения и такие примулы просто погибнут в наших садах. Также имеются сорта махровой примулы 2х летние, такие примулы после отцветания попросту погибают и предназначены такие примулы как подарочный вариант.
Сегодня на наших рынках продают разных красавцев , мимо которых невозможно пройти. Но как понять что это за сорт.

                                  СОРТА ПРИМУЛ МАХРОВОЙ МНОГОЛЕТНЕЙ :

Примула махровая серии ” Балерина” – пожалуй самая неприхотливая безстебельная махровая примула. Эта примула считается вечнозеленой. Даже зимой она сохраняет свои листочки зелеными. Цветет она с марта и на протяжение 2-3х месяцев, сменяя цветки друг с другом. Посадка такой примулы можно в полу тени и на солнечных участках. Любит влагу, но не любит застоя воды. Осенью в конце сентября – октябрь зацветает повторно. Выдерживает морозы до – 28.

Сорта махровой примулы зимующие в наших садах.

сорт ” Валентина”
 Яркая насыщена махровая красная примула ” Валентина ” из серии безстебельных примул ” Балерина”

Сорт ” Аметист Айс”
 Цветки махровые фиолетовые с белой окантовкой по краю лепестка

Сорт ” Блю Сапфир”
 Цветки ярко-синие насыщеные в центре имеется желтый цент.

Сорт ” Нектарин”
 Пожалуй самая загадочная примула Нектарин , цвет персикого- оранжевый по краю лепестков на 2 оттенка темнее.
меняет оттенок свой на протяжении всего сезона. Относится к хамелеонам.

Сорт ” Баттер Еллоу”
 Самая быстрорастущая примула серии Балерина . Требует деление куста раз в 2-3 года.

Сорт ” Пинк Айс”
 Нежно розовая , при отцветании цветки становятся белыми, имеет притный ландышовый аромат.

Сорт ” Крим” 
 Сорт быстро-растущий. Цветки белые с кремовым оттенком. имеет приятный аромат. 

Сорт ” Бургунди Айс”
 Очень интересный сорт темно-бордовая с белой окантовкой.

Сорт ” Елизабет Киллелей “
 Известная многим садоводам ,  Ценится за морозоустойчивость . Недостатки : медленно растет. 

Сорт ” Кэти миссис Спарон”
 Новый сорт известной дикой примулы ключики. Сорт выдерживает морозы -35. Достаточно быстро растет.

Сорт ” Корпорал Бакстер”
 Также является полиантовой . Растет достаточно быстро. Выдерживает морозы – 28. Не любит застоя воды. Предпочитает солнечные участки.

Сорт ” Квакерс Боннэт”
 Относится к полиантовым примулам. Не прихотливая , быстро растет . морозостойкость -30.

Сорт ” Блю Айс”
 Очень красивая нежная примула , цвет ярко-голубая. Цветение обильное и продолжительное. Повторное цветение осенью. Растет достаточно быстро. Морозостойкость – 28.

Сорт ” Саншин Сюзи”
  Неприхотливая махровая полиантовая примула. Морозостойкость – 28. Цветение продолжительное.

Сорт ” Кэт Дерман”
 Неприхотливая красивая , по краю лепестков легкая волнистость. Морозостойкость – 28.

Сорт ” Роуз Пинк Букет”
 Эта серия” Букет” новых английских махровых примул, пожалуй самая яркая и красивая. Цветение позднее в апреле – мае. Растет медленно, но они того стоят. Цветут обильно и долго . Также не любят застоя воды. предпочитают полу тенистые участки. Необходим дренаж при посадке. Морозостойкость – 27.

Сорт ” Пурпле Букет”
 Серия примул Букет. Сорт достаточно быстро растет , поздне цветущий  апрель – май. Морозостойкость – 28.

Сорт ” Роуз Бургунди Букет”
 также является полиантовой примулой . Недостатки медленно растет. Но стоит ждать. Цветоносы крупные темно-бордовые по краю белая окантовка. Зимостойкость – 28. – 30.Предпочитает полу-тенистые места.

Сорт ” Лилас Пурпле Букет” 
 относится к полиантовым примулам. Цветение апрель – май. Цвет насыщено сиреневый. Растет медленно. морозостойкость – 30. Предпочитает полу тенистые участки. Как и всем махровым примулам необходим дренаж.

Сорт ” Дав Ансел” 
 Относится к полиантовым примулам , цвет белый с желтым центом . Место посадки полу тенистые участки. Морозостойкость – 28

Сорт ” Бон Аккорд Пурпле”
 Относится к полиантовой примуле. Не прихотлива. Растет на солнечных участках и полу тени. Морозостойкость – 30.

Сорт ” СноуГуз”
 Относится к полиантовым поздне цветущим примулам. Зимостойкость -30.

Сорт ” Мисс Индиго”
 Относится к полиантовым поздне-цветущим сортам. Цвет изменчевый от синего до фиолетового, относится к хамелеонам.

Сорт ” Меленох” 
 Относится к полиантовым примулам. Цвет желтый. растет быстро. Морозостойкость – 30.

Сорт ” Стронг бир”
 Относится к безстебельным примулам. Цвет насыщенно темно фиолетовый. Достаточно быстро растет. Морозостойкость – 30.

Сорт ” Пинк Боннет”
 тносится к бестебельным примулам. Цветение позднее и продолжительное. осенью повторное цветение. Морозостойкость – 27.

Сорт ” Кобальт Блю ” 
 Сорт Кобальт Блю пожалуй одна из самых любимых и неприхотливых сортов, цветки крупные до 5-7см в обьеме. растет достаточно быстро. Зимостойкость – 27.

Все эти сорта имеются в нашей коллекции , и с каждым годом выискиваю другие сорта махровых примул. 
Какие уже достаточно размножились всегда имеются весной в продаже.

            Размножение махровой примулы:
Примулы абсолютно не прихотливы в уходе. И если их правильно посадить то в благодарность они порадуют вас обильным неповторимым цветением.

Все сорта махровых примул предпочитают полу тенистые участки. 
Я уже писала что перед посадкой примулы обязательно необходим дренаж на дно ямки. Потому как такие сорта не любят застоя воды И могут просто погибнуть от избытка влаги. 

Пересадка примул предпочтительно весной и осенью.
Весной можно сажать и пересаживать даже во время цветения. 
а осенью необходимо это делать в конце сентября – ноябрь, до наступления морозов.
Важно также знать что примулы махровые нельзя заглублять выше шейки как при посадке аурикул. Правильно сажать на уровне шейки .

Как правильно разделить куст примулы для размножения? Такой вопрос я также часто слышу от наших клиентов. 
Для размножения я обычно делю кусты по осени. Полностью выкапываю маточный куст и ножом делю его на розетки ,
 
Потом отдельно рассаживаю либо в открытый грунт либо по горшкам . 
Листики старые все обрываю снизу, это дает нам дополнительно прирост новых листьев и будущих цветоносов. если имеются старые цветоносы их также необходимо срезать. 
Если посадка примул идет в грунт то я помимо дренажа делаю легкую землю, добавляю туда сухой перлит. 
Перлит нам дает воздушность грунта и тогда примула будет обильнее цвести. После посадки необходимо полить примулу, но не заливать ни в коем случае. 

Зимой примулу я ничем не накрываю. Зимует без укрытия. Могу еще снега на нее накидать , тогда ей теплей будет.

Если конечно зима аномальная и дождливая , то могу просто накрыть примулу ведром пустым.

Ни в коем случае не ложите зимой на примулу , листья , солому, куски тряпок, мешки или чем фантазия порадует, как писала выше если боитесь морозовов , лучше сделайте сухое укрытие накройте ведром или пустой пластиковой бутылкой.

Ранней весной примулу открываю уже в конце февраля начало марта. И тогда она быстрей идет в рост и раньше начинает цвести.
Пробуйте , эксперементируйте и в благодарность вам ваши садовые питомцы ответят пышным ярким цветением.
   

Види примули і її сорти

Різні види примули

Ледве розмерзнеться грунт у весняному саду, як ми поспішаємо на зустріч з примули.

На темній землі шапки квітів – білих, синіх, жовтих, червоних, фіолетових, пурпурових, лососевих, з переливчасті мазками, з очима і без них, з каймою, гофрованих.

Багато садові види мають тонкий і досить сильним пряним ароматом. Декоративні і листя примули, а у деяких видів вони їстівні. Є рослини дуже маленькі – висотою всього 5-10 см, а є й такі, у яких суцвіття досягають 1 м. Хіба не диво? Милуватися примулами можна з ранньої весни до осені. Деякі види цвітуть у липні, серпні і навіть у вересні буває повторне, більш слабке цвітіння весняних видів. Примули невибагливі, зимостійкі, швидко розмножуються. Можуть рости в півтіні, рясно та тривало цвітуть, а відростаючих потім листя прикривають місця після мелколуковічних та тюльпанів.

Примули відносяться до сімейства первоцветних, в якому більш 500 видів, що виростають в Європі, Америці, Азії; 67 з них поширені в нашій країні. Деякі дикі примули дуже декоративні. Вони є ендеміками та включені до Червоної книги.

Примули – в основному багаторічні кореневищнi трави, зубчасті листя яких утворюють прикореневі розетки, як правило, зимуючі під снігом. Квіти можуть бути як одиночні, так і в зонтикоподібних або головчасте суцвіттях. Знаходяться вони, на квітконосах до 40 см заввишки, а у канделябровідних та інших подібних видів – до колотівками, у кілька ярусів, висотою до 90 см – 1 м.

В даний час існує величезна кількість гібридних форм і сюртогрупп примули. Всі види згруповані в 19 секцій. Представники деяких з них особливо цікаві і перспективні для садів і квітників. За термінами цвітіння примули можна згрупувати у дві великі групи – весняного і літнього цвітіння.

Примула – первоцвіт звичайний

Першим зацвітає первоцвіт звичайний (Primula vulgaris). У садових форм діаметр віночка квітки 2-5 см, є махрові форми. Висота рослини – 10-15 см. Листя відростають після цвітіння.

Йому на зміну приходить первоцвіт весняний (P. veris). Квітки до 2 см в діаметрі, яскраво-жовті, зібрані в парасольку. Висотою рослина до 20 см. Є безліч гібридних форм.

У квітні-травні вкривається суцільним килимом пурпурових квітів первоцвіт Юлії (P. juliae) – мініатюрне, до 5 см заввишки рослина з шкірястими блискучими округлим листям і одиночними квітками. Цей вид названий на честь Юлії Млокосевіч, що знайшла його на Кавказі в 1900 році.

Є численна група гібридів примули Юлії. Представники цієї групи мають більш значні розміри до 10 – 15 см і відомі під назвою примули пругоніцкой (P. pruhoniciana). Квітки у них більш різноманітного забарвлення, ніж у родоніт, чальніци, і можуть бути зібрані в парасольку. Відомо безліч сортів примули пругоніцкой Пурпуркіссен пурпурово-фіолетовий, Шнеекіссен – білий, Сильвія – Кармен-ново-рожевий. Є форми з лососевою-помаранчевими квітками.

Примула рожева (Р. rosea) – чарівне рослина, яскраво-кіноварний-рожеві блискучі квітки якого, зібрані в парасольку, розпускаються на початку травня, до появи листя. Самі листя подовжені, маленькі, шкірясті. У природі примула рожева зустрічається в Гімалаях, на висоті 3-4 тис. метрів. У культурі вона примхлива, вимагає невсипущої уваги, вважає за краще глинисто-торф’яну вологий грунт, але без застою води. Є крупноквіткова гібриди цієї примули.

Примула дрібнозубчаста (P. denticulata) в культурі з початку минулого століття. Привертає увагу круглими головчатого суцвіттями, 5-8 см в діаметрі, з дрібних квіток бузковим, білої, ліловим темно-фіолетовою, рожевого забарвлення, які з’являються в кінці квітня – початку травня до відростання листя. На одній рослині може бути 5-7 суцвіть. На темній землі квіти виглядають дуже ефектно, привертають, до себе перших весняних метеликів. Кульки суцвіть сидять на квітконосах висотою на початку цвітіння 10-15 см, відростаючих потім до 25-30 см. Квітконоси, а також листя з нижньої сторони покриті жовтим: борошнистим нальотом. Листя подовжені, зібрані в красиву розетку діаметром 35-40 см. Віддає перевагу світлим, зволожені місця.

Примула висока

Примула висока (P. elatior) зацвітає в першій декдде травня. Цей вид в природі широко поширений на Алтаї, Уралі, Кавказі. Має жовті квіти, зібрані в парасольку; висотою рослина до 20 см. Кореневище використовується в лікувальних цілях. Проте в садах вирощують численні гібриди цієї примули з квітками до 6 см в діаметрі і дивною гамою відтінків. Листя часто зморшкуваті, красиві, облямовують зграю квітів, які можна використовувати і для зрізання. Гібриди цієї примули об’єднані в сорто-групи: Гігантеа Грандйфлора, Ерфуртер Рейзен, Пасифік Джайнт, Фарбенсортен, Беінет Кестеман та ін В результаті селекційної роботи була отримана група примули, званих поліактовимі (Р. poiyantha). Це складний гібрид, що має безліч сортів, серед яких зустрічаються одноколерние з вічком, облямовані, переливчасті культиварів. Для цих примули характерні і різноманітність фактури пелюсток віночка, наявність гофрування, бахроми по краю пелюсток. Суцвіття – щиток з 10 – 15 квіток, кожен до 6 см в діаметрі. Листя зберігаються під снігом. Представники цієї групи зацвітають трохи пізніше, ніж попередні, і закінчують цвітіння на початку літа. Висота рослин 20-25 см. крупноквіткова представники цієї групи більш примхливі, але й більш декоративні.

Примула Ушков (P. auricula) розкриває свої жовті ароматні квіти у середині травня. Вони зібрані в парасольку висотою 20-25 см. Листя щільні, гладкі, округлі, в красивій розетки, зимують під снігом. Ця-то примула і була предметом поклоніння в середні століття за оксамитові пелюстки, як би обсипані жовтуватою пилком. Колекції коштували дуже дорого і були доступні тільки багатим людям. Зараз в культурі є складні гібриди цього виду з іншими примулами альпійського походження під єдиною назвою – примула аурікула, що мають безліч сортів з квітками різних кольорів і відтінків, зазвичай приглушених тонів, до 4 см в діаметрі.

На рубежі літа зацвітають примули кортузовідная і Зібольда. Кортузовідние примули (Р. cortusoides) зростають в Маньчжурії, Кореї, гірських лісах Східного Сибіру. Квітки рожево-малинових відтінків, 2-2,5 см в діаметрі, зібрані в парасольку висотою до 25 см. Листя длінночерешковие, яйцевидні, зубчасті. Примула Зібол’да (P. sieboldii) поширена в Амурській області, Маньчжурії, Японії, Забайкалля. Висота рослини 20-25 см. Квітки світло-і темно-лілові з білим центром, близько 3,5 см в діаметрі.

Кортузовідние примули

Є садові форми: Поллі – рожева, Міс Неллі Барнард – карміново-червона, Сноуфлейкс – біла і ін Особливістю цього виду примули, на яку варто звернути увагу при влаштуванні квітника, є часткове відмирання листя незабаром після цвітіння.

Примули, квітучі влітку, – це потужні рослини, досить високі – від 40 см до 1 м, з великими листям, незвичними суцвіттями і тривалим строком цвітіння. Всі вони скидають на зиму листя. Чутливі до різкого коливання температури навесні і тому пізно відростають. Не виносять застою води в коренях, воліють легку півтінь.

Не можна не відзначити примулу Віал (P. viall) – рідкісний поки що в наших садах вигляд. Батьківщина рослини – Китай. Листя у цієї примули подовжені, злегка опушені, покриті легким нальотом борошняним. Бутони яскраво-червоні, квітки дрібні бузкові, зібрані в шишкоподібної суцвіття – качан, квітконоси до 50 см заввишки. Є гібридні форми. Цей вид в культурі вимагає частого, відновлення насінням. Цвіте в червні протягом місяця, викликаючи незмінне захоплення глядачів.

Представники двох секцій candelabra і sikkimensis найпотужніші з сімейства первоцвітів завершують парад примули. Батьківщиною цих рослин є гірські райони Китаю, Гімалаї, Тибет, де вони ростуть на вологих луках на висоті до 4,5 тис. метрів.

Примули секції канделябрів цвітуть у червні-липні. Багатоярусні суцвіття складаються з 5-7 поверхів квіток, кожен з яких 1-2 см в діаметрі. Одне рослина може нести декілька таких канделябрів.

Примула японська (P. japonica) – найпоширеніший у садах вигляд. Цвіте в червні. Висота квітконоса до 50-60 см. Квіти малиново-червоної білого, рожевого та ін забарвлень розташовані на квітконосі в 5-6 поверхів.

Примула Буллея

Примула Буллея (P. bulleyana) має золотисто-жовті квітки і червонуваті бутони. Зацвітає в кінці червня – початку липня і цвіте протягом 3 тижнів. Висота рослини 50-60 см.

Примула Бісау (P. beesiana) цвіте одночасно з попереднім видом, але відрізняється яскравою пурпурово-фіолетовим забарвленням. Є Гібриди цих двох видів під загальною назвою Астор з квітками рожево-бузковою і жовто-оранжевого забарвлення.

Представники секції Сіккімський примули мають ароматні квіти дзвоникоподібна форми, зібрані в густе суцвіття.

Примула Сіккімський (P. sikkimensis) має квітконоси до 60 см заввишки, що несуть 30-35 жовтих квіток діаметром 2-2,5 см.

Примула Флорінди (P. florindae) – потужний рослина з длінночерешковимі листям. Яскраво-жовті квіти дзвоникоподібні в густому суцвітті підносяться над землею на квітконосах висотою близько 1 м. Вони поширюють сильний пряний аромат. Цвітіння триває довго, іноді до середини вересня. Висушені рослини можуть бути використані в зимовому букеті. Є гібридні форми з помаранчевими та малиново-червоними квітками.

Коротко про агротехніки вирощування примули. Переважна більшість цих рослин досить невибагливо, однак для успішного вирощування з пишним і тривалим цвітінням необхідно правильно вибрати місце посадки і враховувати деякі видові особливості. Основні місця проживання примули – високогірні луки, поляни і узлісся листяних лісів, добре освітлені навесні, тобто ділянки, де багато світла, повітря, вологи, але без її надлишку. Грунт необхідна пухка і поживна, Вона. не повинна пересихати і перегріватися. Чим більше вид, тим вище у нього потреба у волозі.

Примули висаджують як на відкритих ділянках, уздовж доріжок, у бордюрах і мікс-бордера, в альпіраніях і кам’янистих садах, так і в легкій півтіні, під поодинокими плодовими та декоративними деревами і кущами з пізно розпускається ажурною листям.

У грунт вносять велику кількість листового перегною, перепрілих гній, компост, пісок, повне мінеральне добриво, золу. У місцях, де поблизу грунтові води, а також на затоплюваних навесні ділянках роблять дренаж з щебеня або іншого відповідного матеріалу. Грунт глибоко, на штик лопати, перекопують, вибираючи кореневища багаторічних бур’янів.

Сіккімський примула

Залежно від розмірів рослин і їх призначення примули висаджують на відстані від 10-15 см для мініатюрних видів і до 40-50 см для великих рослин літнього цвітіння. Щоб прискорити декоративний ефект, посадки можна ущільнити, але тоді вони зажадають додаткового догляду і частого поділу. Садити примули весняного цвітіння можна практично в будь-який час, потрібно тільки часто поливати їх і обприскувати, притіняти від сонця. Невдачі бувають лише при посадці в жарку суху погоду і без постійного зволоження. Примули літнього цвітіння садять навесні до настання спекотної погоди або в серпні, але не пізніше середини вересня.

Догляд за примулами не складний. Протягом вегетаційного періоду землю спушують, підтримують у чистому від бур’янів вигляді, вологому стані, мульчують перегноєм. Рослини підгодовують або повним мінеральним добривом, або настоєм коров’яку 1:10 (пташиним послідом 1:20). Після цвітіння примули знаходяться деякий час в стані як би спокою. Цей період зазвичай збігається з жарким порою року. А щоб і в наступному році рослини радували пишним цвітінням, до осені вони повинні сформувати хорошу розетку з великими здоровими листям. Для цього в жаркий час постійно стежать за вологою в грунті, оголивши коріння і шийки рослин засипають живильної грунтовою сумішшю. Через 3-4 роки посадки примули загущувальну, цвітіння слабшає – рослини необхідно ділити. Їх викопують і гострим ножем розрізають на частини так, щоб кожна деленка мала 1 – 2 розетки і кілька корінців. Дуже довгі коріння злегка вкорочують. Зрізи присипають товченим деревним вугіллям. Поділені рослини висаджують таким чином, щоб центр розетки не був засипаний, і рясно поливають. Ділити примули краще в дощові дні в кінці липня – початку серпня. Примули літнього цвітіння ділять у травні, на початку відростання листя.

Розмножувати примули можна також насінням, а деякі види і живцюванням.

Свіжозібрані насіння сіють під зиму в грунт, або в теплиці, або в кімнаті в лютому-березні, в ящики із сумішшю листового перегною, вивітрених торфу і піску. Самі насіння дрібне, тому їх тільки злегка присипають землею. Посіви прикривають склом або поліетиленовою плівкою. Після появи сходів поступово привчають сіянці до свіжого повітря. Коли з’являться 2-3 аркуша, сіянці пікірують на постійне місце або в ящики. Дуже важливо не перезволожувати рослини, так як вони можуть загинути. Зацвітають сіянці на 2-й рік, а окремі сильні рослини – уже восени.

Для збереження бажаних властивостей примули краще розмножувати вегетативним способом. Деякі види можна черенковать, наприклад примулу аурікулу. Гострим ножем зрізують розетки і висаджують у суміш піску і вивітрених торфу. Зріз припудрюють деревним вугіллям. Постійно стежать за посадками: не пересушують, але й не перезволожують.

При дотриманні всіх правил агротехніки примули хворіють рідко. Але іноді на початку літа на листках утворюються округлі, буруваті плями з жовтою облямівкою. Листя поступово всихають, рослини сильно ослаблюються. Плямистість листя викликають грибки. З метою профілактики рослини обприскують ранньою весною або після цвітіння бордоською рідиною (1%) або хлорокісью міді (0,5%). У хворих рослин обривають і знищують листя, посадки обприскують тими ж розчинами. Найбільшою мірою уражуються п. Юлії та пругоніцкая, а ось п. японська, дрібнозубчаста і Флорінди плямистістю не хворів.

Японська примула

Від надлишку вологи можливо загнивання кореневої шийки. Одна з ознак захворювання – в’янення зовні здорових листя. Врятувати рослину можна, якщо відрізати розетку до здорової тканини, обробити товченим деревним вугіллям і висадити як черешок.

Примули прикрасять будь-яку ділянку. Природно й привабливо виглядають видові примули у квітниках ландшафтного типу, в альпінаріях, кам’янистих садах. На присадибній ділянці посадки примули доречні уздовж доріжок, у квітниках біля будинку, в миксбордерах. Висаджувати їх краще одноколірними куртинами по 8-12 штук на тлі листяних або хвойних чагарників, у композиціях з цибулинними, шилоподібним флокси, карликовими ірисами, арабісом і т. д. Гарні і поодинокі екземпляри в мініатюрних квітниках і рокарії. Ефектно виглядають примули літнього цвітіння біля водойм у поєднанні з декоративно-листяними рослинами – астильба, вузьколистий ірисами, купальниця, папороттю, хостом.

Хороші разноколерние групи на тлі газону. Яскраві, строкаті килими створюють свято навіть у похмурий день.

Є. Константинова

© Чудо-город

Город Первоцвета

Заседание наблюдательного совета Town of Primrose в октябре состоится в режиме телеконференции в понедельник, 4 октября 2021 года, в 20:00. Повестка дня этого собрания размещена ниже, в ратуше, в Маунт-Вернон-Авто и в церкви Примроуз. Сводка повестки дня будет доступна в системе голосовых сообщений по телефону 608-832-6660.

Люди могут присоединиться к телеконференции по телефону (978) 990-5000, код доступа 489616.

Поскольку Примроуз является городом-заповедником сельскохозяйственных угодий, для всех нас будет очень ценно, если земля будет навсегда использована в качестве сельскохозяйственных угодий.Пожалуйста, просмотрите следующий флаер, чтобы узнать больше о доступных программах:

Комиссия по планированию города Примроуз проведет осмотр объекта в субботу, 2 октября 2021 г., по следующему адресу:

10:00 Дуэйн и Бренда Дигенталер

7965 Ritschard Road. Посылки 0507-364-8501-5 и 0507-364-8070-7.

Post: 27 сентября, 2021

Город Примроуз проведет семинар по бюджету во вторник, 28 сентября 2021 года, в Ратуше, начало в 19:00.

8468 County Road A, Верона, Висконсин 53593

ЭТО ЛИЧНАЯ ВСТРЕЧА. СЛЕДУЮЩИЕ ДОЛЖНЫ НОСИТЬ МАСКИ ДЛЯ ЛИЦА И СОБЛЮДАТЬ СОЦИАЛЬНОЕ РАССТОЯНИЕ.

Заседание Комиссии по планированию города Примроуз в сентябре состоится в режиме телеконференции в понедельник, 20 сентября 2021 года, начало в 19:30. Повестка дня этой встречи размещена ниже, в Mount Vernon Auto и Primrose Church. Сводка повестки дня будет доступна в системе голосовых сообщений по телефону 608-832-6660.

Люди могут присоединиться к телеконференции по телефону (978) 990-5000, код доступа 489616.

Заседание наблюдательного совета Town of Primrose в сентябре состоится в формате телеконференции во вторник, 7 сентября 2021 года, в 20:00. Повестка дня этого собрания размещена ниже, в ратуше, в Маунт-Вернон-Авто и в церкви Примроуз. Сводка повестки дня будет доступна в системе голосовых сообщений по телефону 608-832-6660.

Люди могут присоединиться к телеконференции по телефону (978) 990-5000, код доступа 489616.

Повестка дня: 2021-09-07 Повестка дня

Пожарная служба Маунт-Хориб Предлагаемый бюджет: 2022 год. Сбор в MHFD – предварительный

.

Расчет грантов ARPA: расчет потерянного дохода WTA – Primrose

УВЕДОМЛЕНИЕ ОБ ОБЩЕСТВЕННЫХ СЛУШАНИЯХ ДЛЯ

ГОРОД ПРИМРОЗ, ДЕЙН, ВИСКОНСИН

Вторник, 7 сентября 2021 г.

Настоящим сообщается, что во вторник, 7 сентября 2021 года, в 19:00 в городе Примроуз пройдут общественные слушания относительно разрешения на условное использование вышки беспроводной связи по адресу 9108 Ridge Drive, Mount Horeb, Wisconsin.Встреча состоится в режиме телеконференции. Чтобы присоединиться к встрече, наберите (978) 990-5000 код доступа 489616. Осмотр объекта будет проводиться в отеле 28 августа, -е, , 2021 г., начало в 10:00.

От 5 -го числа г. августа 2021 г.

Автор: Рут Хансен, клерк, город Примроуз.

Публичное уведомление: 21.08.21, 26.08.21

Заседание комиссии по планированию 16 августа отменено.

Заседание наблюдательного совета города Примроуз в августе состоится в режиме телеконференции в понедельник, 2 августа 2021 года, в 20:00.Повестка дня этого собрания размещена ниже, в ратуше, в Маунт-Вернон-Авто и в церкви Примроуз. Сводка повестки дня будет доступна в системе голосовых сообщений по телефону 608-832-6660.

Люди могут присоединиться к телеконференции по телефону (978) 990-5000, код доступа 489616.

Заседание Комиссии по планированию города Примроуз в июле состоится в режиме телеконференции в понедельник, 19 июля 2021 года, в 19:30. Повестка дня этого собрания размещена ниже, в ратуше, в Маунт-Вернон-Авто и в церкви Примроуз.Сводка повестки дня будет доступна в системе голосовых сообщений по телефону 608-832-6660.

Люди могут присоединиться к телеконференции по телефону (978) 990-5000, код доступа 489616.

Неутвержденных минут:

Чугачский национальный лес – палаточный лагерь «Примула»

Статус зоны: Открыто

Кемпинг Primrose открыт – услуги доступны и взимается плата – май 2021 года.

Летний кемпинг закончился. Однако некоторые из наших кемпингов работают до тех пор, пока не пойдет снег. Если палаточный лагерь открыт, ворота будут открыты, и размещение кемпинга осуществляется в порядке очереди.

В межсезонье нет воды, мусора и сборов. Пожалуйста, соберите весь мусор. Туалеты и туалеты могут быть недоступны.

Этот кемпинг включает 8 площадок и никаких подключений.

Вода, туалеты, столы, костровые ямы, мусорные баки и трап для лодки.

Этот кемпинг расположен недалеко от тропы Примроуз и рядом с озером Кенай. $ 14 / ночь

Краткий обзор

Текущие условия: Primrose Campground работает в порядке очереди. Нет доступных услуг и комиссии не взимаются.
Часы работы: Вы можете быть в курсе событий и новостей, касающихся Чугачского национального леса, подписавшись на нас в Twitter @ChugachForestAK и Facebook или проследив за нашим календарем событий на нашей домашней странице.
Бронирование: Кемпинг Primrose не бронируется. У входа в палаточный лагерь есть абонентская касса.

Общая информация

Маршрут:

Путешествуйте на юг по шоссе Сьюард к Майлпосту 17.


Общие примечания:

Местность в основном состоит из больших еловых деревьев возле Примроуз-Крик и озера Кенай.


компьютерная программа для создания и оценки филогенетического диапазона олигонуклеотидных зондов и праймеров 16S рРНК в сочетании с базой данных RDP-II

Разработка программы и работа

PRIMROSE была написана для тесного взаимодействия с загружаемой версией базы данных RDP для определения полезных филогенетических зондов и праймеров.На рисунке показан его общий дизайн. PRIMROSE использует файл RDP SSU_Prok.gb, который содержит все выровненные в настоящее время последовательности 16S рРНК в формате GenBank (16 277 записей для версии 8.1). Он также использует связанные файлы SSU_Prok.alpha, SSU_Prok.phylo и SSU_Prok.phylo.stats, которые содержат информацию о названиях бактерий, филогенетических позициях и статистической информации.

Блок-схема, обобщающая процедуру, которой следует PRIMROSE для идентификации олигонуклеотидов. SSU_Prok.gb – это файл в формате GenBank, созданный RDP, содержащий все выровненные в настоящее время записи последовательностей 16S рРНК (в настоящее время всего 16 277 записей в версии 8.1). SSU_Prok.alpha, SSU_Prok.phylo и SSU_Prok.phylo.stats – это связанные файлы, также из RDP, которые предоставляют дополнительную филогенетическую информацию об этих записях. Все файлы доступны на веб-сайте RDP по адресу http://rdp.cme.msu.edu/html/download.html.

PRIMROSE идентифицирует потенциально полезные олигонуклеотиды из набора «целевых» последовательностей 16S рРНК, предоставленных пользователем. PRIMROSE принимает выходные данные из любого программного пакета, способного генерировать выходные данные в форматах GenBank, Fasta или Clustal.Однако, чтобы все возможности PRIMROSE были доступны, RDP_short_ID должны использоваться для идентификации записей везде, где это возможно. По этой причине PRIMROSE лучше всего работает в сочетании с онлайн-инструментами, предлагаемыми RDP, и, в частности, с браузером иерархии RDP. Это средство позволяет пользователю изучить текущую базу данных выровненных 16S рРНК и выбрать для загрузки интересующие последовательности в виде текстовых файлов в формате GenBank.

Размер файлов, которые может обрабатывать PRIMROSE, теоретически ограничен только объемом памяти, установленной на компьютере.Однако для описания большого количества последовательностей мы сочли более эффективным выбрать несколько репрезентативных записей. Таким образом, при поиске олигонуклеотида, который мог бы описывать большую группу, такую ​​как подразделение CFB, мы обнаружили, что необходимо только выбрать репрезентативную запись из каждой из основных групп, составляющих эту группу (т.е. 15 записей из доступных 781 выровненных последовательностей). . Предпочтение было отдано полноразмерным или почти полноразмерным последовательностям 16S рРНК из надежного источника, и браузер иерархии RDP упростил этот выбор.

PRIMROSE использует один из двух алгоритмов для идентификации уникальных олигонуклеотидов из целевых последовательностей в зависимости от того, выровнены ли данные или нет. Если выровнено, используется алгоритм 1. Этот алгоритм позволяет генерировать вырожденные олигонуклеотиды с двумя вырожденными положениями. Алгоритм 1 можно резюмировать следующим образом.

Алгоритм 1 . (i) Из набора данных последовательностей N S длиной L S создается матрица, в которой каждая строка содержит отдельную последовательность, а каждый столбец представляет отдельную базовую позицию в каждой последовательности.(ii) Для каждого из столбцов матрицы L S количество оснований A, T, G и C (т. е. N A , N T , N G , N C ). Также учитываются зазоры ( N зазор ). (iii) Для каждого из столбцов матрицы L S консенсусная база для этой позиции определяется на основе этих оценок, то есть

Если N A = N S , base = A

Иначе, если N T = N S , база = T

Иначе, если N G = N S , база = G

42 , если C = N S , основание = C

Иначе, если N A + N G = N S , база = R

Иначе, если N + N C = N S , база = M

Иначе, если N A + N T = N S , 9 base = W El 9000 если N C + N T = 901 39 N S , основание = Y

Иначе, если N C + N G = N S , основание = S

Иначе, если G 4 + N T = N S , база = K

Иначе, если N A + N G + N C = S 4 4 base = V

Иначе, если N A + N G + N T = N S , base = D

Else if N C N G + N T = N S , база = B

Иначе, если N A + N C + N 901 N S , основание = H

Остальное, если N пробел = N S , основание = –

Остальное основание = N

(iv) Консенсусные основания из столбцов L S объединяются для получения единой согласованной последовательности.(v) Любые – символы (представляющие общие пробелы) в последовательности удаляются. (vi) Все возможные олигонуклеотиды длиной L O , которые могут быть получены из консенсусной последовательности, хранятся в массиве. Содержимое этого массива впоследствии может быть отсортировано по олигонуклеотидам с нулем, одним, двумя или более вырожденными положениями в соответствии с количеством присутствующих неканонических оснований.

Если используются невыровненные данные последовательности, PRIMROSE автоматически переключается на альтернативный алгоритм, алгоритм 2.Этот алгоритм не требует согласованных данных, но может идентифицировать только невырожденные олигонуклеотиды. Несмотря на эту функцию, мы настоятельно рекомендуем пользователям использовать данные выровненных последовательностей везде, где это возможно. Алгоритм можно резюмировать следующим образом.

Алгоритм 2 . (i) Хранить в массиве все возможные олигонуклеотиды длиной L O , которые могут быть сгенерированы из последовательностей N S в наборе данных. (ii) Рассчитайте, сколько раз каждый олигонуклеотид встречается в массиве, затем удалите все множественные копии, чтобы массив был заполнен только уникальными олигонуклеотидами.(iii) Сохранить те олигонуклеотиды с оценками, равными или превышающими пороговое значение, определенное пользователем. Это минимальное количество последовательностей, которые должен описывать олигонуклеотид.

Уникальные олигонуклеотиды, сгенерированные алгоритмом 1 или 2, затем сравниваются с последовательностями в полной базе данных и ранжируются в соответствии с количеством записей, которые они соответствуют, внутри и за пределами своего целевого таксона, как это определено PRIMROSE из их RDP_short_ID (рис. .). Алгоритм, используемый на этом этапе, можно резюмировать следующим образом.

Используя данные последовательности, выбранные из RDP, PRIMROSE идентифицировал диапазон возможных олигонуклеотидов для деления CFB. Каждый перечисленный олигонуклеотид представляет собой гипертекстовую ссылку на дополнительную информацию о филогенетическом диапазоне этой последовательности.

Алгоритм 3 . (i) Из каждого олигонуклеотида создается строка поиска, в которой любое неканоническое основание заменяется простым регулярным выражением, т.е. заменяется M на [AC], R на [AG], W на [AT], S на [CG] , Y с [CT], K с [GT], B с [CGT], D с [AGT], H с [ACT], V с [ACG] и N с [ACGT].(ii) Каждая последовательность в базе данных ищется на совпадение с каждым модифицированным олигонуклеотидом. Если совпадение происходит, запишите попадание. Если происходит попадание и намеченная мишень для олигонуклеотида была определена, оцените, совпадает ли номер доступа для этой последовательности с какой-либо из намеченных мишеней. Если подобранная последовательность не является предполагаемой целью, запишите попадание не по цели. Если количество нецелевых попаданий превышает пороговое значение, определенное пользователем, прервите этот поиск и перейдите к следующему олигонуклеотиду.

PRIMROSE представляет отдельные результаты поиска в формате филогении, аналогичном тому, который используется RDP (рис.). Кроме того, PRIMROSE графически представляет положение олигонуклеотида в его целевом таксоне (рис.). Программа определяет те последовательности в целевом таксоне, которые пропущены из-за того, что они слишком короткие, и на основе этой информации рассчитывается более точная оценка охвата целевого таксона (рис.). Этот аспект программы также можно запускать независимо от PRIMROSE, как отдельное приложение под названием ROSE.ROSE находится в каталоге PRIMROSE и позволяет пользователю исследовать олигонуклеотиды, отличные от тех, которые идентифицированы PRIMROSE.

Дополнительная информация о вырожденном олигонуклеотиде WCCCTTTAAACCCART (зонд CFB560), который был выбран для дальнейшего исследования путем щелчка по гипертекстовой ссылке, показанной на рисунке. В этом окне отображается часть филогенетической разбивки тех записей RDP, на которые нацелен этот олигонуклеотид.

Дополнительная информация об интересующем олигонуклеотиде.В этом примере программа показывает диапазон и положение четырех невырожденных версий вырожденного зонда CFB560 (12).

Результаты in silico

В таблице перечислены те олигонуклеотиды, которые обычно цитируются в литературе как подходящие зонды для идентификации представителей альфа-, бета-, дельта- и гамма-протеобактерий, а также подразделения CFB. Теоретические таксономические диапазоны этих зондов в контексте последней согласованной базы данных RDP (v.8.1) были определены и показывают, что почти во всех случаях, когда анализ был возможен, существующие зонды описывали 30–76% их целевых групп, как определено в настоящее время.Единственным исключением был недавно разработанный CFB560, зонд вырожденного CFB, который описывает 94% целевой группы. Мало того, что прогнозируемый охват большинства этих зондов был относительно низким, но и в четырех случаях количество нецелевых записей, с которыми они сопоставлялись, превышало 180 записей последовательностей.

PRIMROSE успешно идентифицировала ряд хороших потенциальных олигонуклеотидов для всех целевых групп, описанных в таблице. В таблице перечислены лучшие из этих зондов, а также их прогнозируемые таксономические диапазоны согласно текущей базе данных RDP.Для многих рассматриваемых таксонов PRIMROSE идентифицировал зонды с охватом> 84%, часто с очень небольшим количеством совпадений, не относящихся к целевой группе.

Таблица 2.

Возможные олигонуклеотиды 16S рРНК, идентифицированные в этом исследовании с помощью PRIMROSE, вместе с их теоретическим диапазоном согласно версии 8.1 базы данных 16S рРНК RDP

ATTC ATT50 T CCACCA β 900 97 67

98 CTACAT

98 CTACAT

98

46 TCC TCC 3 3 3 TRCTC 3 3 950 ATC 9044 9044 9044 3 3 3 3 целевой диапазон, точное определение хорошего олигонуклеотида может варьироваться в зависимости от области применения.Факторы, которые могут быть важными, включают расположение мишени олигонуклеотида в последовательности 16S рРНК, количество самокомплементарностей в олигонуклеотиде и количество несовпадений с последовательностью, не являющейся мишенью. Для дальнейшего сравнения в таблицах и перечисляется эта дополнительная информация, которая была либо сгенерирована PRIMROSE, либо получена из интерактивного средства PROBE_MATCH RDP. В целом, за исключением CFB560, PRIMROSE смогла найти олигонуклеотиды, которые работали значительно лучше, чем те зонды 16S рРНК, которые используются в настоящее время.

ПРИМРАЗА – ПРИМУЛА ​​- Southern Living

Семейство: Примуловые | Род: PRIMULA

Тип: Однолетние, Многолетние растения

Воздействие на солнце: Частичная тень

Вода: Обычная Вода

Детали растения

Примулы образуют пучки листвы, над которыми возвышаются цветущие стебли, несущие эффектные круглые пятилепестковые цветы. поздней зимой и весной. Цветы могут приходить на отдельные стебли, группами на концах стебля или ярусными группами, такими как канделябры на стебле.

Большинство первоцветов произрастают в Гималаях и прохладных регионах Юго-Восточной Азии и Европы, поэтому они хорошо себя чувствуют в сочетании с влажной богатой почвой и прохладным влажным воздухом. Лишь немногие районы юга удовлетворяют этим условиям. Хотя большинство примул, перечисленных ниже, будут расти как многолетние растения в указанных зонах, многие из них лучше всего рассматривать как однолетние растения для прохладной погоды.

auricula

primula auricula
  • Зоны US, MS, LS; USDA 6-8.
  • До 68 дюймов высотой, с широкими кожистыми серо-зелеными листьями до 5 дюймов длиной, образующими розетки до 1 фута шириной.
  • Цветет ранней весной, несёт грозди ароматных желтых или белоглазых цветов разных цветов, включая оранжевый, розовый, розовый, красный, фиолетовый, синий, белый, кремовый и коричневатый.
  • Обычно выращивают в горшках.

волынка

Primula elatior
  • Зоны US, MS, LS; USDA 6-8.
  • Листья до 8 дюймов длиной, опушенные с нижней стороны, образуют пучки листвы шириной до 10 дюймов.
  • Серно-желтые весенние цветы появляются многоцветковыми гроздьями на стеблях от 8 до 12 дюймов.

примула японская

primula japonica
  • Зоны US, MS, LS; USDA 6-8.
  • Из Японии.
  • Крепкие двухфутовые стебли несут на завитках до пяти желтоглазых пурпурных цветов.
  • Листья 69 дюймов в длину и 3 дюйма в ширину; комки вырастают примерно на 1 фут в ширину.
  • Среди лучших сортов – «Alba» (белый), «Apple Blossom» (бледно-розовый с красным глазом), «Miller’s Crimson» (красный) и «Postford White» (белый с красным глазом).
  • Достаточно воды; будет расти даже на мелководье.

примула juliana

гибриды примулы juliae
  • Зоны США, MS, LS; USDA 6-8.
  • Округлые, ярко-зеленые листья с зубчатыми краями и длиной до 2 дюймов образуют розетку шириной 10 дюймов.
  • Ранней весной цветки распускаются поодиночке или группами на стеблях от 3 до 4 дюймов; цвета включают белый, синий, желтый, оранжевый, красный, розовый, фиолетовый.
  • Отлично подходит для обрезки кромок, лесных массивов, альпинариев.
  • Лучше всего использовать обычную воду, но подходит для более сухой почвы, чем для большинства примул.

примула фея, примула беби

primula malacoides
  • Обычно выращивается как однолетнее (комнатное растение в горшке).
  • Вечнозеленые розетки шириной в фут, состоящие из мягких, бледно-зеленых, длинноплодных листьев, овальной формы с лопастными и срезанными краями, длиной 13 дюймов.
  • Белые, розовые, розовые, красные или лавандовые цветки в кружевных завитках вдоль вертикальных стеблей высотой 8–15 дюймов.
  • Хорошо подойдет под деревьями с высокой ветвью, с весенними луковицами, на клумбах.
  • Переносит легкий мороз.
  • Доступен из теплиц в конце зимы и в начале весны.
Primula obconica
  • Обычно выращивается как однолетнее (комнатное растение в горшке).
  • Белые, розовые, лососевые, бледно-лиловые или красновато-пурпурные цветы, шириной 12 дюймов, в широких скоплениях на стеблях длиной 1 фут.
  • Растения достигают 1 фута шириной.
  • Вечнозеленые, округлые, опушенные листья на длинных стеблях.
  • Волосы на стеблях (кроме волос сорта Freedom) могут раздражать кожу.
  • Доступен из теплиц в конце зимы и в начале весны.

примула polyanthus

primula x polyantha
  • Зоны США, МС; USDA 6-7, обычно выращивается как однолетник.
  • Часто называют примулой английской.
  • Глыбы листвы шириной до 9 дюймов; зеленые листья длиной 8 дюймов напоминают салат ромэн.
  • Сезон цветения длится с зимы до ранней или середины весны; Цветки многих ярких цветов шириной от 1 до 2 дюймов собираются в большие полные грозди на стеблях высотой 1 фут.
  • Миниатюрные виды Polyanthus имеют более мелкие цветки на более коротких стеблях.
  • Выбирайте из множества сортов с крупными цветками, таких как Crescendo и Pacific Giant, или ищите новинки, такие как группа Gold Lace, с золотыми краями, желтыми центрами и глубокими лепестками красного дерева; ‘Zebra Blue’ с прекрасными лепестками в бело-голубую полоску; ‘Penumbra’, похожая, с лепестками с серебряной окантовкой; и «Гвиневра» с бронзовой листвой и нежно-розовыми желтоглазыми цветами.
  • Все для массирования, компаньонов для луковиц или горшков.

примула азиатская

primula sieboldii
  • Зоны США, MS, LS; USDA 6-8.
  • Вырастает 1 фут в высоту и ширину, с овальными, светло-зелеными, глубоко лопастными и зубчатыми листьями.
  • Ранней весной дает белые, розовые или пурпурные цветки с белыми глазками шириной 1 дюйм каждое, по 2–15 гроздей.
  • Множество названий в темных или светлых тонах; цветки некоторых имеют бахромчатые лепестки.
  • Листья всех типов обычно отмирают вскоре после цветения.

cowslip

primula veris
  • Зоны США, MS, LS; USDA 6-8.
  • Листья до 8 дюймов длиной, слегка опушенные с нижней стороны, образуют комок шириной до 10 дюймов.
  • Большие грозди ароматных ярко-желтых (иногда красных или абрикосовых) цветов держатся на стеблях от 8 до 12 дюймов.
  • Цветки «Закатных оттенков» имеют желтые горлышки и лепестки от оранжевого до темно-красного цвета.

примула английская, примула

примула обыкновенная
  • Зоны США, MS, LS; USDA 6-8.
  • Пучки листьев, очень похожие на листья Primula polyantha; комки вырастают примерно на 1 фут в ширину.
  • Весенние цветы обычно растут поодиночке на 8-дюймовых стеблях, хотя некоторые садовые сорта имеют два или три цветка на стебле; цвета включают белый, желтый, красный, синий, бронзовый, коричневый и винный.
  • Одинарные серии, такие как Danova, душистая Primera и крупноцветковая Supreme, распространены повсеместно, но серии с двойными и розовыми цветами, такие как Belarina и Rosanna, набирают популярность.
  • Гибриды, называемые ирландскими первоцветами Кеннеди, включают «Драмклифф» с цветками, выходящими из светло-лиловых, переходящих в белые с желтым глазком, и «Иннисфри» с желтоглазыми красными цветками на бронзово-пурпурной листве.
  • Используется в качестве обрезки в лесном саду.

Примула: Профиль многолетнего растения

Примулы – это многолетние растения, произрастающие в климатических условиях от мягких до экстремальных, размером от нескольких дюймов до нескольких футов в высоту. Хотя существует много видов, широко доступны лишь некоторые из них. Найдите редкие виды в обществах растений и каталогах. Цвета прекрасны, иногда невероятны, оттенки помады розового, темно-синего, золотого, желтого, красного и пурпурного цветов и многие другие.Не все виды бывают всех цветов.

Многолетние растения Галерея изображений

Как вырастить: Большинство примул предпочитают влажную, но хорошо дренированную почву, прохладную, но не отрицательную температуру, и среднее плодородие. Садовые примулы можно разделить осенью и сразу же пересаживать на меньшем расстоянии, стараясь не повредить стержневые корни. Для большинства типов лучше всего подходит частичный оттенок, но это бывает по-разному.

Размножение: Делением и семенами.

Использование: Используйте примулы в горшках, на грядках и натурализованные в садах у реки.

Родственные виды: Primula veris – это примула желтая дикого типа, которая использовалась во многих гибридах. У P. denticulata, примулы голени, есть шары цветов на прямых стеблях. P. heladoxa – это тип канделябров с узкими мутовками цветов на высоких стеблях. P. japonica любит заболоченные почвы. Это еще один канделябр с эффектными цветочными брызгами или завитками в два фута высотой. P. viallii розовая, заостренная, с цветками, раскрывающимися снизу вверх; и P. bulleyana имеет ржаво-оранжевые цветки.

Научное название: Вид примулы

Если вам нравятся сюрреалистические цвета примулы, но у вас нет открытого сада, подумайте о том, чтобы вырастить ее как комнатное растение. Мы покажем вам, как это сделать, в следующем разделе.

Хотите больше информации? Попробуйте эти:

  • Многолетние цветы: Наполните свой сад красивыми многолетними цветами. Они организованы по высоте, типу почвы, солнечному свету и цвету.
  • Многолетние растения: Сад многолетников – это нечто большее, чем просто великолепные цветы.Узнайте обо всех многолетних растениях, которые могут украсить ваш сад.
  • Однолетние цветы: Дополните свои многолетние растения этими великолепными однолетними цветами. Мы сгруппировали их по цвету, солнечному свету, типу почвы и высоте, чтобы упростить планирование вашего сада.

первоцвет – Викисловарь

Английский [править]

Этимология [править]

Среднеанглийский первоцвет , старофранцузский первоцвет , средневековый латинский prima («первый») + rosa («роза»).Причина, по которой это было названо так, может быть в том, что некоторые примулы являются одними из первых цветов, которые распускаются весной.

Произношение [править]

Существительное [править]

первоцвет ( множественное число первоцвет )

  1. Цветковое растение рода Primula .
    1. В частности, вид Primula acaulis (син. Primula vulgaris ), также называемый примулой обыкновенной .
  2. Растение семейства Primulaceae.
  3. Растение из рода Oenothera , более известное как примула вечерняя.
  4. Цветок первоцвета.
  5. Светло-желтый цвет.

    первоцвет:

Синонимы [править]
Производные термины [править]

Термины, образованные от первоцвет (существительное)

Переводы [править]

растение рода Primula

растение семейства Primulaceae

Приведенные ниже переводы необходимо проверить и вставить выше в соответствующие таблицы переводов, удалив все числа.Числа не обязательно совпадают с числами в определениях. См. Инструкции в Викисловаре: Макет статьи § Переводы.

Проверяемые переводы

См. Также [править]

Прилагательное [править]

первоцвет ( сравнительный больше первоцвет , превосходный первоцвет )

  1. Светло-желтого цвета.
    • 1961 Февраль, «Новые мини-буфеты» от Wolverton », в Trains Illustrated , стр. 79:

      Пассажирские салоны со вкусом обставлены деревянным шпоном и перегородками, пестрые серые стены из вианида, бледный первоцвет потолки и серый пол.

Переводы [править]

Глагол [править]

первоцвет ( простое настоящее в единственном числе в третьем лице первоцветы , причастие настоящего первоцвет , простое причастие прошедшего и прошедшего времени первоцвет )

  1. (непереходный) Для сбора примул.
    Мы пошли за в воскресенье и вернулись с полной корзиной.

Ссылки [править]

Анаграммы [править]

Лоусон, Элизабет: 9781789140774: Amazon.com: Книги

“Книга Лоусона украшена более чем 100 другими великолепно воспроизведенными иллюстрациями: ботанические рисунки отдельных растений, фотографии, гербарные листы, электронные микрофотографии, рукописные письма с линейными рисунками, портреты селекционеров и историков примулы, а также плакаты из популярной культуры с изображением цветка. Вокруг и среди этих визуальных удовольствий поразительные сгущения истории и биографии … Авторская радость пронизывает наши богато иллюстрированные словесные путешествия из Шотландии в Турцию и Тибет к одной южноамериканской примуле.Этот труд любви включает в себя исчерпывающий указатель, список ассоциаций и веб-сайтов, отличную библиографию, 20 страниц ссылок и превосходную хронологию. . . . Primrose – новейшее дополнение к серии Botanical от Reaktion Books Ltd. Что касается фразы из «Гамлета», повторно использованной многими – возможно, наиболее трогательно Оскаром Уайльдом в De Profundis – «путь первоцвета» исследуется как метафорически, так и буквально в книге Лоусона. прекрасно написанная книга. Я оставляю тебе, дорогой читатель, твои собственные приятные приключения с ней через множество красок и значений.”

Североамериканское общество садов камней,” Книга месяца “

” Это всеобъемлющее исследование ботанического рода Primula является частью серии ботанических исследований Reaktion, которая объединяет садоводческую и ботаническую информацию о группах растений с социальными и культурными информация о группе. Первоцветы – одни из самых важных садовых цветов, особенно в Европе. . . . Книга красиво оформлена, богата красочными иллюстрациями и написана простым стилем, включающим множество анекдотов.Рекомендуется. “

Выбор

Примула полна увлекательной исторической информации. . . . Книга, безусловно, расширила мой взгляд на историю первоцветов. Это восхитительное чтение. Я призываю вас углубиться в эту хорошо изученную и информативную книгу. . . . Ваша следующая прогулка по тропе примулы даст вам совершенно новое представление о разновидностях примулы ».

Журнал Американского общества примулы

« Серия ботанических книг Reaktion Books продолжает впечатлять. Примула – еще один триумф, пополняемый растущей коллекцией. Это хорошо написанный, богато иллюстрированный, изобилие первобытных первоцветов, анекдотов и истории культуры: прочтите это! »

Botany One

« Простая красота наших местных примул покоряла сердца людей на протяжении веков и эта книга является одновременно и рекордом, и праздником этой тесной привязанности. . . . Такое широко распространенное растение, как можно было представить, проникло во многие аспекты нашего общества и культуры, и автор приводит интересные примеры его места в литературе, музыке и даже политике.Такой более широкий взгляд на примулы значительно расширяет нашу оценку и удовольствие от этих растений и показывает, что наряду с их простой красотой и очаровательной привлекательностью примулы также занимают культурную нишу в нашем обществе. Прочитать об этих других аспектах первоцветов – значит получить от них еще большее удовольствие. Эта книга предоставляет такую ​​возможность ».

– Пэдди Тобин – Ирландский садовник

« Я был впечатлен изысканным переплетом, качеством печати и содержания. . . . Книга щедро иллюстрирована, и Лоусон обнаружил много новых картинок и картин семьи Примула.. . . Этот том представляет собой освежающе новый и эрудированный взгляд на семейство Primula, который понравится любителям Primula во всем мире ».

– Вэл Вули, селекционер и садовод.

Добавить комментарий

Ваш адрес email не будет опубликован. Обязательные поля помечены *

Последовательность (антисмысловая 5 ‘→ 3’)
Положение a
Предполагаемая цель
Нецелевое
Имя b Размер c Hits (no.) d Ударов (%) e Ударов f Увеличение с одним несоответствием g База «Проблем» (% совпадений) h Возможные структуры шпильки i
ATTTCACCTCTACACT 682–697 α 1968 1350 87,9 48 1398 9 (81,9) 0
1968 1269 82.7 49 910 11 (74,0) 0
TGCCGCCAGCGTTCGYT 28–44 1968 891 81,2 38 1 2
CSAATATCTACGAATTT 694–710 1968 1159 75,5 12 392 13 (54,3) 0
1085 851 93.0 10 2315 13 (98,0) 1
RCATMTCTACGCATTTCACT 690–709 1085 722 89,0 77004 0
ACGCATTTCACTGCTACACG 682–701 1085 701 86,4 6 905 12 (77,6) 0 12 (77,6) 0 0 0 1085 689 85.1 0 499 2 (96,4) 1
CACCCGTGCGCCRCTYTACT 96–115 δ 545 285 74,0 285 74,0 285 74,0 285 74,0 2
TTAGCCGGYGCTTCCT 495–510 545 283 67,1 9 3255 15 (88,8)
15 (88,8) 1 545 270 64.1 4 2746 15 (86,9) 1
CCGTCAATTCATTTGAGTTT 907–926 γ 2949 1757 1162 75,1 2
GTCAATTCATTTGAGTTTTA 905–924 2949 1746 74,7 33 4066 9 (98,6) 9 (98,6) 9 (98,6) TRCTC Enterics 762 424 90.2 33 122 14 (54,9) 0
CTRCTTCTTTTKCAACCCAC 1419–1438 762 416 88,5 330097 900 97 0
CCCTTTAAACCCARTRA 561–577 CFB 781 616 94,2 8 619 8 (84,8) 0 8 (84,8) 0
0
Бактероиды 352 297 94.6 2 72 15 (61,1) 0
GTGCTGATTTGACGTCATCC 1186–1205 352 248 80 94,3 597 492 900 900 1
CATTTCACCGCTACACYACW 679–698 Группа цитофагов I 241 162 94,7 44 304 20 (ACT 62,2) 20 (ACT 62.2) 20 (ACT 62.2) 20 (ACT 62,2) 875 241 161 93.1 2 129 10 (38,8) 0
ATACTTATCACTTTCGCTTG 858–877 C.uliginosa группа 16 11 84 84 20 (97,6) 1
TTATCACTTTCGCTTGGCCG 854–873 16 9 69,2 0 16 20 (563 9) 16 20 (563 9)